JoVE Journal > Biochemistry
Summary
Abstract
Introduction
Protocol
Results
Discussion
Disclosures
Acknowledgements
Materials
References
자동 번역
Please note that all translations are automatically generated. Click here for the English version.
생화학

Optisch pincet om RNA-eiwitinteracties in vertaalregelgeving te bestuderen

Published: February 12, 2022
doi:
10.3791/62589
, ,
1Helmholtz Institute for RNA-based Infection Research (HIRI),Helmholtz Zentrum für Infektionsforschung (Helmholtz Centre for Infection Research), 2Medical Faculty,Julius-Maximilians University Würzburg

Summary

Dit protocol presenteert een complete experimentele workflow voor het bestuderen van RNA-eiwitinteracties met behulp van optische pincetten. Verschillende mogelijke experimentele opstellingen worden geschetst, waaronder de combinatie van een optisch pincet met confocale microscopie.

Abstract

RNA neemt verschillende structurele plooien aan, die essentieel zijn voor zijn functies en daardoor verschillende processen in de cel kunnen beïnvloeden. Bovendien kan de structuur en functie van een RNA worden gemoduleerd door verschillende trans-acterende factoren, zoals eiwitten, metabolieten of andere RNA’s. Frameshifting RNA-moleculen zijn bijvoorbeeld regulerende RNA’s in coderende regio’s, die het vertalen van ribosomen naar een alternatief open leeskader sturen en daardoor fungeren als genschakelaars. Ze kunnen ook verschillende plooien aannemen na binding aan eiwitten of andere transfactoren. Om de rol van RNA-bindende eiwitten in translatie te ontleden en hoe ze de RNA-structuur en stabiliteit moduleren, is het cruciaal om het samenspel en de mechanische kenmerken van deze RNA-eiwitcomplexen tegelijkertijd te bestuderen. Dit werk illustreert hoe single-molecule-fluorescentie-gekoppelde optische pincetten kunnen worden gebruikt om het conformationele en thermodynamische landschap van RNA-eiwitcomplexen met een hoge resolutie te verkennen. Als voorbeeld wordt de interactie van het SARS-CoV-2 geprogrammeerde ribosomale frameshifting element met de trans-acterende factor korte isovorm van zink-vinger antiviraal eiwit uitgewerkt. Bovendien werden fluorescentie-gelabelde ribosomen gecontroleerd met behulp van de confocale eenheid, die uiteindelijk de studie van translatie-elongatie mogelijk zou maken. De fluorescentie gekoppelde OT-test kan op grote schaal worden toegepast om diverse RNA-eiwitcomplexen of trans-acterende factoren die de translatie reguleren te onderzoeken en zou studies van op RNA gebaseerde genregulatie kunnen vergemakkelijken.

Introduction

Overdracht van genetische informatie van DNA naar eiwitten via mRNA’s is een complex biochemisch proces, dat op alle niveaus nauwkeurig wordt gereguleerd door macromoleculaire interacties in cellen. Voor translationele regulatie spelen RNA-eiwitinteracties een cruciale rol om snel te reageren op verschillende stimuli en signalen1,2. Sommige RNA-eiwitinteracties beïnvloeden de mRNA-stabiliteit en veranderen daardoor de tijd dat een RNA translatief actief is. Andere RNA-eiwitinteracties zijn geassocieerd met hercoderingsmechanismen zoals stop-codon readthrough, bypassing of geprogrammeerde ribosomale frameshifting (PRF)3,4,5,6,7. Onlangs is aangetoond dat een aantal RNA-bindende eiwitten (RBP’s) interageren met stimulerende mRNA-elementen en de translatiemachinerie om te bepalen wanneer en hoeveel hercodering in de cel zal plaatsvinden7,8,9,10,11. Dus, om de rol van RNA-bindende eiwitten in translatie te ontleden en hoe ze de RNA-structuur en stabiliteit moduleren, is het cruciaal om de interactieprincipes en mechanische eigenschappen van deze RNA-eiwitcomplexen in detail te bestuderen.

Tientallen jaren werk hebben de basis gelegd voor het bestuderen van het meerstaps- en meercomponentenproces van vertaling, dat afhankelijk is van ingewikkelde communicatie tussen het RNA en eiwitcomponenten van de vertaalmachinerie om snelheid en nauwkeurigheid te bereiken12,13,14. Een cruciale volgende stap in het begrijpen van complexe regulerende gebeurtenissen is het bepalen van de krachten, tijdschalen en structurele determinanten tijdens translatie met hoge precisie12,15,16,17. De studie van RNA-conformatiedynamica en vooral hoe trans-acterende hulpfactoren tijdens translatie op de RNA-structuur inwerken, is verder verlicht door de opkomst van hulpmiddelen met één molecuul, waaronder optische pincetten of nulmodusgolfgeleiders16,17,18,19,20,21,22,23,24 ,25,26.

Optische pincetten (OT) vertegenwoordigen een zeer nauwkeurige single-molecule techniek, die is toegepast om vele soorten RNA-afhankelijke dynamische processen te bestuderen, waaronder transcriptie, en translatie26,27,28,29,30,31,32. Het gebruik van een optisch pincet heeft het mogelijk gemaakt om moleculaire interacties, nucleïnezuurstructuren en thermodynamische eigenschappen, kinetiek en energetica van deze processen in detail te onderzoeken16,17,22,33,34,35,36,37,38,39 . Optische pincet assay is gebaseerd op de beknelling van microscopische objecten met een gerichte laserstraal. In een typisch OT-experiment wordt het betreffende molecuul vastgebonden tussen twee transparante (meestal polystyreen) kralen (figuur 1A)27. Deze kralen worden vervolgens gevangen door optische vallen, die zich gedragen als veren. De kracht die op het molecuul wordt uitgeoefend, kan dus worden berekend op basis van de verplaatsing van de kraal uit het midden van de gerichte laserstraal (valcentrum). Onlangs is een optisch pincet gecombineerd met confocale microscopie (figuur 1B), waardoor fluorescentie- of Förster resonantie-energieoverdracht (FRET)-metingen40,41,42 mogelijk zijn. Dit opent een heel nieuw veld van mogelijke experimenten die gelijktijdige meting en dus nauwkeurige correlatie van krachtspectroscopie en fluorescentiegegevens mogelijk maken.

Hier demonstreren we experimenten met behulp van het optische pincet in combinatie met confocale microscopie om eiwit-RNA-interacties te bestuderen die translationele frameshifting reguleren. Tussen het objectief en de condensor maakt een stroomcel met vijf kanalen een continue monstertoepassing met laminaire stroming mogelijk. Via de microfluïdische kanalen kunnen verschillende componenten direct worden geïnjecteerd, wat de hands-on tijd vermindert en zeer weinig monsterverbruik tijdens het experiment mogelijk maakt.

Eerst wordt een basisrichtlijn voorgesteld om het ontwerp van OT-experimenten te ondersteunen en worden voordelen en valkuilen van verschillende opstellingen besproken. Vervolgens wordt de voorbereiding van monsters en experimentele workflows beschreven en wordt een protocol voor de data-analyse verstrekt. Om een voorbeeld te geven, schetsen we de resultaten verkregen van RNA-stretching-experimenten om het SARS-CoV-2 frameshifting RNA-element (figuur 2A) te bestuderen met de trans-acterende factor de korte isovorm van zink-vinger antiviraal eiwit (ZAP), dat de vertaling van het virale RNA van een alternatief leesframe verandert43. Bovendien is aangetoond dat fluorescentie-gelabelde ribosomen kunnen worden gebruikt in deze OT confocale assay, wat nuttig zou zijn om de processiviteit en snelheid van de vertaalmachinerie te controleren. De hier gepresenteerde methode kan worden gebruikt om snel het effect van verschillende buffers, liganden of andere cellulaire componenten te testen om verschillende aspecten van translatie te bestuderen. Tot slot worden veelvoorkomende experimentele valkuilen besproken en hoe deze op te lossen. Hieronder worden enkele cruciale punten in experimenteel ontwerp geschetst.

Ontwerp construeren
In principe zijn er twee gangbare benaderingen om een OT-compatibel RNA-construct te maken. De eerste benadering maakt gebruik van een lang RNA-molecuul dat is gehybridiseerd met complementaire DNA-handvatten, waardoor een construct ontstaat dat bestaat uit twee RNA / DNA-hybride regio’s die een enkelstrengs RNA-sequentie in het midden flankeren (figuur 2B). Deze aanpak wordt gebruikt in de meeste OT RNA-experimenten33,44,45.

De tweede benadering maakt gebruik van dsDNA-handgrepen met korte (ongeveer 20 nt) overhangen15,17. Deze overhangen worden vervolgens gehybridiseerd met het RNA-molecuul. Hoewel ingewikkelder in ontwerp, overwint het gebruik van dsDNA-handles enkele beperkingen van het DNA / RNA-hybride systeem. In principe kunnen zelfs zeer lange handgrepen (>10kb) worden geïmplementeerd, wat handiger is voor confocale metingen. Bovendien kan het RNA-molecuul worden geligeerd aan DNA-handvatten om de stabiliteit van de tether te vergroten.

End-labeling strategie
Het construct moet via een sterke moleculaire interactie aan kralen worden vastgemaakt. Hoewel er benaderingen beschikbaar zijn voor covalente binding van handvatten aan kralen46, worden sterke maar niet-covalente interacties zoals streptavidin-biotine en digoxigenine-antilichaam vaak gebruikt in OT-experimenten15,33,35,45. In het beschreven protocol wordt het construct gelabeld met biotine of digoxigenine en zijn de kralen gecoat met respectievelijk streptavidin of antilichamen tegen digoxigenine (figuur 1A). Deze aanpak zou geschikt zijn voor het toepassen van krachten tot ongeveer 60 pN (per tether)47. Bovendien maakt het gebruik van verschillende 5′- en 3′-etiketteringsstrategieën het mogelijk om de oriëntatie van de tussen de kralen gevormde ketting te bepalen17.

Eiwitetikettering voor fluorescentiemetingen
Voor de confocale beeldvorming zijn er verschillende veelgebruikte benaderingen voor fluorescentie-etikettering. Fluoroforen kunnen bijvoorbeeld covalent worden gehecht aan aminozuurresiduen die inheems in eiwitten worden aangetroffen of door plaatsgerichte mutagenese via een reactieve organische groep worden geïntroduceerd. Thiol of amine-reactieve kleurstoffen kunnen worden gebruikt voor het etiketteren van respectievelijk cysteïne- en lysineresiduen. Er zijn verschillende omkeerbare beschermingsmethoden om de specificiteit van etikettering te vergroten48,49, maar inheemse eiwitten worden meestal gelabeld op meerdere residuen. Hoewel de kleine omvang van de fluorofoor een voordeel kan bieden, kan niet-specifieke etikettering de eiwitactiviteit verstoren en dus de signaalintensiteit variëren49. Afhankelijk van de etikettering kan de intensiteit van het efficiëntiesignaal ook verschillen tussen verschillende experimenten. Daarom moet voorafgaand aan het experiment een activiteitencontrole worden uitgevoerd.

In het geval dat het eiwit van belang een N- of C-terminale tag bevat, zoals een His-tag of streptokokkentag, vertegenwoordigt specifieke etikettering van deze tags een andere populaire benadering. Bovendien vermindert tag-gerichte etikettering de kans dat de fluorofoor de eiwitactiviteit verstoort en kan de oplosbaarheid verbeteren49. Tag-specifieke etikettering levert echter meestal mono-fluorofoor gelabelde eiwitten op, die een uitdaging kunnen zijn om te detecteren. Een andere manier van specifieke etikettering kan worden bereikt door antilichamen te gebruiken.

Microfluïdica-installatie
De combinatie van OT met een microfluïdicasysteem maakt een snelle overgang tussen verschillende experimentele omstandigheden mogelijk. Bovendien maken de huidige systemen gebruik van het behoud van de laminaire stroming in de stroomcel, waardoor het mengen van vloeistoffen uit andere kanalen in de loodrechte richting ten opzichte van de stroomrichting wordt uitgesloten. Daarom is laminaire stroming bijzonder voordelig voor het experimentele ontwerp. Momenteel worden vaak flowcellen met maximaal 5 kanalen gebruikt (figuur 3).

Protocol

1. Monstervoorbereiding Kloon de interessante sequentie in de vector met de Lambda DNA-fragmenten, die dienen als de handvatsequenties (figuur 2)43,50. Genereer eerst een DNA-sjabloon voor daaropvolgende in vitro transcriptie via PCR (figuur 2B; reactie 1). Bij deze PCR-stap wordt de T7-promotor toegevoegd aan het 5′-uiteinde van het zintuig DNA-molecuul32,33…

Representative Results

In deze sectie wordt voornamelijk aandacht besteed aan metingen van RNA-eiwit/ligand interacties door het fluorescentie optische pincet. Voor een beschrijving van algemene RNA optische pincet experimenten en bijbehorende representatieve resultaten, zie32. Voor meer gedetailleerde bespreking van de RNA/DNA-eiwit interacties, zie ook1,2,26,59,60.<sup class="xref…

Discussion

Hier demonstreren we het gebruik van fluorescentie-gekoppelde optische pincetten om interacties en dynamisch gedrag van RNA-moleculen met verschillende liganden te bestuderen. Hieronder worden kritische stappen en beperkingen van de huidige techniek besproken.

Kritieke stappen in het protocol
Zoals voor veel andere methoden is de kwaliteit van het monster van cruciaal belang om betrouwbare gegevens te verkrijgen. Daarom, om monsters van de hoogst mogelijke kwaliteit te verk…

Disclosures

The authors have nothing to disclose.

Acknowledgements

We bedanken Anuja Kibe en Jun. Prof. Redmond Smyth voor het kritisch beoordelen van het manuscript. Wij danken Tatyana Koch voor de deskundige technische bijstand. We bedanken Kristyna Pekarkova voor de hulp bij het opnemen van experimentele video’s. Het werk in ons laboratorium wordt ondersteund door de Helmholtz Association en financiering van de European Research Council (ERC) Grant Nr. 948636 (to NC).

Materials

Bacterial Strains
E. coli HB101 lab collection N/A cloning of the vectors
Chemicals and enzymes
Sodium chloride Sigma-Aldrich 31424 Buffers
Biotin-16-dUTP Roche 11093070910 Biotinylation
BSA Sigma-Aldrich A4737 Buffers
Catalase Lumicks N/A Oxygen scavanger system
Dithiothreitol (DTT) Melford Labs D11000 Buffers
DNAse I from bovine pancreas Sigma-Aldrich D4527 in vitro transcription
dNTPs Th.Geyer 11786181 PCR
EDTA Sigma-Aldrich E9884 Buffers
Formamide Sigma-Aldrich 11814320001 Buffers
Glucose Sigma-Aldrich G8270-1KG Oxygen scavanger system
Glucose-oxidase Lumicks N/A Oxygen scavanger system
HEPES Carl Roth HN78.3 Buffers
Magnesium chloride Carl Roth 2189.1 Buffers
Phusion DNA polymerase NEB M0530L Gibson assembly, cloning
Potassium chloride Merck 529552-1KG Buffers
PrimeSTAR GXL DNA Polymerase Takara Bio Clontech R050A PCR
Pyrophosphotase, thermostabile, inorganic NEB M0296L in vitro transcription
RNase Inhibitor Molox 1000379515 Buffers
rNTPS life technologies R0481 in vitro transcription
Sodium thiosulophate Sigma-Aldrich S6672-500G Bleach deactivation
Sytox Green Lumicks N/A confocal measurements
T4 DNA Polymerase NEB M0203S Biotinylation
T5 exonuclease NEB M0363S Gibson assembly, cloning
T7 RNA polymerase Produced in-house N/A in vitro transcription
Taq DNA polymerase NEB M0267S PCR
Taq ligase Biozym L6060L Gibson assembly, cloning
TWEEN 20 BioXtra Sigma-Aldrich P7949 Buffers
Kits
Monolith Protein Labeling Kit RED-NHS 2nd Generation (Amine Reactive) Nanotemper MO-L011 Used for ribosome labeling
Purefrex 2.0 GeneFrontier PF201-0.25-EX Ribosomes used for the labeling
Oligonucleotides
5' handle T7 forward Microsynth custom order 5’ – CTTAATACGACTCACTATAGGTC
CTTTCTGTGGACGCC – 3’, used to generate OT in vitro transcription template in PCR 1
3’ handle reverse Microsynth custom order 5' -  GTCAAAGTGCGCCCCGTTATCC – 3', used to generate OT in vitro transcription template in PCR 1
5' handle forward Microsynth custom order 5' – TCCTTTCTGTGGACGCCGC – 3' , used to generate 5' handle in PCR 2
5’ handle reverse Microsynth custom order 5’ – CATAAATACCTCTTTACTAATATA
TATACCTTCGTAAGCTAGCGT – 3’, used to generate 5' handle in PCR 2
3’ handle forward Microsynth custom order 5' – ATCCTGCAACCTGCTCTTCGCC
AG – 3', used to generate 3' handle in PCR 3
3’ handle reverse 5’labeled with digoxigenin Microsynth custom order 5' -[Dig]-GTCAAAGTGCGCCCCGTTATCC – 3', used to generate 3' handle in PCR 3
DNA vectors
pMZ_OT produced in-house N/A further description in "Structural studies of Cardiovirus 2A protein reveal the molecular basis for RNA recognition and translational control"
Chris H. Hill, Sawsan Napthine, Lukas Pekarek, Anuja Kibe, Andrew E. Firth, Stephen C. Graham, Neva Caliskan, Ian Brierley
bioRxiv 2020.08.11.245035; doi: https://doi.org/10.1101/2020.08.11.245035
Software and Algorithms
Atom https://atom.io/packages/ide-python N/A
Bluelake Lumicks N/A
Graphpad https://www.graphpad.com/ N/A
InkScape 0.92.3 https://inkscape.org/ N/A
Matlab https://www.mathworks.com/products/matlab.html N/A
POTATO https://github.com/lpekarek/POTATO.git N/A
RNAstructure https://rna.urmc.rochester.edu/RNAstructure.html N/A
Spyder https://www.spyder-ide.org/ N/A
기타
Streptavidin Coated Polystyrene Particles, 1.5-1.9 µm, 5 ml, 1.0% w/v Spherotech SVP-15-5
Anti-digoxigenin Coated Polystyrene Particles, 2.0-2.4 µm, 2 ml, 0.1% w/v Spherotech DIGP-20-2
Syringes VWR TERUMO SS+03L1
Devices
C-trap Lumicks N/A  optical tweezers coupled with confocal microscopy
DOWNLOAD MATERIALS LIST

References

  1. Balcerak, A., Trebinska-Stryjewska, A., Konopinski, R., Wakula, M., Grzybowska, E. A. RNA-protein interactions: disorder, moonlighting and junk contribute to eukaryotic complexity. Open Biology. 9 (6), 190096 (2019).
  2. Armaos, A., Zacco, E., Sanchez de Groot, N., Tartaglia, G. G. RNA-protein interactions: Central players in coordination of regulatory networks. BioEssays. 43 (2), 2000118 (2021).
  3. Firth, A. E., Brierley, I. Non-canonical translation in RNA viruses. Journal of General Virology. 93, 1385-1409 (2012).
  4. Caliskan, N., Peske, F., Rodnina, M. V. Changed in translation: mRNA recoding by −1 programmed ribosomal frameshifting. Trends in Biochemical Sciences. 40 (5), 265-274 (2015).
  5. Jaafar, Z. A., Kieft, J. S. Viral RNA structure-based strategies to manipulate translation. Nature Reviews Microbiology. 17 (2), 110-123 (2019).
  6. Eswarappa, S. M., et al. Programmed translational readthrough generates antiangiogenic VEGF-Ax. Cell. 157 (7), 1605-1618 (2014).
  7. Rodnina, M. V., et al. Translational recoding: canonical translation mechanisms reinterpreted. Nucleic Acids Research. 48 (3), 1056-1067 (2020).
  8. Li, Y., et al. Transactivation of programmed ribosomal frameshifting by a viral protein. Proceedings of the National Academy of Sciences. 111 (21), 2172 (2014).
  9. Napthine, S., et al. Protein-directed ribosomal frameshifting temporally regulates gene expression. Nature Communications. 8 (1), 15582 (2017).
  10. Patel, A., et al. Molecular characterization of the RNA-protein complex directing -2/-1 programmed ribosomal frameshifting during arterivirus replicase expression. Journal of Biological Chemistry. 295 (52), 17904-17921 (2020).
  11. Napthine, S., Bell, S., Hill, C. H., Brierley, I., Firth, A. E. Characterization of the stimulators of protein-directed ribosomal frameshifting in Theiler’s murine encephalomyelitis virus. Nucleic Acids Research. 47 (15), 8207-8223 (2019).
  12. Marshall, R. A., Aitken, C. E., Dorywalska, M., Puglisi, J. D. Translation at the Single-Molecule Level. Annual Review of Biochemistry. 77 (1), 177-203 (2008).
  13. Rodnina, M. V. The ribosome in action: Tuning of translational efficiency and protein folding. Protein science : A publication of the Protein Society. 25 (8), 1390-1406 (2016).
  14. Rodnina, M. V., Fischer, N., Maracci, C., Stark, H. Ribosome dynamics during decoding. Philosophical Transactions of Royal Society of London B Biological Sciences. 372 (1716), (2017).
  15. Yan, S., Wen, J. D., Bustamante, C., Tinoco, I. Ribosome excursions during mRNA translocation mediate broad branching of frameshift pathways. Cell. 160 (5), 870-881 (2015).
  16. Liu, T., et al. Direct measurement of the mechanical work during translocation by the ribosome. eLife. 3, 03406 (2014).
  17. Desai, V. P., et al. Co-temporal force and fluorescence measurements reveal a ribosomal gear shift mechanism of translation regulation by structured mRNAs. Molecular Cell. 75 (5), 1007-1019 (2019).
  18. Choi, J., O’Loughlin, S., Atkins, J. F., Puglisi, J. D. The energy landscape of -1 ribosomal frameshifting. Science Advances. 6 (1), (2020).
  19. Prabhakar, A., Puglisi, E. V., Puglisi, J. D. Single-molecule fluorescence applied to translation. Cold Spring Harbor Perspectives in Biology. 11 (1), 032714 (2019).
  20. Bao, C., et al. mRNA stem-loops can pause the ribosome by hindering A-site tRNA binding. Elife. 9, 55799 (2020).
  21. Chen, J., Tsai, A., O’Leary, S. E., Petrov, A., Puglisi, J. D. Unraveling the dynamics of ribosome translocation. Current Opinion in Structural Biology. 22 (6), 804-814 (2012).
  22. Qu, X., et al. The ribosome uses two active mechanisms to unwind messenger RNA during translation. Nature. 475 (7354), 118-121 (2011).
  23. Zheng, Q., et al. Ultra-stable organic fluorophores for single-molecule research. Chemical Society Reviews. 43 (4), 1044-1056 (2014).
  24. Blanchard, S. C. Single-molecule observations of ribosome function. Current Opinion in Structural Biology. 19 (1), 103-109 (2009).
  25. Juette, M. F., et al. The bright future of single-molecule fluorescence imaging. Current Opinion in Chemical Biology. 20, 103-111 (2014).
  26. McCauley, M. J., Williams, M. C. Mechanisms of DNA binding determined in optical tweezers experiments. Biopolymers. 85 (2), 154-168 (2007).
  27. Ashkin, A., Dziedzic, J. M., Bjorkholm, J. E., Chu, S. Observation of a single-beam gradient force optical trap for dielectric particles. Optics Letters. 11 (5), 288-290 (1986).
  28. Bustamante, C., Smith, S. B., Liphardt, J., Smith, D. Single-molecule studies of DNA mechanics. Current Opinion in Structural Biology. 10 (3), 279-285 (2000).
  29. Choudhary, D., Mossa, A., Jadhav, M., Cecconi, C. Bio-molecular applications of recent developments in optical tweezers. Biomolecules. 9 (1), 23 (2019).
  30. Moffitt, J. R., Chemla, Y. R., Smith, S. B., Bustamante, C. Recent advances in optical tweezers. Annual Reviews of Biochemistry. 77, 205-228 (2008).
  31. Li, P. T. X., Vieregg, J., Tinoco, I. How RNA Unfolds and Refolds. Annual Review of Biochemistry. 77 (1), 77-100 (2008).
  32. Stephenson, W., Wan, G., Tenenbaum, S. A., Li, P. T. Nanomanipulation of single RNA molecules by optical tweezers. Journal of Visualized Experiments. (90), e51542 (2014).
  33. Halma, M. T. J., Ritchie, D. B., Cappellano, T. R., Neupane, K., Woodside, M. T. Complex dynamics under tension in a high-efficiency frameshift stimulatory structure. Proceedings of the National Academy of Sciences. 116 (39), 19500 (2019).
  34. Hansen, T. M., Reihani, S. N. S., Oddershede, L. B., Sørensen, M. A. Correlation between mechanical strength of messenger RNA pseudoknots and ribosomal frameshifting. Proceedings of the National Academy of Sciences of the United States of America. 104 (14), 5830-5835 (2007).
  35. Zhong, Z., et al. Mechanical unfolding kinetics of the SRV-1 gag-pro mRNA pseudoknot: possible implications for -1 ribosomal frameshifting stimulation. Science Reports. 6, 39549 (2016).
  36. McCauley, M. J., Rouzina, I., Li, J., Núñez, M. E., Williams, M. C. Significant differences in RNA structure destabilization by HIV-1 GagDp6 and NCp7 proteins. Viruses. 12 (5), 484 (2020).
  37. de Messieres, M., et al. Single-molecule measurements of the CCR5 mRNA unfolding pathways. Biophysics Journal. 106 (1), 244-252 (2014).
  38. Yang, L., et al. Single-molecule mechanical folding and unfolding of RNA hairpins: Effects of single A-U to A·C pair substitutions and single proton binding and implications for mRNA structure-induced -1 ribosomal frameshifting. Journal of American Chemical Society. 140 (26), 8172-8184 (2018).
  39. McCauley, M. J., et al. Targeted binding of nucleocapsid protein transforms the folding landscape of HIV-1 TAR RNA. Proceedings of the National Academy of Sciences of the United States of America. 112 (44), 13555-13560 (2015).
  40. Whitley, K. D., Comstock, M. J., Chemla, Y. R. High-resolution "Fleezers": Dual-trap optical tweezers combined with single-molecule fluorescence detection. Methods in Molecular Biology. 1486, 183-256 (2017).
  41. Yerramilli, V. S., Kim, K. H. Labeling RNAs in live cells using malachite green aptamer scaffolds as fluorescent probes. ACS Synthetic Biology. 7 (3), 758-766 (2018).
  42. Gross, P., Farge, G., Peterman, E. J., Wuite, G. J. Combining optical tweezers, single-molecule fluorescence microscopy, and microfluidics for studies of DNA-protein interactions. Methods in Enzymology. 475, 427-453 (2010).
  43. Zimmer, M. M., et al. The short isoform of the host antiviral protein ZAP acts as an inhibitor of SARS-CoV-2 programmed ribosomal frameshifting. Nature Communications. 12 (1), 7193 (2021).
  44. Neupane, K., Yu, H., Foster, D. A. N., Wang, F., Woodside, M. T. Single-molecule force spectroscopy of the add adenine riboswitch relates folding to regulatory mechanism. Nucleic acids research. 39 (17), 7677-7687 (2011).
  45. Ritchie, D. B., Soong, J., Sikkema, W. K., Woodside, M. T. Anti-frameshifting ligand reduces the conformational plasticity of the SARS virus pseudoknot. Journal of the American Chemical Society. 136 (6), 2196-2199 (2014).
  46. Janissen, R., et al. Invincible DNA tethers: covalent DNA anchoring for enhanced temporal and force stability in magnetic tweezers experiments. Nucleic Acids Research. 42 (18), 137 (2014).
  47. Smith, S. B., Cui, Y., Bustamante, C. Overstretching B-DNA: The elastic response of individual double-stranded and single-stranded DNA molecules. Science. 271 (5250), 795 (1996).
  48. Puljung, M. C., Zagotta, W. N. Labeling of specific cysteines in proteins using reversible metal protection. Biophysical Journal. 100 (10), 2513-2521 (2011).
  49. Toseland, C. P. Fluorescent labeling and modification of proteins. Journal of Chemical Biology. 6 (3), 85-95 (2013).
  50. Hill, C. H., et al. Structural and molecular basis for Cardiovirus 2A protein as a viral gene expression switch. Nature Communications. 12 (1), 7166 (2021).
  51. Butterworth, S. On the theory of filter amplifiers. Experimental Wireless and the Wireless Engineer. 7, 536-541 (1930).
  52. Wang, M. D., Yin, H., Landick, R., Gelles, J., Block, S. M. Stretching DNA with optical tweezers. Biophysics Journal. 72 (3), 1335-1346 (1997).
  53. Mukhortava, A., et al. Structural heterogeneity of attC integron recombination sites revealed by optical tweezers. Nucleic Acids Research. 47 (4), 1861-1870 (2019).
  54. Buck, S., Pekarek, L., Caliskan, N. POTATO: An automated pipeline for batch analysis of optical tweezers data. bioRxiv. , (2021).
  55. Zhang, Y., Jiao, J., Rebane, A. A. Hidden Markov modeling with detailed balance and its application to single protein folding. Biophysical Journal. 111 (10), 2110-2124 (2016).
  56. Sgouralis, I., Pressé, S. An introduction to infinite HMMs for single-molecule data analysis. Biophysics Journal. 112 (10), 2021-2029 (2017).
  57. Müllner, F. E., Syed, S., Selvin, P. R., Sigworth, F. J. Improved hidden Markov models for molecular motors, part 1: basic theory. Biophysical Journal. 99 (11), 3684-3695 (2010).
  58. Elms, P. J., Chodera, J. D., Bustamante, C. J., Marqusee, S. Limitations of constant-force-feedback experiments. Biophysical Journal. 103 (7), 1490-1499 (2012).
  59. Re, A., Joshi, T., Kulberkyte, E., Morris, Q., Workman, C. T. RNA-protein interactions: an overview. Methods Molecular Biology. 1097, 491-521 (2014).
  60. Jankowsky, E., Harris, M. E. Specificity and nonspecificity in RNA-protein interactions. Nature reviews. Molecular Cell Biology. 16 (9), 533-544 (2015).
  61. Lim, F., Peabody, D. S. RNA recognition site of PP7 coat protein. Nucleic Acids Research. 30 (19), 4138-4144 (2002).
  62. Sunbul, M., Jäschke, A. SRB-2: a promiscuous rainbow aptamer for live-cell RNA imaging. Nucleic Acids Research. 46 (18), 110 (2018).
  63. Sanchez de Groot, N., et al. RNA structure drives interaction with proteins. Nature Communications. 10 (1), 3246 (2019).
  64. Zeffman, A., Hassard, S., Varani, G., Lever, A. The major HIV-1 packaging signal is an extended bulged stem loop whose structure is altered on interaction with the Gag polyprotein. Journal of Molecular Biology. 297 (4), 877-893 (2000).
  65. Mangeol, P., et al. Probing ribosomal protein-RNA interactions with an external force. Proceedings of the National Academy of Sciences. 108 (45), 18272 (2011).
  66. Luo, X., et al. Molecular mechanism of RNA recognition by Zinc-Finger antiviral protein. Cell Reports. 30 (1), 46-52 (2020).
  67. Qu, X., Lancaster, L., Noller, H. F., Bustamante, C., Tinoco, I. Ribosomal protein S1 unwinds double-stranded RNA in multiple steps. Proceedings of the National Academy of Science U. S. A. 109 (36), 14458-14463 (2012).
  68. Chandra, V., Hannan, Z., Xu, H., Mandal, M. Single-molecule analysis reveals multi-state folding of a guanine riboswitch. Nature Chemical Biology. 13 (2), 194-201 (2017).
  69. Savinov, A., Perez, C. F., Block, S. M. Single-molecule studies of riboswitch folding. Biochimica et Biophysica Acta. 1839 (10), 1030-1045 (2014).
  70. Kelly, J. A., et al. Structural and functional conservation of the programmed ribosomal frameshift signal of SARS coronavirus 2 (SARS-CoV-2). Journal of Biological Chemistry. 295 (31), 10741-10748 (2020).
  71. Neupane, K., et al. Structural dynamics of single SARS-CoV-2 pseudoknot molecules reveal topologically distinct conformers. Nature Communications. 12 (1), 4749 (2021).
  72. Schindelin, J., et al. Fiji: an open-source platform for biological-image analysis. Nature Methods. 9 (7), 676-682 (2012).
  73. Zheng, Q., Jockusch, S., Zhou, Z., Blanchard, S. C. The contribution of reactive oxygen species to the photobleaching of organic fluorophores. Photochemistry and Photobiology. 90 (2), 448-454 (2014).
  74. Deerinck, T. J. The application of fluorescent quantum dots to confocal, multiphoton, and electron microscopic imaging. Toxicologic Pathology. 36 (1), 112-116 (2008).
  75. Rill, N., Mukhortava, A., Lorenz, S., Tessmer, I. Alkyltransferase-like protein clusters scan DNA rapidly over long distances and recruit NER to alkyl-DNA lesions. Proceedings of the National Academy of Science U. S. A. 117 (17), 9318-9328 (2020).
  76. Swoboda, M., et al. Enzymatic oxygen scavenging for photostability without pH drop in single-molecule experiments. ACS Nano. 6 (7), 6364-6369 (2012).
  77. Aitken, C. E., Marshall, R. A., Puglisi, J. D. An oxygen scavenging system for improvement of dye stability in single-molecule fluorescence experiments. Biophysical Journal. 94 (5), 1826-1835 (2008).
  78. Wen, J. -. D., et al. Force unfolding kinetics of RNA using optical tweezers. I. Effects of experimental variables on measured results. Biophysical journal. 92 (9), 2996-3009 (2007).

Tags

Optical TweezersRNA-protein InteractionsTranslation RegulationSingle Molecule TechniquesFluorescence Assisted Optical TweezersForce-ramp ExperimentsConstant Force MeasurementsReal-time VisualizationDNA-RNA ConstructIn-vitro TranscriptionPCR Reactions

Play Video
PDF
DOI
DOWNLOAD MATERIALS LIST
Cite This Article
Pekarek, L., Buck, S., Caliskan, N. Optical Tweezers to Study RNA-Protein Interactions in Translation Regulation. J. Vis. Exp. (180), e62589, doi:10.3791/62589 (2022).
Download Citation
Reprints and Permissions

View Video

✖

To prove you're not a robot, please enter the text in the image below

CAPTCHA Image
Play CAPTCHA Audio
Refresh Image