JoVE Journal > Genetics
Summary
Abstract
Introduction
Protocol
Results
Discussion
Disclosures
Acknowledgements
Materials
References
자동 번역
Please note that all translations are automatically generated. Click here for the English version.
유전학

ड्रोसोफिला कोशिकाओं में इन-न्यूक्लियस हाय-सी

Published: September 15, 2021
doi:
10.3791/62106
, , ,
1Departamento de Genética Molecular, Instituto de Fisiología Celular,Universidad Nacional Autónoma de México

Summary

जीनोम को परमाणु अंतरिक्ष में विभिन्न संरचनाओं में व्यवस्थित किया जाता है जिसे गुणसूत्र संरचना कैप्चर प्रौद्योगिकियों के माध्यम से प्रकट किया जा सकता है। इन-न्यूक्लियस हाई-सी विधि ड्रोसोफिला सेल लाइनों में क्रोमेटिन इंटरैक्शन का जीनोम-वाइड संग्रह प्रदान करती है, जो संपर्क मानचित्र उत्पन्न करती है जिसे प्रतिबंध खंड स्तर पर मेगाबेस रिज़ॉल्यूशन पर खोजा जा सकता है।

Abstract

जीनोम को डोमेन के बीच बातचीत को अलग करने वाली सीमाओं द्वारा सीमित डोमेन (TADs) को टोपोलॉजिकल रूप से संबद्ध करने में आयोजित किया जाता है। ड्रोसोफिला में, टीएडी गठन और सीमाओं में अंतर्निहित तंत्र अभी भी जांच के घेरे में हैं । यहां वर्णित इन-न्यूक्लियस हाई-सी विधि के आवेदन ने पायदान जीन को अलग करने वाली टीएडी सीमाओं पर वास्तुशिल्प प्रोटीन (एपी) के बाध्यकारी स्थलों के कार्य को विच्छेदन करने में मदद की । डोमेन सीमाओं का आनुवंशिक संशोधन जो एपीएस के नुकसान का कारण बनता है, टीएडी संलयन, प्रतिलेखन दोषों और लंबी दूरी के स्थलाकृतिक परिवर्तनों में परिणाम देता है। इन परिणामों ने ड्रोसोफिला में डोमेन सीमा निर्माण और जीन अभिव्यक्ति नियंत्रण में आनुवंशिक तत्वों के योगदान का प्रदर्शन करने वाले साक्ष्य प्रदान किए । यहां इन-न्यूक्लियस हाई-सी विधि का विस्तार से वर्णन किया गया है, जो प्रोटोकॉल के साथ प्रयोग की गुणवत्ता का आकलन करने के लिए महत्वपूर्ण चौकियां प्रदान करता है । यह भी दिखाया अनुक्रमण पढ़ता है और वैध हाय-सी जोड़े की आवश्यक संख्या के लिए विभिंन जीनोमिक तराजू पर जीनोमिक बातचीत का विश्लेषण कर रहे हैं । CRISPR/Cas9-मध्यस्थता आनुवंशिक तत्वों के आनुवंशिक संपादन और इस में नाभिक हाय-सी प्रोटोकॉल का उपयोग कर जीनोमिक बातचीत के उच्च संकल्प प्रोफाइलिंग आनुवंशिक तत्वों के संरचनात्मक समारोह की जांच के लिए एक शक्तिशाली संयोजन हो सकता है ।

Introduction

यूकेरियोट्स में, जीनोम को गुणसूत्रों में विभाजित किया जाता है जो इंटरफेज1के दौरान परमाणु अंतरिक्ष में विशिष्ट क्षेत्रों पर कब्जा करते हैं। गुणसूत्रों का गठन करने वाले गुणसूत्रों को दो मुख्य राज्यों में विभाजित किया जा सकता है: सुलभ गुणकों में से एक जो प्रतिलेखन रूप से स्वतंत्र है, और कॉम्पैक्ट क्रोमेटिन का दूसरा जो ट्रांसक्रिप्शनल दमनकारी है। ये क्रोमेटिन राज्य परमाणु अंतरिक्ष में अलग और शायद ही कभी मिश्रण करते हैं, जो नाभिक2में दो अलग-अलग डिब्बे बनाते हैं। उप-मेगाबेस पैमाने पर, सीमाएं उच्च आवृत्ति क्रोमेटिन इंटरैक्शन के डोमेन को अलग करती हैं, जिन्हें TADs कहा जाता है, जो क्रोमोसोमल संगठन3,4,5को चिह्नित करते हैं। स्तनधारियों में, टीएडी सीमाओं पर कोहेसिन और सीसीटीसी-बाध्यकारीकारक (सीटीसीएफ)6,7,8 द्वारा कब्जा कर लियाजाताहै। कोहेसिन परिसर क्रोमेटिन को बाहर निकालता है और सीटीसीएफ-बाध्यकारी स्थलों पर रुकता है जिन्हें जीनोमिक अनुक्रम में एक अभिसरण अभिविन्यास में निपटाया जाता है ताकि स्थिर क्रोमेटिन लूप9,10,13,14बनसके। सीमाओं पर सीटीसीएफ डीएनए-बाइंडिंग साइट के आनुवंशिक व्यवधान या सीटीसीएफ और कोहेसिन प्रोटीन प्रचुरता में कमी के परिणामस्वरूप नियामक तत्वों के बीच असामान्य बातचीत, टीएडी गठन की हानि, और जीन अभिव्यक्ति विनियमन9,10, 11,13,14।

ड्रोसोफिला में, TADs के बीच सीमाओं सीमा तत्व से जुड़े कारक ३२ केडीए (BEAF-३२), आकृति 1 बाध्यकारी प्रोटीन (M1BP), सेंट्रोसोमल प्रोटीन १९० (CP190), बालों के दमन विंग (SuHW), और CTCF सहित कई एपीएस द्वारा कब्जा कर रहे हैं, और सक्रिय हिस्टोन संशोधनों और बहुलकों द्वितीय16,17,18में समृद्ध हैं । यह सुझाव दिया गया है कि ड्रोसोफिला में, TADsप्रतिलेखन13,17, 19के परिणामस्वरूप दिखाई देता है, और सीमागठनऔर इन्सुलेशन गुणों में स्वतंत्र एपीएस की सही भूमिका की अभी जांच की जा रही है। इस प्रकार, चाहे ड्रोसोफिला में डोमेन समान प्रतिलेखन राज्यों के क्षेत्रों के एकत्रीकरण का एकमात्र परिणाम है या क्या सीटीसीएफ सहित एपीएस, सीमा निर्माण में योगदान करते हैं, पूरी तरह से विशेषता बनी हुई है । उच्च संकल्प पर जीनोमिक संपर्कों की खोज अगली पीढ़ी के अनुक्रमण के साथ-साथ गुणसूत्र संरचना कैप्चर प्रौद्योगिकियों के विकास के माध्यम से संभव हुई है । हाय-सी प्रोटोकॉल को सबसे पहले क्रोमेटिन टुकड़ों के बीच नकली लिगेशन उत्पादों से बचने के प्रयास में “समाधान में”2 प्रदर्शन किए गए लिगेशन चरण के साथ वर्णित किया गया था। हालांकि, कई अध्ययनों ने इस अहसास की ओर इशारा किया कि आंकड़ों में उपयोगी संकेत आंशिक रूप से lysed नाभिक पर बने लिगेशन उत्पादों से आया है जो समाधान20,21में नहीं थे ।

इसके बाद प्रोटोकॉल को एकल-कोशिका हाय-सी प्रयोग22के हिस्से के रूप में नाभिक के अंदर लिगेशन करने के लिए संशोधित किया गया था । इन-न्यूक्लियस हाई-सी प्रोटोकॉल को बाद में कोशिका जनसंख्या हाई-सी में शामिल किया गया ताकि जीनोमिक दूरी की पूरी श्रृंखला पर अधिक सुसंगत कवरेज प्राप्त किया जा सके और कम तकनीकी शोर23,24के साथ डेटा का उत्पादन कियाजासके। प्रोटोकॉल, यहां विस्तार से वर्णित है, जनसंख्या में नाभिक हाय-सी प्रोटोकॉल23, 24पर आधारित है और ड्रोसोफिला25 में पायदान जीन लोकस में एकडोमेन सीमा से सीटीसीएफ और M1BP के लिए डीएनए बाध्यकारी रूपांकनों को आनुवंशिक रूप से हटाने के परिणामों की जांच करने के लिए इस्तेमाल किया गया था । परिणाम बताते है कि सीमा पर एपीएस के लिए डीएनए बाध्यकारी रूपांकनों में फेरबदल पायदान डोमेन गठन के लिए कठोर परिणाम है, पायदान लोकस आसपास के क्षेत्रों में बड़ा स्थलाकृतिक दोष, और जीन अभिव्यक्ति विनियमन । यह इंगित करता है कि डोमेन सीमाओं पर आनुवंशिक तत्व ड्रोसोफिला25में जीनोम टोपोलॉजी और जीन अभिव्यक्ति के रखरखाव के लिए महत्वपूर्ण हैं ।

Protocol

1. निर्धारण 10 मिलियन श्नाइडर की लाइन 2 प्लस (S2R +) कोशिकाओं के साथ शुरू करें श्नाइडर माध्यम में एक सेल निलंबन के 17.5 एमएल तैयार करने के लिए जिसमें कमरे के तापमान (आरटी) पर 10% भ्रूण गोजातीय सीरम (एफबीएस) होता है…

Representative Results

नीचे वर्णित एक सफल हाई-सी प्रोटोकॉल के परिणाम हैं (चित्रा 1 एमें हाई-सी प्रोटोकॉल वर्कफ़्लो का सारांश देखें)। इन-न्यूक्लियस हाई-सी प्रयोग के दौरान कई गुणवत्ता नियंत्रण चौकियां हैं। नमूना aliquot…

Discussion

यहां प्रस्तुत इन-न्यूक्लियस हाय-सी विधि ने उच्च संकल्प पर ड्रोसोफिला जीनोम टोपोलॉजी की विस्तृत खोज की अनुमति दी है, जो विभिन्न जीनोमिक तराजू पर जीनोमिक इंटरैक्शन का एक दृश्य प्रदान करता है, जैसे प्रमो…

Disclosures

The authors have nothing to disclose.

Acknowledgements

इस काम को यूएनएएम टेक्नोलॉजी इनोवेशन एंड रिसर्च सपोर्ट प्रोग्राम (PAPIIT) अनुदान संख्या IN207319 और विज्ञान और प्रौद्योगिकी राष्ट्रीय परिषद (CONACyT-FORDECyT) अनुदान संख्या 303068 द्वारा समर्थित किया गया था। ई.एल. विज्ञान और प्रौद्योगिकी राष्ट्रीय परिषद (CONACyT) CVU नंबर 968128 द्वारा समर्थित एक मास्टर छात्र है ।

Materials

16% (vol/vol) paraformaldehyde solution Agar Scientific R1026
Biotin-14-dATP Invitrogen CA1524-016
ClaI enzyme NEB R0197S
COVARIS Ultrasonicator Covaris LE220-M220
Cut Smart NEB B72002S
Dulbecco's Modified Eagle Medium (DMEM) 1x Life Technologies 41965-039
Dynabeads MyOne Streptabidin C1 Invitrogen 65002
Fetal bovine serum (FBS) sterile filtered Sigma F9665
Klenow Dna PolI large fragment NEB M0210L
Klenow exo(-) NEB M0210S
Ligation Buffer NEB B020S
MboI enzyme NEB R0147M
NP40-Igepal SIGMA CA-420 Non-ionic surfactant for addition in lysis buffer
PE adapter 1.0 Illumina 5'-P-GATCGGAAGAGCGGTTCAGCAG
GAATGCCGAG-3'
PE adapter 2.0 Illumina 5'-ACACTCTTTCCCTACACGACGCT
CTTCCGATCT-3'
PE PCR primer 1.0 Illumina 5'-AATGATACGGCGACCACCGAGAT
CTACACTCTTTCCCTACACGACG
CTCTTCCGATCT-3'
PE PCR primer 2.0 Illumina 5'-CAAGCAGAAGACGGCATACGAG
ATCGGTCTCGGCATTCCTGCTGA
ACCGCTCTTCCGATCT-3'
Phenol: Chloroform:Isoamyl Alcohol 25:24:1 SIGMA P2069
Primer 1 (known interaction, Figure 2A) Sigma 5'-TCGCGGTAATTTTGCGTTTGA-3'
Primer 2 (known interactions, Figure 2A) Sigma 5'-CCTCCCTGCCAAAACGTTTT-3'
Protease inhibitor cocktail tablet Roche 4693132001
Proteinase K Roche 3115879001
Qubit ThermoFisher Q33327
RNAse Roche 10109142001
SPRI Beads Beckman B23318
T4 DNA ligase Invitrogen 15224-025
T4 DNA polymerase NEB M0203S
T4 polynucleotide kinase (PNK)  NEB M0201L
TaqPhusion NEB M0530S DNA polymerase
Triton X-100 Non-ionic surfactant for quenching of SDS
DOWNLOAD MATERIALS LIST

References

  1. Cremer, T., Cremer, C. Chromosome territories, nuclear architecture and gene regulation in mammalian cells. Nature Review Genetics. 2, 292-301 (2001).
  2. Lieberman-Aiden, E., et al. Comprehensive mapping of long-range interactions reveals folding principles of the human genome. Science. 326, 289-293 (2009).
  3. Dixon, J. R., et al. Topological domains in mammalian genomes identified by analysis of chromatin interactions. Nature. 485, 376-380 (2012).
  4. Sexton, T., et al. Three-dimensional folding and functional organization principles of the Drosophila genome. Cell. 148 (3), 458-472 (2012).
  5. Dixon, J. R., Gorkin, D. U., Ren, B. Chromatin domains: the unit of chromosome organization. Molecular Cell. 62, 668-680 (2016).
  6. Bonev, B., Cavalli, G. Organization and function of the 3D genome. Nature Reviews Genetics. 17, 661-678 (2016).
  7. Lupiáñez, D. G., Spielmann, M., Mundlos, S. Breaking TADs: how alterations of chromatin domains result in disease. Trends in Genetics. 32, 225-237 (2016).
  8. Phillips, J. E., Corces, V. G. CTCF: master weaver of the genome. Cell. 137 (7), 1194-1211 (2009).
  9. Hong, S., Kim, D. Computational characterization of chromatin domain boundary-associated genomic elements. Nucleic Acids Research. 45, 10403-10414 (2017).
  10. Zuin, J., et al. Cohesin and CTCF differentially affect chromatin architecture and gene expression in human cells. Proceedings of the National Academy of Sciences of the United States of America. 111 (3), 996-1001 (2014).
  11. Guo, Y., et al. CRISPR inversion of CTCF sites alters genome topology and enhancer/promoter function. Cell. 162, 900-910 (2015).
  12. Lupiáñez, D. G., et al. Disruptions of topological chromatin domains cause pathogenic rewiring of gene-enhancer interactions. Cell. 161, 1012-1025 (2015).
  13. Van-Steensel, B., Furlong, E. E. M. The role of transcription in shaping the spatial organization of the genome. Nature Reviews Molecular Cell Biology. 20, 327-337 (2019).
  14. Merkenschlager, M., Nora, E. P. CTCF and cohesin in genome folding and transcriptional gene regulation. Annual Review of Genomics and Human Genetics. 17 (1), 17-43 (2016).
  15. Hansen, A. S., Pustova, I., Cattoglio, C., Tjian, R., Darzacq, X. CTCF and cohesin regulate chromatin loop stability with distinct dynamics. Elife. 6, 1-10 (2017).
  16. Van Bortle, K., et al. Insulator function and topological domain border strength scale with architectural protein occupancy. Genome Biology. 15, 82 (2014).
  17. Ramírez, F., et al. High-resolution TADs reveal DNA sequences underlying genome organization in flies. Nature Communications. 9, 189 (2018).
  18. Ulianov, S. V., et al. Active chromatin and transcription play a key role in chromosome partitioning into topologically associating domains. Genome Research. 26, 70-84 (2016).
  19. Rowley, M. J., et al. Evolutionarily conserved principles predict 3D chromatin organization. Molecular Cell. 67, 837-852 (2017).
  20. Gavrilov, A. A., Golov, A. K., Razin, S. V. Actual ligation frequencies in the chromosome conformation capture procedure. PLoS One. 8, 60403 (2013).
  21. Gavrilov, A. A., et al. Disclosure of a structural milieu for the proximity ligation reveals the elusive nature of an active chromatin hub. Nucleic Acids Research. 41, 3563-3575 (2013).
  22. Nagano, T., et al. Single-cell Hi-C reveals cell-to-cell variability in chromosome structure. Nature. 502, 59-64 (2013).
  23. Rao, S. S. P., et al. A 3D map of the human genome at kilobase resolution reveals principles of chromatin looping. Cell. 159 (7), 1665-1680 (2014).
  24. Nagano, T., et al. Comparison of Hi-C results using in-solution versus in-nucleus ligation. Genome Biology. 16, 175 (2015).
  25. Arzate-Mejía, R., et al. In situ dissection of domain boundaries affect genome topology and gene transcription in Drosophila. Nature Communications. 11, 894 (2020).
  26. Schoenfelder, S., et al. Promoter capture Hi-C: high-resolution, genome-wide profiling of promoter interactions. Journal of Visualized Experiments. (136), e57320 (2018).
  27. Servant, N., et al. HiC-Pro: an optimized and flexible pipeline for Hi-C processing. Genome Biology. 16, 259 (2015).
  28. Philip, E., Måns, M., Sverker, L., Max, K. MultiQC: Summarize analysis results for multiple tools and samples in a single report. Bioinformatics. 10, 1093 (2016).
  29. Wingett, S., et al. HiCUP: pipeline for mapping and processing Hi-C data. F1000 Research. 4, 1310 (2015).
  30. Imakaev, M., et al. Iterative correction of Hi-C data reveals hallmarks of chromosome organization. Nature Methods. 9 (10), 999-1003 (2012).
  31. Akdemir, K. C., Chin, L. HiCPlotter integrates genomic data with interaction matrices. Genome Biolog. 16, 198 (2015).
  32. Ramirez, F., et al. High-resolution TADs reveal DNA sequences underlying genome organization in flies. Nature Communications. 9, 189 (2018).
  33. Ando-Kuri, M., et al. The global and promoter-centric 3D genome organization temporally resolved during a circadian cycle. bioRxiv. , (2020).
  34. Cuellar-Partida, G., et al. Epigenetic priors for identifying active transcription factor binding sites. Bioinformatics. 28 (1), 56-62 (2012).
  35. Zhang, Y., et al. Model-based analysis of ChIP-Seq (MACS). Genome Biology. 9, 137 (2008).
  36. Ong, C. -. T., et al. Poly(ADP-ribosyl)ation regulates insulator function and intrachromosomal interactions in Drosophila. Cell. 155 (1), 148-159 (2013).
  37. Fresán, U., et al. The insulator protein CTCF regulates Drosophila steroidogenesis. Biology Open. 4 (7), 852-857 (2015).
  38. Quinodoz, S., et al. RNA promotes the formation of spatial compartments in the nucleus. Cell. 174, 744-757 (2018).
  39. Olivares-Chauvet, P., et al. Capturing pairwise and multi-way chromosomal conformations using chromosomal walks. Nature. 540 (7632), 296-300 (2016).
  40. Beagrie, R., et al. Complex multi-enhancer contacts captured by genome architecture mapping. Nature. 543, 519-524 (2017).
  41. Redolfi, J., et al. DamC reveals principles of chromatin folding in vivo without crosslinking and ligation. Nature Structural and Molecular Biology. 26, 471-480 (2019).
  42. Maxwell, R., et al. HiChIP: efficient and sensitive analysis of protein-directed genome architecture. Nature Methods. 13, 919-922 (2016).
  43. Gao, X., et al. C-BERST: Defining subnuclear proteomic landscapes at genomic elements with dCas9-APEX2. Nature Methods. 15 (6), 433-436 (2018).

Tags

Keywords: Hi-CChromatin ConformationGenome OrganizationChromosomal InteractionsDrosophila CellsNuclear ClumpsFormaldehyde CrosslinkingGlycine QuenchingCell LysisRestriction Enzyme DigestionSDS PermeabilizationTriton TreatmentQuality ControlSequencing
check_url/kr/62106?article_type=t

Play Video
PDF
DOI
DOWNLOAD MATERIALS LIST
Cite This Article
Esquivel-López, A., Arzate-Mejía, R., Pérez-Molina, R., Furlan-Magaril, M. In-Nucleus Hi-C in Drosophila Cells. J. Vis. Exp. (175), e62106, doi:10.3791/62106 (2021).
Download Citation
Reprints and Permissions

View Video

✖

To prove you're not a robot, please enter the text in the image below

CAPTCHA Image
Play CAPTCHA Audio
Refresh Image