Recombinant Proteïne Expressie, Kristallisatie en Biofysische Studies van a<em> Bacillus</em> -conserveerd nucleotide pyrophosphorylase, BcMazG
Summary
Bacillus anthracis is het verplichte pathogeen van dodelijke inhalatie miltbrand, zodat studies van zijn genen en eiwitten strikt gereguleerd zijn. Een alternatieve benadering is het bestuderen van orthologische genen. We beschrijven biofysicochemische studies van een B. anthracis ortholog in B. cereus , bc1531, die minimale experimentele apparatuur vereisen en ernstige veiligheidsproblemen ontbreken.
Abstract
Om veiligheidsbeperkingen en -regulaties te overwinnen bij het bestuderen van genen en eiwitten van echte pathogenen, kunnen hun homologen worden bestudeerd. Bacillus anthracis is een verplicht pathogeen dat dodelijke inhalatie miltbrand veroorzaakt. Bacillus cereus wordt beschouwd als een bruikbaar model voor het bestuderen van B. anthracis door zijn nauwe evolutionaire relatie. De gencluster ba1554 – ba1558 van B. anthracis wordt sterk bewaard met het bc1531 – bc1535 cluster in B. cereus , evenals met het bt1364-bt1368 cluster in Bacillus thuringiensis, wat de kritische rol van de geassocieerde genen in het Bacillus genus aangeeft. Dit manuscript beschrijft methoden voor het bereiden en karakteriseren van een eiwitproduct van het eerste gen ( ba1554 ) van het gencluster di B. anthracis met behulp van een recombinant eiwit van zijn ortholoog in B. cereus , bc1531.
Introduction
Recombinant eiwit expressie wordt veel gebruikt om problemen die verband houden met natuurlijke eiwitbronnen, zoals beperkte eiwithoeveelheden en schadelijke verontreiniging te overwinnen. Bovendien kan bij studies van pathogene genen en eiwitten een alternatieve laboratoriumstam die geen aanvullende veiligheidsmaatregelen vereist, worden gebruikt. Bacillus cereus is bijvoorbeeld een bruikbaar model voor het bestuderen van Bacillus anthracis door hun nauwe evolutionaire relatie 1 .
B. anthracis is een verplicht pathogeen dat dodelijke inademende miltvuur veroorzaakt bij mensen en vee en kan potentieel als bioweapon worden gebruikt 2 . Zo worden laboratoriumstudies op B. anthracis strikt gereguleerd door de Amerikaanse Centers for Disease Control, waarbij biosafety niveau 3 (BSL-3) praktijken vereist worden, waarbij wordt bepaald dat het laboratoriumgebied gescheiden wordt met negatieve kamerdruk. In tegenstelling tot B. anthracis </eM>, B. cereus is gecategoriseerd als een BSL-1-agent en heeft derhalve minimale veiligheidskwesties. B. cereus is een opportunistisch pathogeen dat bij infectie voedselvergiftiging veroorzaakt die zonder medische hulp kan worden behandeld. Aangezien B. cereus veel kritische genen deelt met B. anthracis , kunnen de functies van B. anthracis eiwitten worden bestudeerd onder toepassing van de bijbehorende homologen van B. cereus 1 .
De ba1554 – ba1558 gencluster van B. anthracis is sterk bewaard met het bc1531 – bc1535 cluster Van B. cereus , evenals met het bt1364-bt1368 cluster van Bacillus thuringiensis , in termen van genorganisatie en sequentie. Bovendien zijn de eerste genen ( ba1554 , bc1531 en bt1364 ) van de respectieve clusters absoluut behouden ( dwz 100% nucleotide sequentie identiteit), implicietNg een kritische rol van het genproduct in de Bacillus- soort. Vanwege de ligging in deze genclusters was ba1554 verkeerd geïdentificeerd als een vermoedelijke transcriptie regelaar 3 . Echter, aminozuursequentie analyse van het ba1554 product geeft aan dat het behoort tot de MazG familie, die nucleotide pyrofoshydrolase activiteit heeft en niet geassocieerd wordt met transcriptiefactor activiteit 4 , 5 . Hoewel eiwitten die behoren tot de MazG-familie verschillend zijn met betrekking tot de totale sequentie en lengte, delen ze een gemeenschappelijk MazG-domein van 100 resten, gekenmerkt door een EXXE 12-28 EXXD-motief ("X" staat voor elk aminozuurresidu en het getal Geeft het aantal X residuen aan).
Het MazG domein vertoont niet altijd direct een bepaalde katalytische activiteit. Een MazG lid van Escherichia coli (EcMazG) bezit twee MazG domeinen, maar opHet C-terminale MazG-domein is enzymatisch actief 6 . Bovendien varieert de substraat specificiteit van MazG enzymen van niet-specifieke nucleoside trifosfaten (voor EcMazG) naar specifieke dCTP / dATP (voor integrin-geassocieerde MazG) en dUTP (voor dUTPases) 6 , 7 , 8 , 9 . Daarom zijn biofysicochemische analyses van het BA1554-eiwit nodig om zijn NTPase-activiteit te bevestigen en zijn substraatspecificiteit te ontcijferen.
Hier geven we een stap-voor-stap protocol dat de meeste laboratoria zonder een BSL-3-faciliteit kunnen volgen om het eiwitproduct van het B. cereus bc1531- gen te karakteriseren , dat is een ortholoog van B. anthracis ba1554 , op het moleculaire niveau. In het kort werd recombinant BC1531 (rBC1531) uitgedrukt in E. coli en gezuiverd met behulp van een affiniteitstabel. Voor röntgenkristallografische experimenten, de kristallijZation voorwaarden van het rBC1531 eiwit werden gescreend en geoptimaliseerd. Om de enzymatische activiteit van rBC1531 te beoordelen, werd de NTPase-activiteit kleurimetrisch gecontroleerd om radioactief gemerkte nucleotiden die conventioneel zijn gebruikt te vermijden. Tenslotte maakten analyses van de verkregen biofysicochemische gegevens ons de oligomerisatietoestand en de katalytische parameters van rBC1531 mogelijk, evenals om röntgendiffractiedata van het rBC1531 kristal te verkrijgen.
Protocol
Representative Results
Discussion
Studies of true pathogens are limited due to safety restrictions and regulations. Alternatively, pathogens can be studied using evolutionarily related non-pathogens or less pathogenic species. The ba1554 gene is considered a critical gene in B. anthracis. Fortunately, an identical gene is present in nonclinical B. cereus. Thus, without serious safety concerns, recombinant BC1531 protein can be used for biophysical and enzymatic characterization. Here, we described detailed procedures, moving fr…
Divulgazioni
The authors have nothing to disclose.
Acknowledgements
De röntgendiffractie-datasets werden verzameld bij beamline 7A van het Pohang Accelerator Laboratory (Korea). Deze studie werd ondersteund door het Basic Science Research Programma dat wordt beheerd door de National Research Foundation of Korea (NRF), gefinancierd door het ministerie van wetenschap, ICT & toekomstige planning (2015R1A1A01057574 naar MH).
Materials
| Bacillus cereus ATCC14579 | Korean Collection for Tissue Culture | 3624 | |
| Genomic DNA prep kit | GeneAll | 106-101 | Genomic DNA preparation |
| Forward primer | Macrogen | GAAGGATCCGGAAGCAAAAA CGATGAAAGATATGCA |
BamHI site is underlined |
| Reverse primer | Macrogen | CTTGTCGACTTATTCTTTCTCT CCCTCATCAATACGTG |
SalI site is underlined |
| nPfu-Forte | Enzynomics | P410 | PCR polymerase |
| BamHI | Enzynomics | R003S | |
| SalI | Enzynomics | R009S | |
| pET49b expression vector | Novagen | 71463 | Expression vector was modified to add affinity tags and BamHI/SalI sites10 |
| T4 DNA ligase | Enzynomics | M001S | |
| Dialysis memebrane | Thermofisher | 18265017 | |
| Dry block heater | JSR | JSBL-02T | |
| LB broth (Luria-Bertani) | LPS solution | LB-05 | |
| LB Agar, Miller (Luria-Bertani) | Becton, Dickinson and Company | ||
| Kanamycin | LPS solution | KAN025 | |
| Mini-prep kit | Favorgen | FAPDE300 | Plasmid DNA preparation |
| BL21(DE3) Competent cell | Novagen | 69450-3CN | |
| Isopropyl β-D-1-thiogalactopyranoside (IPTG) | Fisher BioReagents | 50-213-378 | |
| Sodium chloride | Daejung | 7548-4100 | PBS material |
| Potassium chloride | Daejung | 6566-4405 | PBS material |
| Potassium phosphate | Bio Basic Inc | PB0445 | PBS material |
| Sodium phosphate | Bio Basic Inc | S0404 | PBS material |
| Imidazole | Bio Basic Inc | IB0277 | |
| Sonicator | Sonics | VCX 130 | |
| Ni-NTA agaros | Qiagen | 30210 | Nickel bead |
| Rotator | Finepcr | AG | |
| Precision Plus Protein Dual Color Standards | Bio-rad | 1610374 | SDS-PAGE protein standard |
| Coonmassie Brilliant Blue R-250 | Fisher BioReagents | BP101-25 | Coomassie staining solution |
| Methyl alcohol | Samchun chemical | M0585 | Coomassie staining solution |
| Acetic acid | Daejung | 1002-4105 | Coomassie staining solution |
| Dialysis memebrane | Thermofisher | 68035 | |
| 2-Mercaptoethanol | Sigma-aldrich | M6250 | |
| Thrombin | Merckmillipore | 605157-1KUCN | Prepare aliquots of 20 μl (1 Unit per μl) and store at 70 °C and thaw before use |
| Superdex 200 16/600 | General Electric | 28989335 | Size exclusion chromatography |
| Gel filtration standard | Bio-rad | 151-1901 | |
| Centrifugal filter | Amicon | UFC800396 | |
| Crystralization plates | Hampton research | HR3-083 | 96-well sitting drop plate |
| The JCSG core suite I-IV | Qiagen | 130924-130927 | Crystallization secreening solution |
| Microscope | Nikon | SMZ745T | |
| Cryschem plates | Hampton research | HR3-158 | 24-well sitting drop plate |
| Inorganic pyrophosphatase | Sigma | 10108987001 | |
| Ammonium molybdate solution | Sigma | 13106-76-8 | |
| L-ascorbic acid | Sigma | 50-81-7 | |
| NTP substrate | Startagene | 200415-51 | |
| Spectrophotometer | Biotek | SynergyH1 | microplate reader |
| GraphPad Prism 5 | GraphPad | Prism 5 for Window |
Riferimenti
- Ivanova, N., et al. Genome sequence of Bacillus cereus and comparative analysis with Bacillus anthracis. Nature. 423, 87-91 (2003).
- Spencer, R. C. Bacillus anthracis. J Clin Pathol. 56, 182-187 (2003).
- Deli, A., et al. LmbE proteins from Bacillus cereus are de-N-acetylases with broad substrate specificity and are highly similar to proteins in Bacillus anthracis. FEBS J. 277, 2740-2753 (2010).
- Gross, M., Marianovsky, I., Glaser, G. MazG — a regulator of programmed cell death in Escherichia coli. Mol Microbiol. 59, 590-601 (2006).
- Galperin, M. Y., Moroz, O. V., Wilson, K. S., Murzin, A. G. House cleaning, a part of good housekeeping. Mol Microbiol. 59, 5-19 (2006).
- Lee, S., et al. Crystal structure of Escherichia coli MazG, the regulator of nutritional stress response. J Biol Chem. 283, 15232-15240 (2008).
- Moroz, O. V., et al. Dimeric dUTPases, HisE, and MazG belong to a new superfamily of all-alpha NTP pyrophosphohydrolases with potential "house-cleaning" functions. J Mol Biol. 347, 243-255 (2005).
- Robinson, A., et al. A putative house-cleaning enzyme encoded within an integron array: 1.8 A crystal structure defines a new MazG subtype. Mol Microbiol. 66, 610-621 (2007).
- Moroz, O. V., et al. The crystal structure of a complex of Campylobacter jejuni dUTPase with substrate analogue sheds light on the mechanism and suggests the "basic module" for dimeric d(C/U)TPases. J Mol Biol. 342, 1583-1597 (2004).
- Green, M., Sambrook, J. . Molecular cloning: A laboratory Manual. 1, (2012).
- Brown, T. A. . Gene cloning an introduction. , (1986).
- Kim, M. I., Hong, M. Crystal structure of the Bacillus-conserved MazG protein, a nucleotide pyrophosphohydrolase. Biochem Biophys Res Commun. 472, 237-242 (2016).
- Sheehan, D. . Physical biochemistry: Principles and applications. , (2009).
- Lesley, S. A., Wilson, I. A. Protein production and crystallization at the joint center for structural genomics. J Struct Funct Genomics. 6, 71-79 (2005).
- Jeon, Y. J., et al. Structural and biochemical characterization of bacterial YpgQ protein reveals a metal-dependent nucleotide pyrophosphohydrolase. J Struct Biol. 195, 113-122 (2016).
