יישום של הפרעת RNA בנמטודת אורן, בורסהפלנצ'וס קסילופילוס
Summary
כאן, אנו מציגים שיטת השרייה מפורטת של הפרעת RNA ב Bursaphelenchus xylophilus כדי להקל על המחקר של תפקודי גנים.
Abstract
נמטודת עצי האורן, Bursaphelenchus xylophilus, היא אחד המינים הפולשים ההרסניים ביותר בעולם, וגורמת בסופו של דבר למותם של עצי אורן. למרות ההכרה בחשיבותם הכלכלית והסביבתית, עד כה לא ניתן היה לחקור את תפקודי הגנים המפורטים של נמטודות טפיליות צמחיות (PPNs) באמצעות גנטיקה קונבנציונלית קדימה ושיטות מהונדסות. עם זאת, כטכנולוגיה של גנטיקה הפוכה, הפרעות RNA (RNAi) מקלות על חקר הגנים הפונקציונליים של נמטודות, כולל B. xylophilus.
מאמר זה מתווה פרוטוקול חדש ל-RNAi של הגן ppm-1 ב-B . xylophilus, אשר דווח כי הוא ממלא תפקידים מכריעים בהתפתחות וברבייה של נמטודות פתוגניות אחרות. עבור RNAi, מקדם T7 היה מקושר למסוף 5′ של מקטע המטרה על ידי תגובת שרשרת פולימראז (PCR), ורנ”א דו-גדילי (dsRNA) סונתז על ידי שעתוק במבחנה . לאחר מכן, אספקת dsRNA הושגה על ידי השריית הנמטודות בתמיסת dsRNA מעורבבת עם נוירוסטימולנטים סינתטיים. צעירים מסונכרנים של B. xylophilus (כ-20,000 פרטים) נשטפו והושרו ב-dsRNA (0.8 מיקרוגרם/מ”ל) במאגר ההשריה במשך 24 שעות בחושך בטמפרטורה של 25 מעלות צלזיוס.
אותה כמות של נמטודות הוכנסה למאגר ספוג ללא dsRNA כבקרה. בינתיים, כמות זהה נוספת של נמטודות הוכנסה למאגר ספוג עם הגן dsRNA של חלבון פלואורסצנטי ירוק (gfp) כבקרה. לאחר ההשרייה, רמת הביטוי של תמלילי היעד נקבעה באמצעות PCR כמותי בזמן אמת. ההשפעות של RNAi אושרו לאחר מכן באמצעות תצפית מיקרוסקופית של הפנוטיפים והשוואה של גודל הגוף של המבוגרים בין הקבוצות. הפרוטוקול הנוכחי יכול לסייע בקידום המחקר כדי להבין טוב יותר את תפקודם של הגנים של B. xylophilus ונמטודות טפיליות אחרות לקראת פיתוח אסטרטגיות בקרה באמצעות הנדסה גנטית.
Introduction
נמטודות טפיליות-צמחיות (PPNs) מהוות איום מתמשך על ביטחון המזון ועל המערכות האקולוגיות של היערות. הם גורמים להפסדים כלכליים של כ-100 מיליארד דולר בכל שנה1, כאשר הבעייתיים שבהם הם בעיקר נמטודות שורשים, נמטודות ציסטות ונמטודות מעץ אורן. נמטודת עץ האורן, Bursaphelenchus xylophilus, היא נמטודה נודדת, אנדופרזיטית, שהיא הפתוגן הסיבתי של מחלת אורן נבול2. הוא גרם נזק רב ליערות אורנים ברחבי העולם3. אם נשתמש בטרמינולוגיה של Van Megen et al.4, B. xylophilus הוא חבר ב-Parasitaphelenchidae ושייך לקלייד 10, בעוד שרוב טפילי הצמחים הגדולים האחרים שייכים לקלייד 12.
כטפיל צמחי עצמאי שהתפתח לאחרונה, ב. קסילופילוס הוא מודל אטרקטיבי למחקרים השוואתיים. עד כה, היה מחקר משמעותי על נמטודות קשר שורש ונמטודות ציסטות השייכות לקלייד 12, שהן אנדופרזיטים מחייבים, בישיבה והן חלק מהנמטודות הנחקרות ביותר. עם זאת, ביצוע מחקר נוסף בתחום חשוב זה טומן בחובו אתגר גדול: תפקודם של גנים של טפילות הוא צוואר בקבוק מחקרי. מחקרים פונקציונליים כוללים בדרך כלל ביטוי חוץ רחמי וניסויי נוק-דאון/אאוט, אך מסתמכים על פרוטוקולי טרנספורמציה גנטית יעילים עבור הנמטודה. כתוצאה מכך, גנטיקה הפוכה ב-PPNs מסתמכת כמעט אך ורק על השתקת גנים על ידי RNAi.
RNAi, מנגנון הקיים באופן נרחב בתאים אאוקריוטים, משתיק ביטוי גנים על ידי החדרת RNA דו-גדילי (dsRNA)5. עד כה, מנגנון השתקת הגנים שלאחר ההדבקה המושרה על ידי dsRNA נמצא בכל האאוקריוטים שנחקרו, וטכנולוגיית RNAi, ככלי למחקר גנומי פונקציונלי ויישומים אחרים, התפתחה במהירות באורגניזמים רבים. מאז גילוי מכונות ה- RNAi ב- Caenorhabditis elegans בשנת 19986, טכניקות RNAi הפכו לשיטות יעילות לזיהוי תפקוד הגן של נמטודות ומוצעות כדרך חדשה לשלוט ביעילות בנמטודות פתוגניות7.
מבחינה טכנית, ה-RNAi סופג את הצעירים ב-dsRNA; עם זאת, היעילות והשכפול של גישה זו משתנות מאוד עם מיני הנמטודות ועם גן המטרה8. השתקה של 20 גנים המעורבים במסלולי ה-RNAi של נמטודת קשר השורש, Meloidogyne incognita, נחקרה באמצעות dsRNAs ארוכים כטריגרים, וכתוצאה מכך תגובות מגוונות, כולל עלייה וללא שינוי בביטוי של גנים מסוימים9. תוצאות אלה מראות כי גני מטרה עשויים להגיב להפלת RNAi באופן שונה, מה שמחייב הערכה ממצה של התאמתם כמטרות לבקרת נמטודות באמצעות RNAi. עם זאת, יש כיום מיעוט של מחקר על הביולוגיה ההתפתחותית והרבייה של ב ‘קסילופילוס.
כהמשך לעבודה קודמת10,11,12,13, אנו מתארים כאן פרוטוקול ליישום RNAi כדי לחקור את תפקוד הגן ppm-1 של B. xylophilus, כולל סינתזה של dsRNA, השריית נוירוסטימולנטים סינתטיים וזיהוי תגובת שרשרת פולימראז כמותית (qPCR). הידע שיתקבל מגישה ניסיונית זו צפוי לתרום רבות להבנת מערכות ביולוגיות בסיסיות ולמניעת מחלת האורנים.
Protocol
Representative Results
Discussion
למרות שהיסטוריית החיים והסביבה הטפילית של B. xylophilus שונים מאלו של נמטודות אחרות, היה מחקר מוגבל על הפתוגנזה המולקולרית של פתוגן צמח זה. למרות ההתקדמות הרבה שהושגה ביישום טכנולוגיית עריכת הגנום CRISPR/Cas9 ב-C. elegans ובנמטודות אחרות, רק טכנולוגיית RNAi המיושמת על B. xylophilus פורסמה עד כה<sup c…
Divulgations
The authors have nothing to disclose.
Acknowledgements
מחקר זה מומן על ידי הקרן הלאומית למדעי הטבע של סין (31870637, 31200487) ומומן במשותף על ידי תוכנית המחקר המרכזית של ג’ה-ג’יאנג (2019C02024, LGN22C160004).
Materials
| Baermann funnel | n/a | n/a | to isolate nematodes |
| Beacon Designer 7.9 | Shanghai kangyusheng information technology co. | n/a | to design qPCR primers |
| Botrytis cinerea | n/a | n/a | as food for nematodes |
| Bursaphelenchus xylophilus | n/a | n/a | its number was NXY61 and was it was originally extracted from diseased Pinus massoniana in Ningbo, Zhejiang province, China. |
| constant temperature incubator | Shanghai Jing Hong Laboratory Instrument Co. | H1703544 | to cultur nematodes |
| Electrophoresis apparatus | Bio-Rad Laboratories | 1704466 | to achieve electrophoretic analysis |
| Ethanol, 75% | Sinopharm Chemical Reagent Co. | 80176961 | to extract RNA |
| Ex Taq Polymerase Premix | Takara Bio Inc. | RR030A | for PCR |
| Ex Taq Polymerase Premix | Takara Bio Inc. | RR390A | for PCR |
| Gel imager | LongGene Scientific Instruments Co. | LG2020 | to make nucleic acid bands visible |
| GraphPad Prism 8 | GraphPad Prism | n/a | to analyze the data and make figurs |
| High Speed Centrifuge | Hangzhou Allsheng Instruments Co. | AS0813000 | centrifug |
| High-flux tissue grinder | Bertin | to extract RNA | |
| ImageJ software | National Institutes of Health | n/a | to measure the body lengths |
| isopropyl alcohol | Shanghai Aladdin Biochemical Technology Co. | L1909022 | to extract RNA |
| Leica DM4B microscope | Leica Microsystems Inc. | to observe nematodes | |
| magnetic beads | Aoran science technology co. | 150010C | to extract RNA |
| MEGAscript T7 High Yield Transcription Kit | Thermo Fisher Scientific Inc. | AM1333 | to synthesize dsRNA in vitro |
| NanoDrop ND-2000 spectrophotometer | Thermo Fisher Scientific Inc. | NanoDrop 2000/2000C | to analyze the quality of the dsRNA |
| PCR Amplifier | Bio-Rad Life Medical Products Co. | 1851148 | to amplify nucleic acid sequence |
| Petri dishes | n/a | n/a | to cultur nematodes |
| pGEM-T Easy vector | Promega Corporation | A1360 | for cloning |
| Potato Dextrose Agar (Medium) | n/a | n/a | to cultur Botrytis cinerea |
| Prime Script RT reagent Kit with gDNA Eraser | Takara Bio Inc. | RR047B | to synthetic cDNA |
| Primer Premier 5.0 | PREMIER Biosoft | n/a | to design PCR primers |
| primers:ppm-1-F/R | Tsingke Biotechnology Co. | n/a | F: 5'-GATGCGAAGTTGCCAATCATTCT -3'; R: 5'- CCAGATCCAGTCCACCATACACC -3 |
| q-ppm-1-F/R | Tsingke Biotechnology Co. | n/a | F: 5'-CATCCGAATGGCAATACAG-3'; R: 5'-ACTATCCTCAGCGTTAGC-3' |
| Real-time thermal cycler qTOWER 2.2 | Analytique Jena Instruments (Beijing) Co. | for qPCR | |
| shaking table | Shanghai Zhicheng analytical instrument manufacturing co. | to soak nematodes | |
| stereoscopic microscope | Chongqing Optec Instrument Co. | 1814120 | to observe nematodes |
| T7-GFP-F/R | Tsingke Biotechnology Co. | n/a | F: 5'-TAATACGACTCACTATAGGGAAA GGAGAAGAACTTTTCAC-3'; R: 5'-TAATACGACTCACTATAGGGCTG TTACAAACTCAAGAAGG-3' |
| T7 promoter | Tsingke Biotechnology Co. | n/a | TAATACGACTCACTATAGGG |
| Takara MiniBEST Agarose Gel DNA Extraction Kit | Takara Bio Inc. | 9762 | to recover DNA |
| TaKaRa TB Green Premix Ex Taq (Tli RNaseH Plus) | Takara Bio Inc. | RR820A | for qPCR |
| trichloroethane | Shanghai LingFeng Chemical Reagent Co. | to extract RNA | |
| TRIzol Reagent | Thermo Fisher Scientific Inc. | 15596026 | total RNA extraction reagent,to extract RNA |
References
- Nicol, J. M., Jones, J., Gheysen, G., Fenoll, C., et al. Current nematode threats to world agriculture. Genomics and Molecular Genetics of Plant-Nematode Interactions. , 21-43 (2011).
- Jones, J. T., et al. Top 10 plant-parasitic nematodes in molecular plant pathology. Molecular Plant Pathology. 14 (9), 946-961 (2013).
- Kikuchi, T., et al. Genomic insights into the origin of parasitism in the emerging plant pathogen Bursaphelenchus xylophilus. PLoS Pathogens. 7 (9), 1002219 (2011).
- Megen, H. V., et al. A phylogenetic tree of nematodes based on about 1200 full-length small subunit ribosomal DNA sequences. Nematology. 11 (6), 927-950 (2009).
- Niu, J. H., Jian, H., Xu, J. M., Guo, Y. D., Liu, Q. RNAi technology extends its reach: Engineering plant resistance against harmful eukaryotes. African Journal of Biotechnology. 9 (45), 7573-7582 (2010).
- Fire, A., et al. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature. 91 (6669), 806-811 (1998).
- Shahid, M., Imran, A., Mazhar, H., Yusuf, Z., Rob, W. B. Engineering novel traits in plants through RNA interference. Trends in Plant Science. 11 (11), 559-565 (2006).
- Marmonier, A., et al. In vitro acquisition of specific small interfering RNAs inhibits the expression of some target genes in the plant ectoparasite Xiphinema index. International Journal of Molecular Sciences. 20 (13), 3266 (2019).
- Iqbal, S., Fosu-Nyarko, J., Jones, M. G. K. Attempt to silence genes of the RNAi pathways of the root-knot nematode, Meloidogyne incognita results in diverse responses including increase and no change in expression of some genes. Frontiers in Plant Science. 11, 328 (2020).
- Zhou, L. F., et al. Molecular characterization and functional analysis of akt-1 in pinewood nematode, Bursaphelenchus xylophilus. Forest Pathology. 51 (1), 12647 (2021).
- Zhou, L. F., et al. The role of mab-3 in spermatogenesis and ontogenesis of pinewood nematode, Bursaphelenchus xylophilus. Pest Management Science. 77 (1), 138-147 (2021).
- Tang, J., et al. Bxy-fuca encoding α-L-fucosidase plays crucial roles in development and reproduction of the pathogenic pinewood nematode, Bursaphelenchus xylophilus. Pest Management Science. 76 (1), 205-214 (2020).
- Wang, J. H., et al. Molecular characterization and functional analysis of daf-8 in the pinewood nematode, Bursaphelenchus xylophilus. Journal of Forestry Research. , (2021).
- Viglierchio, D. R., Schmitt, R. V. On the methodology of nematode extraction from field samples: Baermann funnel modifications. Journal of Nematology. 15 (3), 438-444 (1983).
- Zhu, N., et al. Observation and quantification of mating behavior in the pinewood nematode, Bursaphelenchus xylophilus. Journal of Visualized Experiments: JoVE. (118), e54842 (2016).
- Zhou, L. F., Chen, F. M., Ye, J. R., Pan, H. Y. Selection of reliable reference genes for RT-qPCR analysis of Bursaphelenchus mucronatus gene expression from different habitats and developmental stages. Frontiers in Genetics. 9, 269-279 (2018).
- Wang, M., et al. Double-stranded RNA-mediated interference of dumpy genes in Bursaphelenchus xylophilus by feeding on filamentous fungal transformants. International Journal for Parasitology. 46 (5-6), 351-360 (2016).
- Ma, H. B., Lu, Q., Liang, J., Zhang, X. Y. Functional analysis of the cellulose gene of the pine wood nematode, Bursaphelenchus xylophilus, using RNA interference. Genetics and Molecular Research: GMR. 10 (3), 1931-1941 (2011).
- Cheng, X. Y., Dai, S. M., Xiao, L., Xie, B. Y. Influence of cellulase gene knock down by dsRNA interference on the development and reproduction of the pine wood nematode, Bursaphelenchus xylophilus. Nematology. 12 (12), 225-233 (2010).
- Xue, Q., Wu, X. Q., Zhang, W. J., Deng, L. N., Wu, M. M. Cathepsin L-like cysteine proteinase genes are associated with the development and pathogenicity of pine wood nematode, Bursaphelenchus xylophilus. International Journal of Molecular Sciences. 20 (1), 215 (2019).
- Tabara, H., Grishok, A., Mello, C. C. RNAi in C. elegans: Soaking in the genome sequence. Science. 282 (5388), 430-431 (1998).
- Urwin, P. E., Lilley, C. J., Atkinson, H. J. Ingestion of double-stranded RNA by pre parasitic juvenile cyst nematodes leads to RNA interference. Molecular Plant-Microbe Interactions: MPMI. 15 (8), 747-752 (2002).
- Bakhetia, M., Charlton, W., Atkinson, H. J., McPherson, M. J. RNA interference of dual oxidase in the plant nematode Meloidogyne incognita. Molecular Plant-Microbe Interactions: MPMI. 18 (10), 1099-1106 (2005).
- Rosso, M. N., Dubrana, M. P., Cimbolini, N., Jaubert, S., Abad, P. Application of RNA interference to root-knot nematode genes encoding esophageal gland proteins. Molecular Plant-Microbe Interactions: MPMI. 18 (7), 615-620 (2005).
- Chen, Q., Rehman, S., Smant, G., Jones, J. T. Functional analysis of pathogenicity proteins of the potato cyst nematode Globodera rostochiensis using RNAi. Molecular Plant-Microbe Interactions: MPMI. 18 (7), 621-625 (2005).
- Wang, D. D., Li, Y., Li, J., Xie, B. Y., Chen, G. H. Molecular clone and its RNAi interference effect analysis of mapk gene in Bursaphelenchus xylophilus ( in Chinese). Acta Phytopathologica Sinica. 46 (5), 662-669 (2016).
- Qiu, X., Wu, X., Huang, L., Ye, J. R. Influence of Bxpel1 gene silencing by dsRNA interference on the development and pathogenicity of the pine wood nematode, Bursaphelenchus xylophilus. International Journal of Molecular Sciences. 17 (1), 125 (2016).
- Dulovic, A., Streit, A. RNAi-mediated knockdown of daf-12 in the model parasitic nematode Strongyloides ratti. PLoS Pathogens. 15 (3), 1007705 (2019).
- Li, L., Zhao, H., Cui, Y., Wei, H., Li, M. Research progress of gene editing technology. Life Science Research. 21 (3), 268-274 (2017).
- Bindhya, C. Y., Karuppannan, V., Kuppuswamy, S. Host-generated double stranded RNA induces RNAi in plant-parasitic nematodes and protects the host from infection. Molecular and Biochemical Parasitology. 148 (2), 219-222 (2006).
- Jiang, Z., Sher, A. K., David, G. H., Ralph, B. Next-generation insect-resistant plants: RNAi-mediated crop protection. Trends in Biotechnology. 35 (9), 871-882 (2017).
