쥐 장에서 T4 박테리오파지와 대장균 상호작용: 생체 내 숙주-박테리오파지 역학 연구를 위한 프로토타입 모델
Summary
박테리아를 감염시키는 바이러스인 박테리오파지(파지)는 장내 마이크로바이옴의 필수 구성 요소입니다. 이러한 공생 생물이 박테리아 적합성과 개체군 역학을 주도하지만 장내 항상성과 질병에 미치는 영향에 대해서는 거의 알려져 있지 않습니다. 이 프로토콜은 마우스 모델 내에서 분리된 T4 파지를 연구하며, 다른 파지-박테리아 쌍에 적응할 수 있습니다.
Abstract
박테리오파지(파지)는 종 및 균주 수준의 특이성을 가진 박테리아를 감염시키는 바이러스이며 알려진 모든 생태계에서 가장 풍부한 생물학적 개체입니다. 장내 미생물군에서 발견되는 것과 같은 박테리아 군집 내에서 파지는 미생물군 개체군 역학을 조절하고 박테리아 진화를 주도하는 데 관여합니다. 지난 10년 동안 파지 연구에 대한 관심이 다시 높아졌는데, 이는 부분적으로 항생제 내성 박테리아의 증가하는 위협에 대응할 수 있는 유망한 도구를 제공하는 용해 파지의 숙주 특이적 살상 능력 때문입니다. 또한, 파지가 장 점액에 달라붙는다는 것을 입증한 최근 연구는 파지가 박테리아가 하부 상피로 침입하는 것을 방지하는 보호 역할을 할 수 있음을 시사합니다. 중요한 것은 박테리아 마이크로바이옴과 마찬가지로 파괴된 파지오메는 염증성 장 질환과 같은 질병의 악화된 결과와 관련이 있다는 것입니다. 이전 연구에서는 파지가 분변 여과액 이식을 통해 동물과 인간의 마이크로바이옴을 조절하여 숙주의 건강에 도움이 될 수 있음을 입증했습니다. 이러한 최근의 연구의 물결로 인해 장내 마이크로바이옴의 맥락에서 파지를 연구하기 위한 프로토콜을 수립하고 표준화해야 할 필요성이 대두되고 있습니다. 이 프로토콜은 쥐 위장관의 맥락에서 분리된 T4 파지와 박테리아 숙주인 대장균을 연구하기 위한 일련의 절차를 제공합니다. 여기에 설명된 방법은 파지 용해물에서 시작하여 마우스에 투여하고 박테리아 숙주 및 파지 수준에 대한 영향을 평가하는 방법을 간략하게 설명합니다. 이 프로토콜은 변형되어 다른 파지-박테리아 쌍에 적용될 수 있으며 생체 내에서 숙주-파지 역학을 연구하기 위한 출발점을 제공합니다.
Introduction
박테리오파지(Bacteriophage) 또는 파지(phage)는 종 및 균주 수준 특이성을 가진 박테리아를 감염시키고 죽이는 바이러스입니다1. 파지는 장내 미생물군(gut microbiota)과 같은 복잡한 박테리아 군집 내에서 중요한 역할을 하며, 개체군 역학을 조절하고 박테리아 적합성을 촉진하는 데 관여한다2. 지난 10년 동안 항생제 내성 병원체3의 증가와 대체 치료 전략으로서의 파지 요법의 잠재력으로 인해 파지 연구에 대한 관심이 다시 높아졌습니다. 최근 몇 년 동안 용해 파지 칵테일은 인간의 심각한 항생제 내성 세균 패혈증 감염에 어느 정도 성공을 거두면서 정맥 주사로 사용되었습니다 3,4. 경구 파지 요법은 또한 장 감염 및 염증을 치료하기 위한 항생제의 잠재적인 대안으로 제안되었습니다. 또한, 파지는 박테리아를 제거하기 위해 여과된 분변 미생물군 제제인 분변 여과물 이식(FFT)의 성공과 관련이 있으며, 재발성 클로스트리디오이데스 디피실 감염(rCDI)5,6, 염증성 장 질환(IBD)7,8 및 조산 돼지의 괴사성 장염 치료에 사용되었다9. 이러한 결과를 감안할 때, 기존 군집에 새로운 파지를 추가하면 표적 박테리아 2,10뿐만 아니라 군집 전체에 간접적인 영향을 미칠 수 있으므로 파지와 장내 미생물군, 파지와 포유류 숙주 사이의 상호 작용을 고려하는 것이 중요합니다.
체외에서 표적 박테리아와 파지 상호 작용에 대한 연구는 장에서 파지와 박테리아 상호 작용의 메커니즘과 영향을 이해하는 데 유용한 것으로 입증되었습니다. 이러한 설정에서, Caudovirales 목의 대장균 특이적 T4 파지는 장 점액에 부착하기 위해 비리온 표면의 항원성이 높은 외부 캡시드(Hoc) 단백질 내에 위치한 면역글로불린(Ig) 유사 도메인을 필요로 하는 것으로 나타났다11. 또한, 트랜스웰 분석은 T4 파지가 상피세포 배양과 상호 작용하고 마크로피노사이토시스(macropinocytosis)에 의해 세포층을 통해 전위될 수 있음을 보여주었습니다12,13. 이러한 결과는 파지가 진핵 세포를 감염시킬 수 없더라도 중생대 숙주와 상호 작용할 수 있다는 가설을 뒷받침합니다. 이러한 모델은 유용하기는 하지만, 파지, 박테리아 및 중생대 숙주 간의 삼자 상호 작용을 포괄적으로 탐구하는 데 필요한 장 생태계에서 발생하는 복잡한 상호 작용의 전체 범위가 부족합니다.
마우스 모델은 복잡한 환경 내에서 파지를 조사하는 데 중요한 도구입니다. 파지 투여의 바람직한 적용은 IBD를 포함한 만성 염증성 질환과 관련된 항생제 내성 감염 또는 병원체를 치료하기 위한 대체 전략입니다. 그러나 새로운 문헌에 따르면 체외에서의 파지 거동은 생체 내 기능을 완전히 나타내지 않습니다. Buttimer et al.14는 파지 칵테일이 단순화된 인간 미생물군 컨소시엄에서 표적 박테리아를 고갈시킬 수 있었지만 동일한 박테리아-파지 컨소시엄으로 식민지화된 gnotobiotic 마우스에서는 생체 내에서 복제할 수 없음을 입증했습니다. 또한, 기존의 마우스 마이크로바이옴에서 T7 파지는 표적 장내 세균의 선택적 고갈을 유도했지만, 시간이 지남에 따라 점진적인 회복이 관찰되어 내성이 진화했음을 나타냅니다15. 다른 연구에서는 생체 내경구 투여 파지와 표적 박테리아 균주의 공존을 입증했습니다 2,16. 실제로, 파지/박테리아 공존을 넘어서, 파지 투여는 전반적인 미생물군 군집 구성과 기능에 광범위한 변화를 가져왔다 2,16. 이는 여러 연구에서 Caudovirales의 상대적 풍부도 증가와 IBD 7,8,17 사이의 연관성을 발견했으며, 이는 박테리아 풍부도의 변화와 무관하게 발견되었기 때문에 질병 환경과 관련이 있다 7. 이것이 질병 발병의 원인인지 결과인지는 아직 밝혀지지 않았습니다.
파지 연구의 역사적 초점은 파지와 표적 박테리아 간의 관계에 관한 것이었습니다. 그러나 파지와 중생대 숙주의 점막, 상피 및 면역 체계 사이의 잠재적인 상호 작용을 고려하는 것도 중요합니다. 이러한 상호 작용은 모두 장 파지 감염에 대한 전반적인 반응에 중요한 역할을 합니다. 이를 입증하기 위해 파지는 무균(GF) 마우스를 사용하여 미생물총(microbiota)의 간섭 없이 면역 체계에 미치는 영향을 규명하기 위해 연구되었다8. 이 시스템에서, 파지 핵산은 식세포 면역세포(대식세포 및 수지상세포)의 엔도솜 내에 위치한 톨 유사 수용체(TLR)에 의해 검출되었습니다. 이는 다운스트림 신호전달을 활성화하고 인터페론(IFN)-γ8 또는 유형 I IFN의 T 세포 의존성 생성을 자극했다18. 더욱이, Fluckiger et al.19는 기억 CD8+ T 세포가 파지로 인코딩된(프로파지) 항원을 인식하는 데 관여하며, 이로 인해 T 세포가 종양 항원과 교차 반응하여 종양 부담을 감소시켰습니다. 마지막으로, 파지 특이적 항체 생산은 식수 8,20 또는 수개월에 걸쳐 반복적인 경구 개비지(20)를 통해 파지를 동물 모델에 지속적으로 전달한 마우스 연구에서 문서화되었으며, 이는 체액성 면역 반응을 촉진하는 파지 단백질의 능력을 입증했습니다. 이러한 파지 접종 방식은 면역 체계의 최적이고 지속적인 프라이밍을 허용하지만, 파지와 장내 환경 사이에서 자연적으로 발생하는 상호 작용이나 경구 적용 파지 요법의 역학을 나타내지 않을 수 있습니다. 지금까지, 제한된 수의 연구들이 단일군락화된 마우스 모델에서 단일 박테리아 종과 파지의 상호작용을 조사하였다21. 그러나, 단일군락화된 마우스는 위장관(GI) 및 면역 발달에 대한 개별 종의 미생물 특이적 효과를 해독하는 데 중요한 것으로 입증되었으며, 파지, 표적 박테리아 및 중생대 숙주 사이의 삼자 상호작용을 이해하는 데 유용할 수 있습니다.
흥미롭게도, 장내 파지와 장내 공생 박테리아 사이의 상호 작용뿐만 아니라 중생대 숙주와 그 안에 있는 파지 사이에서 발생하는 상호 작용에 대해 아직 배워야 할 것이 많습니다. 이 프로토콜은 gnotobiotic 마우스 모델을 사용하여 분리된 T4 파지와 박테리아 대응물인 E. coli (K-12, BW25113)를 연구하기 위한 일련의 절차를 제공합니다. 이러한 표준화된 절차는 또한 성장 파라미터를 관심 쌍에 맞게 조정하여 다른 파지/박테리아 다이아드를 최적화하기 위한 기반을 제공합니다. 여기에 기술된 방법들은 개략적으로 설명된다: (1) 마우스의 구강 위축을 위한 T4 파지 및 차량 용해물의 준비; (2) 대장균 단일집락화 gnotobiotic 마우스에 대한 T4 파지의 경구 투여; (3) 시간 경과에 따른 쥐의 대변 및 조직의 T4 파지 수준 모니터링.
여기에 제시된 대표적인 결과를 위해, 정제된 T4 파지 용해물은 Rohwer Lab에 의해 유지되는 파지 뱅크 스톡으로부터 전파되었다. T4 파지를 증식하기 위한 파지-온-탭(Phage-on-Tap) 방법은 이 프로토콜에서 참조된 바와 같이25에 적응되었다. 이 방법은 3일 이내에 높은 역가, 내독소가 적은 파지 스톡을 생성합니다. 이 접근법을 이용하여, 10 mL의 ≥10 10 플라크 형성 단위(pfu)/mL의 T4 파지와 < 0.5 내독소 단위(EU)/mL를 일상적으로 수집하였다. 마우스에 대한 경구 또는 정맥 투여에 대한 권장 내독소 수치는 각각 ≤ 20EU/mL 및 ≤ 5EU/kg/h(또는 20g 마우스의 경우 1시간 동안 0.1EU 투여)이며, 이는 생체 내 접종을 위한 파지 제제에 적합한 방법입니다. 모든 파지 스톡은 식염수 마그네슘(SM) 파지 완충액에 4°C에서 보관하였다(1.1.5.1단계에서 제공된 레시피). 대장균은 LB 배지에서 배양되었습니다. 다양한 파지-박테리아 쌍에 대해, 다양한 배양 배지 및 성장 조건이 이 프로토콜로부터 적응될 수 있다. 파지는 또한 폐수, 해수, 토양 및 장 내용물과 같은 환경으로부터 공급될 수 있으며, 관심 있는 각 파지-숙주 쌍(25)에 대한 적절한 성장 및 증식 조건을 사용하여 제조 전에 Sambrook 및 Russell26에 따라 분리 및 정제할 수 있다. 대안적으로, 파지는 상업적 공급원(재료 표 참조) 또는 파지 은행에서 얻을 수 있습니다.
Protocol
Representative Results
Discussion
마이크로바이옴의 파지 연구는 박테리아 파지에 비해 상당한 도전 과제를 제시합니다. 특히, 파지는 원핵생물 및 진핵생물 종의 시퀀싱 및 식별을 용이하게 하는 16S 및 18S 리보솜 소단위체와 유사한 모든 파지에 공통적인 보존된 계통발생학적 마커를 각각 포함하지 않는다(42). 그러나 판독 길이, 처리량 증가 및 비용 절감을 포함한 차세대 염기서열 분석 접근법의 발전으로 박테…
Declarações
The authors have nothing to disclose.
Acknowledgements
저자들은 이 연구를 수행한 땅이 xwməθkwəy̓əm(Musqueam) 국가의 전통적이고 조상적이며 미개척된 영토임을 인정합니다. 그것이 위치한 땅은 수천 년 동안 이 사이트에서 한 세대에서 다음 세대로 문화, 역사 및 전통을 전해 온 Musqueam 사람들에게 항상 배움의 장소였습니다. 우리는 다른 사람들이 https://native-land.ca 에서 살고 일하는 고향에 대해 더 많이 배우도록 권장합니다. 저자는 캐나다 자연 과학 및 공학 위원회(NSERC) 캐나다 대학원 장학금 – 석사(NP), Michael Smith Health Research BC 연수생 상(RT-2023-3174, MH), 캐나다 자연 과학 및 공학 연구 위원회(NSERC) 디스커버리 보조금 프로그램(RGPIN-2019-04591 to C.T., RGPIN-2016-04282 to LCO), Canadian Institute for Advanced Research/Humans and the Microbiome(FL-001253 Appt 3362, C.T.), Michael Smith Foundation for Health Research Scholar Award(18239, C.T.), Canadian Institutes for Health Research(PJT-159458 to LCO) 및 Canadian Foundation for Innovation(34673 to LCO 및 38277 to CT)을 수상했습니다. UBC GREx Biological Resilience Initiative의 지원을 받는 UBC Center for Disease Modelling 및 ubcFLOW의 기술 지원과 원고에 대한 비판적 토론과 평가를 위해 Osborne 및 Tropini 연구소 구성원에게 감사드립니다. 그림 1A 와 그림 2A 는 Biorender.com 를 사용하여 생성되었습니다.
Materials
| 1-octanol (99%) | Thermofisher | CAAAA15977-AP | |
| 50 ml PES Steriflip Sterile Disposable Vacuum Filter Units | Millipore Sigma | SCGP00525 | |
| Agarose (Low-EEO/Multi-Purpose/Molecular Biology Grade) | Fisher BioReagents | BP160-500 | |
| Amicon® 100kDa Ultra-15 centrifugal filter device, Ultracel-100 | Millipore Sigma | UFC910008 | |
| BD Microtainer® Tubes, SST | BD Medical | 365967 | |
| Bioexclusion airtight cages (ISO cages) | Techiplast | 1245ISOCAGE | |
| C1000 Touch™ Thermal Cycler with 96-Well Fast Reaction Module | BioRad | 1851196 | |
| Calcium Chloride Dihydrate (White Crystals to Powder) | Fisher BioReagents | BP510-500 | |
| Cap Locks For 1.5ML Tube 100/pk | Andwin Scientific | 16812612 | |
| Chloroform (Ethanol as Preservative/Certified ACS) | Fisher | C298-500 | |
| Copper coated steel beads (4.5 mm) | Crosman Corporation | 0767 | |
| DNeasy Blood & Tissue Kit (50) | Thermo Scientific | 69504 | |
| DreamTaq Green PCR Master Mix (2X) | Thermo Scientific | K1081 | |
| Ethylenediaminetetraacetic acid (EDTA) disodium salt solution, for molecular biology, 0.5 M in H2O | Sigma Aldrich | E7889 | |
| Fisher BioReagents™ Agar, Powder / Flakes, Fisher BioReagents™ | Fisher Bioreagents | BP1423-500 | |
| Fisher BioReagents™ Microbiology Media: LB Broth (Powder) – Lennox | Fisher Bioreagents | BP1427-500 | |
| GeneRuler 100 bp DNA Ladder | Thermo Scientific | SM0241 | |
| Green FastMix® qPCR mix, 1250 rxns | QuantaBio | 95072-012 | |
| HEPA filters for isocage lids, AUTOCLAVABLE H14 FILTERS FOR ISO LINE- IRRADIATED | Techiplast | UISOHEPAXTBOX-300 | |
| Magnesium sulfate heptahydrate | Fisher BioReagents | BP213-1 | |
| MaxQ 6000 Incubated Shaker | Thermo Scientific | 8354-30-0009 | |
| Microbiology Media: LB Broth (Powder) – Lennox | Fisher BioReagents | BP1427-500 | |
| Microcentrifuge Tubes with Locking Snap Cap, 2ml | Fisher | 14-666-315 | |
| Parafilm sealing film | Bemis | PM-996 | |
| Phage stocks | Carolina Biological Supply | n/a | |
| PicoLab® Mouse Diet 20 EXT | LabDiet | 5R58 | |
| Pierce™ Chromogenic Endotoxin Quant Kit | Thermo Scientific | A39552S | |
| RNase A (17,500 U) | Qiagen | 19101 | |
| RNase-free DNase Set | Qiagen | 79254 | |
| Sodium Bicarbonate (Fine White Powder) | Fisher Chemical | BP328-500 | |
| Sodium Chloride (Crystalline/Certified ACS) | Fisher Chemical | S271 | |
| Sonicator (probe model CL-18; power source model FB50) | Fisher scentific | n/a | |
| Sterile flexible film isolator | Class Biologically Clean | n/a | |
| SYBR™ Safe DNA Gel Stain | Invitrogen | S33102 | |
| T100 Thermal Cycler | BioRad | 1861096 | |
| T4 phage primer, forward (CCACACATAGCGCGAGTATAA) | IDT | n/a | |
| T4 phage primer, forward (GAAACTCGGTCAGGCTATCAA) | IDT | n/a | |
| TissueLyser II | Qiagen | 85300 | |
| Tris-HCl, 1M Solution, pH 8.0, Molecular Biology Grade, Ultrapure | Thermo Scientific | AAJ22638AE | |
| Water, (DNASE, RNASE free) | Fisher BioReagents | BP2484100 |
Referências
- Rohwer, F., Segall, A. M. A century of phage lessons. Nature. 528 (7580), 46-47 (2015).
- Hsu, B. B., et al. Dynamic modulation of the gut microbiota and metabolome by bacteriophages in a mouse model. Cell Host & Microbe. 25 (6), 803-814.e5 (2019).
- Gordillo Altamirano, F. L., Barr, J. J. Phage Therapy in the postantibiotic era. Clinical Microbiology Reviews. 32 (2), (2019).
- Schooley, R. T., et al. Development and use of personalized bacteriophage-based therapeutic cocktails to treat a patient with a disseminated resistant Acinetobacter baumannii infection. Antimicrobial Agents and Chemotherapy. 61 (10), (2017).
- Ott, S. J., et al. Efficacy of Sterile Fecal Filtrate Transfer for Treating Patients With Clostridium difficile Infection. Gastroenterology. 152 (4), 799-811.e7 (2017).
- Zuo, T., et al. Bacteriophage transfer during faecal microbiota transplantation in Clostridium difficile infection is associated with treatment outcome. Gut. 67 (4), 634-643 (2018).
- Norman, J. M., et al. Disease-specific alterations in the enteric virome in inflammatory bowel disease. Cell. 160 (3), 447-460 (2015).
- Gogokhia, L., et al. Expansion of bacteriophages is linked to aggravated intestinal inflammation and colitis. Cell Host & Microbe. 25 (2), 285-299.e8 (2019).
- Brunse, A., et al. Fecal filtrate transplantation protects against necrotizing enterocolitis. The ISME Journal. 16 (3), 686-694 (2022).
- Duerkop, B. A., Clements, C. V., Rollins, D., Rodrigues, J. L. M., Hooper, L. V. A composite bacteriophage alters colonization by an intestinal commensal bacterium. Proceedings of the National Academy of Sciences of the United States of America. 109 (43), 17621-17626 (2012).
- Barr, J. J., et al. Bacteriophage adhering to mucus provide a non-host-derived immunity. Proceedings of the National Academy of Sciences of the United States of America. 110 (26), 10771-10776 (2013).
- Nguyen, S., et al. Bacteriophage Transcytosis provides a mechanism to cross epithelial cell layers. mBio. 8 (6), (2017).
- Bichet, M. C., et al. Bacteriophage uptake by mammalian cell layers represents a potential sink that may impact phage therapy. iScience. 24 (4), 102287 (2021).
- Buttimer, C., et al. Impact of a phage cocktail targeting Escherichia coli and Enterococcus faecalis as members of a gut bacterial consortium in vitro and in vivo. Frontiers in Microbiology. 13, 936083 (2022).
- Li, Y., et al. Bacteriophages allow selective depletion of gut bacteria to produce a targeted-bacterium-depleted mouse model. Cell Reports Methods. 2 (11), 100324 (2022).
- Reyes, A., Wu, M., McNulty, N. P., Rohwer, F. L., Gordon, J. I. Gnotobiotic mouse model of phage-bacterial host dynamics in the human gut. Proceedings of the National Academy of Sciences of the United States of America. 110 (50), 20236-20241 (2013).
- Federici, S., et al. Targeted suppression of human IBD-associated gut microbiota commensals by phage consortia for treatment of intestinal inflammation. Cell. 185 (16), 2879-2898.e4 (2022).
- Sweere, J. M., et al. Bacteriophage trigger antiviral immunity and prevent clearance of bacterial infection. Science (New York, N.Y.). 363 (6434), (2019).
- Fluckiger, A., et al. Cross-reactivity between tumor MHC class I-restricted antigens and an enterococcal bacteriophage. Science (New York, N.Y.). 369 (6506), 936-942 (2020).
- Majewska, J., et al. Induction of Phage-Specific Antibodies by Two Therapeutic Staphylococcal Bacteriophages Administered per os. Frontiers in Immunology. 10, 2607 (2019).
- Weiss, M., et al. In vivo replication of T4 and T7 bacteriophages in germ-free mice colonized with Escherichia coli. Virology. 393 (1), 16-23 (2009).
- Thomson, C. A., Morgan, S. C., Ohland, C., McCoy, K. D. From germ-free to wild: modulating microbiome complexity to understand mucosal immunology. Mucosal Immunology. 15 (6), 1085-1094 (2022).
- Al-Asmakh, M., Zadjali, F. Use of germ-free animal models in microbiota-related research. Journal of Microbiology and Biotechnology. 25 (10), 1583-1588 (2015).
- Ivanov, I. I., et al. Induction of intestinal Th17 cells by segmented filamentous bacteria. Cell. 139 (3), 485-498 (2009).
- Bonilla, N., et al. Phage on tap-a quick and efficient protocol for the preparation of bacteriophage laboratory stocks. PeerJ. 4, e2261 (2016).
- Sambrook, J., Russell, D. W. . Molecular Cloning: A Laboratory Manual. 1, (2001).
- Kropinski, A. M., Mazzocco, A., Waddell, T. E., Lingohr, E., Johnson, R. P. Enumeration of bacteriophages by double agar overlay plaque assay. Methods in Molecular Biology (Clifton, N.J). 501, 69-76 (2009).
- Manikantha, B., Karthika, R., Murugadas, V., Vishnuvinayagam, S., Rao, B. M. Comparison of the single agar and double agar layer methods for enumeration of bacteriophages. Fishery Technology. 59, 60-63 (2022).
- Sanders, E. R. Aseptic laboratory techniques: plating methods. Journal of Visualized Experiments. 63, e3064 (2012).
- Louten, J. Chapter 7 – Detection and diagnosis of viral infections. Essential Human Virology. , 111-132 (2016).
- Richter, &. #. 3. 2. 1. ;., et al. Adsorption of bacteriophages on polypropylene labware affects the reproducibility of phage research. Scientific Reports. 11 (1), 7387 (2021).
- . Amicon Ultra-15 Centrifugal Filter Devices Available from: https://www.emdmillipore.com/CA/en/product/Amicon-Ultra-15-Centrifugal-Filter-Unit (2018)
- Hecker, W., Witthauer, D., Staerk, A. Validation of dry heat inactivation of bacterial endotoxins. PDA Journal of Pharmaceutical Science and Technology. 48 (4), 197-204 (1994).
- Jakočiūnė, D., Moodley, A. A Rapid bacteriophage DNA extraction method. Methods and Protocols. 1 (3), 27 (2018).
- Zucoloto, A. Z., Yu, I. L., McCoy, K. D., McDonald, B. Generation, maintenance, and monitoring of gnotobiotic mice. STAR Protocols. 2 (2), 100536 (2021).
- Ng, K. M., et al. Single-strain behavior predicts responses to environmental pH and osmolality in the gut microbiota. mBio. 14 (4), e0075323 (2023).
- McCallum, G., Tropini, C. The gut microbiota and its biogeography. Nature Reviews. Microbiology. , (2023).
- Bergstrom, K., Xia, L. The barrier and beyond: Roles of intestinal mucus and mucin-type O-glycosylation in resistance and tolerance defense strategies guiding host-microbe symbiosis. Gut Microbes. 14 (1), 2052699 (2022).
- Askar, M., Ashraf, W., Scammell, B., Bayston, R. Comparison of different human tissue processing methods for maximization of bacterial recovery. European Journal of Clinical Microbiology & Infectious Diseases. 38 (1), 149-155 (2019).
- Redanz, S., Podbielski, A., Warnke, P. Improved microbiological diagnostic due to utilization of a high-throughput homogenizer for routine tissue processing. Diagnostic Microbiology and Infectious Disease. 82 (3), 189-193 (2015).
- Bhinder, G., et al. The Citrobacter rodentium mouse model: studying pathogen and host contributions to infectious colitis. Journal of Visualized Experiments. 72, e50222 (2013).
- Reyes, A., Semenkovich, N. P., Whiteson, K., Rohwer, F., Gordon, J. I. Going viral: next-generation sequencing applied to phage populations in the human gut. Nature Reviews Microbiology. 10 (9), 607-617 (2012).
- Camarillo-Guerrero, L. F., Almeida, A., Rangel-Pineros, G., Finn, R. D., Lawley, T. D. Massive expansion of human gut bacteriophage diversity. Cell. 184 (4), 1098-1109.e9 (2021).
- Reyes, A., et al. Viruses in the faecal microbiota of monozygotic twins and their mothers. Nature. 466 (7304), 334-338 (2010).
- Bach, M. S., et al. Filamentous bacteriophage delays healing of Pseudomonas-infected wounds. Cell Reports. Medicine. 3 (6), 100656 (2022).
- Filyk, H. A., Osborne, L. C. The multibiome: The intestinal ecosystem’s influence on immune homeostasis, health, and disease. EBioMedicine. 13, 46-54 (2016).
- Rohwer, F., Merry, Y., Maughan, H., Hisakawa, N. Heather Life in Our Phage World: A Centennial Field Guide to the Earth’s Most Diverse Inhabitants. Wholon. , (2014).
- Glonti, T., Pirnay, J. P. In Vitro techniques and measurements of phage characteristics that are important for phage therapy success. Viruses. 14 (7), 1490 (2022).
- Fraser, J. S., Yu, Z., Maxwell, K. L., Davidson, A. R. Ig-like domains on bacteriophages: a tale of promiscuity and deceit. Journal of Molecular Biology. 359 (2), 496-507 (2006).
- Li, H., et al. The outer mucus layer hosts a distinct intestinal microbial niche. Nature Communications. 6, 8292 (2015).
- Bergström, A., et al. Nature of bacterial colonization influences transcription of mucin genes in mice during the first week of life. BMC Research Notes. 5, 402 (2012).
- Adams, M. H. . Bacteriophages. , (1959).
- Kutter, E., Sulakvelidze, A. . Bacteriophages: Biology and Applications. , (2004).
- Bao, H., et al. Dysbiosis and intestinal inflammation caused by Salmonella Typhimurium in mice can be alleviated by preadministration of a lytic phage. Microbiological Research. 260, 127020 (2022).
