저비용 양이온성 고분자 폴리에틸렌이민(PEI)을 사용하여 hESC 및 NPC에 대한 shRNA의 렌티바이러스 매개 전달
Summary
저가의 양이온성 고분자 폴리에틸렌이민(PEI)을 사용하여 H9 인간 배아줄기세포(hESCs)에서 shRNA의 안정적인 발현을 위한 렌티바이러스 입자를 생산하고 H9 유래 신경전구세포(NPC)를 고효율로 일시적으로 형질도입했습니다.
Abstract
현재의 프로토콜은 인간 배아 줄기 세포 (hESCs)뿐만 아니라 hESCs로부터 유래 된 신경 전구 세포 (NPCs) 모두에 짧은 헤어핀 RNA (shRNAs)를 고효율로 전달하기위한 렌티바이러스 입자의 사용을 기술한다. 렌티바이러스 입자는 저가의 양이온성 폴리머 폴리에틸렌이민(PEI)을 사용하여 패키징 플라스미드(pAX 및 pMD2.G)와 함께 진입 벡터(운반 shRNAs)를 사용하여 HEK293T 세포를 공동형질감염시킴으로써 생성되었다. 바이러스 입자는 초원심분리를 사용하여 농축되었고, 이는 5 x 107 이상의 평균 역가를 초래하였다. hESCs 및 NPCs 둘 다 퓨로마이신 선택 및 hESC에서의 안정한 발현뿐만 아니라 NPC에서의 일시적인 GFP 발현에 의해 나타난 바와 같이, 이러한 렌티바이러스 입자를 사용하여 높은 효율로 감염될 수 있었다. 더욱이, 웨스턴 블롯 분석은 shRNAs에 의해 표적화된 유전자의 발현에서 유의한 감소를 보여주었다. 또한, 세포는 CNS의 다른 계보로의 후속 분화에 의해 입증 된 바와 같이 분화 잠재력뿐만 아니라 다능성을 유지했습니다. 현재 프로토콜은 shRNA의 전달을 다룬다; 그러나, 과발현 연구를 위해 cDNA의 자궁외 발현에 대해 동일한 접근법이 사용될 수 있다.
Introduction
배반포 내부 세포괴로부터 유래된 인간 배아줄기세포(hESCs)는 다능성이며, 시험관내 조건 1,2 하에서 외부 인자에 따라 상이한 세포 유형으로 분화될 수 있다. hESC의 잠재력을 완전히 활용하기 위해서는 이러한 세포에 대한 신속하고 신뢰할 수있는 유전자 전달 방법이 필수적입니다. 종래, 사용된 기술은 크게 두 가지 유형으로 분류될 수 있다: 비바이러스성 및 바이러스 유전자 전달 시스템(3,4). 더 자주 사용되는 비바이러스 유전자 전달 시스템은 리포펙션, 전기천공 및 핵형성이다. 비바이러스 전달 시스템은 더 적은 삽입 돌연변이 및 면역원성의 전반적인 감소 5,6 때문에 유리하다. 그러나, 이들 방법은 낮은 형질감염 효율 및 짧은 일시적 유전자 발현의 기간을 초래하며, 이는 장기 분화 연구7에 대한 주요한 한계이다. 전기천공은 리포펙션에 비해 더 나은 형질감염 효율을 초래한다; 그러나, 50% 이상의 세포 사멸 8,9,10을 초래한다. 핵을 사용하여, 세포 생존 및 형질감염 효율은 리포펙션과 전기천공을 결합함으로써 개선될 수 있지만, 접근법은 세포-특이적 완충액 및 특수 장비를 필요로 하며, 따라서, 스케일업 응용(11,12)을 위해 상당히 비용이 많이 든다.
대조적으로, 바이러스 벡터는 형질도입 후 개선된 형질감염 효율뿐만 아니라 전반적으로 낮은 세포독성을 나타냈다. 또한, 전달된 유전자는 안정적으로 발현되고, 따라서, 이 방법은 장기 연구13에 이상적이다. hESCs로의 유전자 전달을 위해 가장 일반적으로 사용되는 바이러스 벡터 중에는 높은 역가 바이러스 입자14,15를 사용하여 80% 이상의 형질도입 효율을 제공할 수 있는 렌티바이러스 벡터(LVS)가 있다. 리포펙션 및CaPO4 침전은 렌티바이러스 입자(16)를 수득하기 위해 패키징 플라스미드와 함께 HEK293T 세포 또는 그의 유도체를 유전자 전달 벡터로 일시적으로 형질감염시키는 데 가장 일반적으로 사용되는 방법 중 하나이다. 지방 감염은 좋은 형질감염 효율과 낮은 세포 독성을 초래하지만,이 기술은 비용에 의해 방해 받고 높은 역가 렌티 바이러스 입자를 얻기 위해 확장하는 것은 매우 비쌉니다. CaPO4 침전은 리포펙션을 사용하여 수득된 것과 비교적 유사한 형질감염 효율을 초래한다. 비용 효율적이지만, CaPO4 침전은 형질감염 후 상당한 세포 사멸을 초래하며, 이는 표준화를 어렵게 하고 배치-배치-배치 변이(batch-to-batch) 변이를 피한다(17). 이 시나리오에서, 높은 형질감염 효율, 낮은 세포독성 및 비용 효율성을 제공하는 방법을 개발하는 것은 hESCs에 사용되는 높은 역가 렌티바이러스 입자의 생산을 위해 매우 중요하다.
폴리에틸렌이민(PEI)은 HEK293T 세포를 많은 세포독성 없이 고효율로 형질감염시킬 수 있는 양이온성 고분자이며, 리포펙션 기반 방법(18)에 비해 무시할 수 있는 비용을 갖는다. 이러한 상황에서, PEI는 다양한 기술을 사용하는 배양 상청액으로부터의 렌티바이러스 입자의 농도를 통한 고역가 LVS 생산의 스케일업 응용에 사용될 수 있다. 제시된 기사는 슈크로스 쿠션을 통한 초원심분리를 사용하여 HEK293T 세포 및 렌티바이러스 벡터 농도를 형질감염시키기 위한 PEI의 사용을 기술한다. 이 방법을 사용하여, 우리는 정기적으로 낮은 배치 대 배치 변화로 5 x 107 IU / mL 이상의 역가를 얻습니다. 이 방법은 hESC 및 hESC 유래 세포로의 유전자 전달을 위한 확장 적용에 간단하고 간단하며 비용 효율적입니다.
Protocol
Representative Results
Discussion
연구 또는 임상 목적을 위해 줄기 세포를 유 전적으로 변형시키는 능력은 hESC의 생물학에 대한 기술과 기본적인 이해에 의해 제한됩니다. 리포펙션 및 전기천공과 같은 마우스 ESC에서 상당한 잠재력을 보인 기술은 hESC에 대해 매우 효율적이지 않으며, 이는 통상적인 방법(20)에 의한 유전자 전달에 대해 악명 높게 어렵다. 이 개념은 기존 기술의 최적화뿐만 아니라 hESC에서 형질감…
Declarações
The authors have nothing to disclose.
Acknowledgements
이 연구는 아랍 에미리트 대학 (UAEU), 보조금 # 31R170 (건강 과학을위한 Zayed 센터) 및 # 12R010 (UAEU-AUA 보조금)의 연구 보조금에 의해 지원되었습니다. 우리는 Randall Morse 교수 (Wadsworth Center, Albany, NY)가 스타일과 문법을 위해 원고를 편집 할 수 있도록 도와 주신 것에 감사드립니다.
모든 데이터는 요청시 사용할 수 있습니다.
Materials
| 2-Mercaptoethanol | Invitrogen | 31350010 | |
| 38.5 mL, Sterile + Certified Free Open-Top Thinwall Ultra-Clear Tubes | Beckman Coulter | C14292 | |
| Accutase | Stem Cell Technologies | 7920 | |
| bFGF Recombinant human | Invitrogen | PHG0261 | |
| Bovine serum albumin FRAC V | Invitrogen | 15260037 | |
| Corning Matrigel Basement Membrane Matrix, LDEV-free | Corning | 354234 | |
| Cyclopamine | Stem Cell Technologies | 72074 | |
| DMEM media | Invitrogen | 11995073 | |
| DMEM Nutrient mix F12 | Invitrogen | 11320033 | |
| DPBS w/o: Ca and Mg | PAN Biotech | P04-36500 | |
| Fetal bovie serum | Invitrogen | 10270106 | |
| GAPDH (14C10) Rabbit mAb Antibody | CST | 2118S | |
| Gentle Cell Dissociation Reagent | Stem Cell Technologies | 7174 | |
| HyClone Non Essential Amino Acids (NEAA) 100X Solution | GE healthcare | SH30238.01 | |
| L Glutamine, 100X | Invitrogen | 2924190090 | |
| L2HGDH Polyclonal antibody | Proteintech | 15707-1-AP | |
| L2HGDH shRNA | Macrogen | Seq: CGCATTCTTCATGTGAGAAAT | |
| Lipofectamine 3000 kit | Thermo Fisher | L3000001 | |
| mTesR1 complete media | Stem Cell Technologies | 85850 | |
| Neurobasal medium 1X CTS | Invitrogen | A1371201 | |
| Neuropan 2 Supplement 100x | PAN Biotech | P07-11050 | |
| Neuropan 27 Supplement 50x | PAN Biotech | P07-07200 | |
| Penicillin streptomycin SOL | Invitrogen | 15140122 | |
| pLKO.1 TRC vector | Addgene | 10878 | |
| pLL3.7 vector | Addgene | 11795 | |
| pMD2.G | Addgene | 12259 | |
| Polybrene infection reagent | Sigma | TR1003- G | |
| Polyethylenimine, branched | Sigma | 408727 | |
| psPAX2.0 | Addgene | 12260 | |
| Purmorphamine | Tocris | 4551/10 | |
| Puromycin | Invitrogen | A1113802 | |
| ROCK inhibitor Y-27632 dihydrochloride |
Tocris | 1254 | |
| SB 431542 | Tocris | 1614/10 | |
| Trypsin .05% EDTA | Invitrogen | 25300062 | |
| XAV 939 | Tocris | 3748/10 |
Referências
- Thomson, J. A., et al. Embryonic stem cell lines derived from human blastocysts. Science. 282 (5391), 1145-1147 (1998).
- Reubinoff, B. E., Pera, M. F., Fong, C. Y., Trounson, A., Bongso, A. Embryonic stem cell lines from human blastocysts: Somatic differentiation in vitro. Nature Biotechnology. 18 (4), 399-404 (2000).
- Strulovici, Y., Leopold, P. L., O’Connor, T. P., Pergolizzi, R. G., Crystal, R. G. Human embryonic stem cells and gene therapy. Molecular Therapy. 15 (5), 850-866 (2007).
- Kane, N., McRae, S., Denning, C., Baker, A. Viral and nonviral gene delivery and its role in pluripotent stem cell engineering. Drug Discovery Today. Technologies. 5 (4), 105 (2008).
- Li, S. D., Huang, L. Nonviral is superior to viral gene delivery. Journal of Controlled Release. 123 (3), 181-183 (2007).
- Mastrobattista, E., Bravo, S. A., vander Aa, M., Crommelin, D. J. Nonviral gene delivery systems: From simple transfection agents to artificial viruses. Drug Discovery Today. Technologies. 2 (1), 103-109 (2005).
- Cao, F., et al. Comparison of gene-transfer efficiency in human embryonic stem cells. Molecular Imaging and Biology. 12 (1), 15-24 (2010).
- Mohr, J. C., de Pablo, J. J., Palecek, S. P. Electroporation of human embryonic stem cells: Small and macromolecule loading and DNA transfection. Biotechnology Progress. 22 (3), 825-834 (2006).
- Sukhorukov, V. L., et al. Surviving high-intensity field pulses: Strategies for improving robustness and performance of electrotransfection and electrofusion. The Journal of Membrane Biology. 206 (3), 187-201 (2005).
- Floch, V., et al. Cationic phosphonolipids as non viral vectors for DNA transfection in hematopoietic cell lines and CD34+ cells. Blood Cells, Molecules and Diseases. 23 (1), 69-87 (1997).
- Lakshmipathy, U., et al. Efficient transfection of embryonic and adult stem cells. Stem Cells. 22 (4), 531-543 (2004).
- Siemen, H., et al. Nucleofection of human embryonic stem cells. Stem Cells and Development. 14 (4), 378-383 (2005).
- Zhang, X., Godbey, W. T. Viral vectors for gene delivery in tissue engineering. Advanced Drug Delivery Reviews. 58 (4), 515-534 (2006).
- Ma, Y., Ramezani, A., Lewis, R., Hawley, R. G., Thomson, J. A. High-level sustained transgene expression in human embryonic stem cells using lentiviral vectors. Stem Cells. 21 (1), 111-117 (2003).
- Gropp, M., et al. Stable genetic modification of human embryonic stem cells by lentiviral vectors. Molecular Therapy. 7 (2), 281-287 (2003).
- Tan, E., Chin, C. S. H., Lim, Z. F. S., Ng, S. K. HEK293 cell line as a platform to produce recombinant proteins and viral vectors. Frontiers in Bioengineering and Biotechnology. 9, 796991 (2021).
- Merten, O. W., Hebben, M., Bovolenta, C. Production of lentiviral vectors. Molecular Therapy: Methods & Clinical Development. 3, 16017 (2016).
- Lungwitz, U., Breunig, M., Blunk, T., Göpferich, A. Polyethylenimine-based nonviral gene delivery systems. European Journal of Pharmaceutics and Biopharmaceutics. 60 (2), 247-266 (2005).
- Parween, S., et al. Higher O-GlcNAc levels are associated with defects in progenitor proliferation and premature neuronal differentiation during in-vitro human embryonic cortical neurogenesis. Frontiers in Cellular Neuroscience. 11, 415 (2017).
- Weissinger, F., et al. Gene transfer in purified human hematopoietic peripheral-blood stem cells by means of electroporation without prestimulation. Journal of Laboratory and Clinical Medicine. 141 (2), 138-149 (2003).
- Cui, Y., et al. Targeting transgene expression to antigen-presenting cells derived from lentivirus-transduced engrafting human hematopoietic stem/progenitor cells. Blood. 99 (2), 399-408 (2002).
- Yu, X., et al. Lentiviral vectors with two independent internal promoters transfer high-level expression of multiple transgenes to human hematopoietic stem-progenitor cells. Molecular Therapy. 7 (6), 827-838 (2003).
- Sweeney, N. P., Vink, C. A. The impact of lentiviral vector genome size and producer cell genomic to gag-pol mRNA ratios on packaging efficiency and titre. Molecular Therapy – Methods & Clinical Development. 21, 574-584 (2021).
