Hi-C in nucleus in drosophilacellen
Summary
Het genoom is georganiseerd in de nucleaire ruimte in verschillende structuren die kunnen worden onthuld door middel van chromosoom conformatie capture technologieën. De hi-c-methode in de kern biedt een genoombrede verzameling chromatine-interacties in Drosophila-cellijnen, die contactkaarten genereert die kunnen worden verkend met megabaseresolutie op beperkingsfragmentniveau.
Abstract
Het genoom is georganiseerd in topologisch koppelende domeinen (TAD’s) gescheiden door grenzen die interacties tussen domeinen isoleren. In Drosophila worden de mechanismen die ten grondslag liggen aan TAD-formatie en grenzen nog onderzocht. De toepassing van de hier beschreven hi-C-methode in de kern hielp bij het ontleden van de functie van architecturale eiwitbindende locaties bij TAD-grenzen die het Notch-gen isoleren. Genetische modificatie van domeingrenzen die verlies van AP’s veroorzaken, resulteert in TAD-fusie, transcriptiedefecten en topologische veranderingen op lange afstand. Deze resultaten leverden bewijs dat genetische elementen bijdragen aan de vorming van domeingrens en genexpressiecontrole in Drosophila. Hier is de hi-C-methode in de kern in detail beschreven, die belangrijke controlepunten biedt om de kwaliteit van het experiment samen met het protocol te beoordelen. Ook worden de vereiste aantallen sequencing-leesingen en geldige Hi-C-paren weergegeven om genomische interacties op verschillende genomische schalen te analyseren. CRISPR/Cas9-gemedieerde genetische bewerking van regulerende elementen en profilering met hoge resolutie van genomische interacties met behulp van dit hi-C-protocol in de kern zou een krachtige combinatie kunnen zijn voor het onderzoek naar de structurele functie van genetische elementen.
Introduction
Bij eukaryoten wordt het genoom verdeeld in chromosomen die specifieke gebieden in de nucleaire ruimte bezetten tijdens interfase1. De chromatine die de chromosomen vormt, kan worden onderverdeeld in twee hoofdtoestanden: een van toegankelijke chromatine die transcriptie-permissief is, en de andere van compacte chromatine die transcriptie-repressief is. Deze chromatinetoestanden scheiden en mengen zich zelden in de nucleaire ruimte en vormen twee afzonderlijke compartimenten in de kern2. Op de sub-megabase schaal, grenzen afzonderlijke domeinen van hoogfrequente chromatine interacties, genaamd TADs, die chromosomale organisatiemarkeren 3,4,5. Bij zoogdieren worden tad-grenzen ingenomen door cohesine en CCCTC-bindingsfactor (CTCF)6,7,8. Het cohesinecomplex extrudeert chromatine en stopt op CTCF-bindingsplaatsen die in een convergente oriëntatie in de genomische sequentie worden afgevoerd om stabiele chromatinelussen9,10 , 13,14te vormen . Genetische verstoring van de CTCF DNA-bindende plaats aan de grenzen of vermindering van de overvloed aan CTCF – en cohesine-eiwit resulteert in abnormale interacties tussen regulerende elementen, verlies van TAD-vorming en genexpressiederegulering9,10,11,13,14.
In Drosophila worden de grenzen tussen TAD’s bezet door verschillende AP’s, waaronder grenselement-geassocieerde factor 32 kDa (BEAF-32), Motif 1 binding eiwit (M1BP), centrosomaal eiwit 190 (CP190), suppressor van hairy-wing (SuHW) en CTCF, en zijn verrijkt met actieve histonmodificaties en Polymerase II16,17,18. Er is gesuggereerd dat in Drosophila TAD’s verschijnen als gevolg van transcriptie13,17,19, en de exacte rol van onafhankelijke AP’s in grensvorming en isolatie-eigenschappen wordt nog onderzocht. Dus of domeinen in Drosophila een enig gevolg zijn van de aggregatie van regio’s van vergelijkbare transcriptietoestanden of dat AP’s, waaronder CTCF, bijdragen aan grensvorming, moet dus nog volledig worden gekarakteriseerd. Exploratie van genomische contacten met hoge resolutie is mogelijk geweest door de ontwikkeling van chromosoomconformatie-opnametechnologieën in combinatie met sequencing van de volgende generatie. Het Hi-C protocol werd voor het eerst beschreven met de ligatiestap uitgevoerd “in oplossing”2 in een poging om valse ligatieproducten tussen chromatinefragmenten te voorkomen. Verschillende studies wezen echter op het besef dat het nuttige signaal in de gegevens afkomstig was van ligatieproducten die werden gevormd bij gedeeltelijk gelyseerde kernen die niet in oplossing20,21waren .
Het protocol werd vervolgens aangepast om de ligatie in de kern uit te voeren als onderdeel van het eencellige Hi-C-experiment22. Het hi-c-protocol in de kern werd vervolgens opgenomen in de celpopulatie Hi-C om een consistentere dekking over het volledige bereik van genomische afstanden te produceren en gegevens te produceren met minder technische ruis23,24. Het protocol, hier in detail beschreven, is gebaseerd op het populatie-in-nucleus Hi-C protocol23,24 en werd gebruikt om de gevolgen te onderzoeken van het genetisch verwijderen van DNA-bindende motieven voor CTCF en M1BP van een domeingrens bij de Notch-gen locus in Drosophila25. De resultaten tonen aan dat het veranderen van de DNA-bindende motieven voor AP’s aan de grens drastische gevolgen heeft voor de vorming van notch-domein, grotere topologische defecten in de regio’s rond de Notch-locus en genexpressiederegulering. Dit geeft aan dat genetische elementen op domeingrenzen belangrijk zijn voor het behoud van genoomtopologie en genexpressie in Drosophila25.
Protocol
Representative Results
Discussion
De hier gepresenteerde hi-c-methode in de kern heeft een gedetailleerde verkenning van de drosophila-genoomtopologie met hoge resolutie mogelijk gemaakt, waardoor een beeld werd verkregen van genomische interacties op verschillende genomische schalen, van chromatinelussen tussen regulerende elementen zoals promotors en versterkers tot TAD’s en identificatie van grotecompartimenten 25. Dezelfde technologie is ook efficiënt toegepast op weefsels van zoogdieren met enkele wijzigingen<sup class="xref…
Disclosures
The authors have nothing to disclose.
Acknowledgements
Dit werk werd ondersteund door UNAM Technology Innovation and Research Support Program (PAPIIT) subsidienummer IN207319 en de Science and Technology National Council (CONACyT-FORDECyT) subsidienummer 303068. A.E.-L. is een masterstudent ondersteund door de CVA-nummer 968128 van de Science and Technology National Council (CONACyT).
Materials
| 16% (vol/vol) paraformaldehyde solution | Agar Scientific | R1026 | |
| Biotin-14-dATP | Invitrogen | CA1524-016 | |
| ClaI enzyme | NEB | R0197S | |
| COVARIS Ultrasonicator | Covaris | LE220-M220 | |
| Cut Smart | NEB | B72002S | |
| Dulbecco's Modified Eagle Medium (DMEM) 1x | Life Technologies | 41965-039 | |
| Dynabeads MyOne Streptabidin C1 | Invitrogen | 65002 | |
| Fetal bovine serum (FBS) sterile filtered | Sigma | F9665 | |
| Klenow Dna PolI large fragment | NEB | M0210L | |
| Klenow exo(-) | NEB | M0210S | |
| Ligation Buffer | NEB | B020S | |
| MboI enzyme | NEB | R0147M | |
| NP40-Igepal | SIGMA | CA-420 | Non-ionic surfactant for addition in lysis buffer |
| PE adapter 1.0 | Illumina | 5'-P-GATCGGAAGAGCGGTTCAGCAG GAATGCCGAG-3' |
|
| PE adapter 2.0 | Illumina | 5'-ACACTCTTTCCCTACACGACGCT CTTCCGATCT-3' |
|
| PE PCR primer 1.0 | Illumina | 5'-AATGATACGGCGACCACCGAGAT CTACACTCTTTCCCTACACGACG CTCTTCCGATCT-3' |
|
| PE PCR primer 2.0 | Illumina | 5'-CAAGCAGAAGACGGCATACGAG ATCGGTCTCGGCATTCCTGCTGA ACCGCTCTTCCGATCT-3' |
|
| Phenol: Chloroform:Isoamyl Alcohol 25:24:1 | SIGMA | P2069 | |
| Primer 1 (known interaction, Figure 2A) | Sigma | 5'-TCGCGGTAATTTTGCGTTTGA-3' | |
| Primer 2 (known interactions, Figure 2A) | Sigma | 5'-CCTCCCTGCCAAAACGTTTT-3' | |
| Protease inhibitor cocktail tablet | Roche | 4693132001 | |
| Proteinase K | Roche | 3115879001 | |
| Qubit | ThermoFisher | Q33327 | |
| RNAse | Roche | 10109142001 | |
| SPRI Beads | Beckman | B23318 | |
| T4 DNA ligase | Invitrogen | 15224-025 | |
| T4 DNA polymerase | NEB | M0203S | |
| T4 polynucleotide kinase (PNK) | NEB | M0201L | |
| TaqPhusion | NEB | M0530S | DNA polymerase |
| Triton X-100 | Non-ionic surfactant for quenching of SDS |
References
- Cremer, T., Cremer, C. Chromosome territories, nuclear architecture and gene regulation in mammalian cells. Nature Review Genetics. 2, 292-301 (2001).
- Lieberman-Aiden, E., et al. Comprehensive mapping of long-range interactions reveals folding principles of the human genome. Science. 326, 289-293 (2009).
- Dixon, J. R., et al. Topological domains in mammalian genomes identified by analysis of chromatin interactions. Nature. 485, 376-380 (2012).
- Sexton, T., et al. Three-dimensional folding and functional organization principles of the Drosophila genome. Cell. 148 (3), 458-472 (2012).
- Dixon, J. R., Gorkin, D. U., Ren, B. Chromatin domains: the unit of chromosome organization. Molecular Cell. 62, 668-680 (2016).
- Bonev, B., Cavalli, G. Organization and function of the 3D genome. Nature Reviews Genetics. 17, 661-678 (2016).
- Lupiáñez, D. G., Spielmann, M., Mundlos, S. Breaking TADs: how alterations of chromatin domains result in disease. Trends in Genetics. 32, 225-237 (2016).
- Phillips, J. E., Corces, V. G. CTCF: master weaver of the genome. Cell. 137 (7), 1194-1211 (2009).
- Hong, S., Kim, D. Computational characterization of chromatin domain boundary-associated genomic elements. Nucleic Acids Research. 45, 10403-10414 (2017).
- Zuin, J., et al. Cohesin and CTCF differentially affect chromatin architecture and gene expression in human cells. Proceedings of the National Academy of Sciences of the United States of America. 111 (3), 996-1001 (2014).
- Guo, Y., et al. CRISPR inversion of CTCF sites alters genome topology and enhancer/promoter function. Cell. 162, 900-910 (2015).
- Lupiáñez, D. G., et al. Disruptions of topological chromatin domains cause pathogenic rewiring of gene-enhancer interactions. Cell. 161, 1012-1025 (2015).
- Van-Steensel, B., Furlong, E. E. M. The role of transcription in shaping the spatial organization of the genome. Nature Reviews Molecular Cell Biology. 20, 327-337 (2019).
- Merkenschlager, M., Nora, E. P. CTCF and cohesin in genome folding and transcriptional gene regulation. Annual Review of Genomics and Human Genetics. 17 (1), 17-43 (2016).
- Hansen, A. S., Pustova, I., Cattoglio, C., Tjian, R., Darzacq, X. CTCF and cohesin regulate chromatin loop stability with distinct dynamics. Elife. 6, 1-10 (2017).
- Van Bortle, K., et al. Insulator function and topological domain border strength scale with architectural protein occupancy. Genome Biology. 15, 82 (2014).
- Ramírez, F., et al. High-resolution TADs reveal DNA sequences underlying genome organization in flies. Nature Communications. 9, 189 (2018).
- Ulianov, S. V., et al. Active chromatin and transcription play a key role in chromosome partitioning into topologically associating domains. Genome Research. 26, 70-84 (2016).
- Rowley, M. J., et al. Evolutionarily conserved principles predict 3D chromatin organization. Molecular Cell. 67, 837-852 (2017).
- Gavrilov, A. A., Golov, A. K., Razin, S. V. Actual ligation frequencies in the chromosome conformation capture procedure. PLoS One. 8, 60403 (2013).
- Gavrilov, A. A., et al. Disclosure of a structural milieu for the proximity ligation reveals the elusive nature of an active chromatin hub. Nucleic Acids Research. 41, 3563-3575 (2013).
- Nagano, T., et al. Single-cell Hi-C reveals cell-to-cell variability in chromosome structure. Nature. 502, 59-64 (2013).
- Rao, S. S. P., et al. A 3D map of the human genome at kilobase resolution reveals principles of chromatin looping. Cell. 159 (7), 1665-1680 (2014).
- Nagano, T., et al. Comparison of Hi-C results using in-solution versus in-nucleus ligation. Genome Biology. 16, 175 (2015).
- Arzate-Mejía, R., et al. In situ dissection of domain boundaries affect genome topology and gene transcription in Drosophila. Nature Communications. 11, 894 (2020).
- Schoenfelder, S., et al. Promoter capture Hi-C: high-resolution, genome-wide profiling of promoter interactions. Journal of Visualized Experiments. (136), e57320 (2018).
- Servant, N., et al. HiC-Pro: an optimized and flexible pipeline for Hi-C processing. Genome Biology. 16, 259 (2015).
- Philip, E., Måns, M., Sverker, L., Max, K. MultiQC: Summarize analysis results for multiple tools and samples in a single report. Bioinformatics. 10, 1093 (2016).
- Wingett, S., et al. HiCUP: pipeline for mapping and processing Hi-C data. F1000 Research. 4, 1310 (2015).
- Imakaev, M., et al. Iterative correction of Hi-C data reveals hallmarks of chromosome organization. Nature Methods. 9 (10), 999-1003 (2012).
- Akdemir, K. C., Chin, L. HiCPlotter integrates genomic data with interaction matrices. Genome Biolog. 16, 198 (2015).
- Ramirez, F., et al. High-resolution TADs reveal DNA sequences underlying genome organization in flies. Nature Communications. 9, 189 (2018).
- Ando-Kuri, M., et al. The global and promoter-centric 3D genome organization temporally resolved during a circadian cycle. bioRxiv. , (2020).
- Cuellar-Partida, G., et al. Epigenetic priors for identifying active transcription factor binding sites. Bioinformatics. 28 (1), 56-62 (2012).
- Zhang, Y., et al. Model-based analysis of ChIP-Seq (MACS). Genome Biology. 9, 137 (2008).
- Ong, C. -. T., et al. Poly(ADP-ribosyl)ation regulates insulator function and intrachromosomal interactions in Drosophila. Cell. 155 (1), 148-159 (2013).
- Fresán, U., et al. The insulator protein CTCF regulates Drosophila steroidogenesis. Biology Open. 4 (7), 852-857 (2015).
- Quinodoz, S., et al. RNA promotes the formation of spatial compartments in the nucleus. Cell. 174, 744-757 (2018).
- Olivares-Chauvet, P., et al. Capturing pairwise and multi-way chromosomal conformations using chromosomal walks. Nature. 540 (7632), 296-300 (2016).
- Beagrie, R., et al. Complex multi-enhancer contacts captured by genome architecture mapping. Nature. 543, 519-524 (2017).
- Redolfi, J., et al. DamC reveals principles of chromatin folding in vivo without crosslinking and ligation. Nature Structural and Molecular Biology. 26, 471-480 (2019).
- Maxwell, R., et al. HiChIP: efficient and sensitive analysis of protein-directed genome architecture. Nature Methods. 13, 919-922 (2016).
- Gao, X., et al. C-BERST: Defining subnuclear proteomic landscapes at genomic elements with dCas9-APEX2. Nature Methods. 15 (6), 433-436 (2018).
