Voorwaardelijke Genetische transsynaptische Tracing in de embryonale hersenen van muizen
Summary
Capitalizing on a binary genetic strategy we provide a detailed protocol for neural circuit tracing in mice that express complementary transsynaptic tracers after Cre-mediated recombination. Because cell-specific tracer production is genetically encoded, our experimental approach is suitable to study the formation and maturation of neural circuitry during murine embryonic brain development at a single cell resolution.
Abstract
Anatomical path tracing is of pivotal importance to decipher the relationship between brain and behavior. Unraveling the formation of neural circuits during embryonic maturation of the brain however is technically challenging because most transsynaptic tracing methods developed to date depend on stereotaxic tracer injection. To overcome this problem, we developed a binary genetic strategy for conditional genetic transsynaptic tracing in the mouse brain. Towards this end we generated two complementary knock-in mouse strains to selectively express the bidirectional transsynaptic tracer barley lectin (BL) and the retrograde transsynaptic tracer Tetanus Toxin fragment C from the ROSA26 locus after Cre-mediated recombination. Cell-specific tracer production in these mice is genetically encoded and does not depend on mechanical tracer injection. Therefore our experimental approach is suitable to study neural circuit formation in the embryonic murine brain. Furthermore, because tracer transfer across synapses depends on synaptic activity, these mouse strains can be used to analyze the communication between genetically defined neuronal populations during brain development at a single cell resolution. Here we provide a detailed protocol for transsynaptic tracing in mouse embryos using the novel recombinant ROSA26 alleles. We have utilized this experimental technique in order to delineate the neural circuitry underlying maturation of the reproductive axis in the developing female mouse brain.
Introduction
Anatomische pad tracing is een van de meest gebruikte middelen om de relatie tussen hersenen en gedrag 1 ontcijferen. Vooruitgang in de neurale circuit tracing technologieën heeft neurowetenschappers geschonken met de mogelijkheid om neurale circuits sporen van genetisch geïdentificeerd neuron bevolking in muizen 2. Ondanks deze technische vooruitgang blijft een uitdaging om de vorming van neurale circuits ontrafelen vooral tijdens embryonale ontwikkeling. Dit is omdat de meeste van de tracering worden ontwikkeld tijd berusten op stereotaxische injectie van transsynaptische tracers of genetisch gemodificeerde neurotrope virussen (figuur 1) 2,3. Hoewel deze technieken te bereiken ruimtelijke en temporele resolutie van connectiviteit, een aantal inherente beperkingen, zoals technisch uitdagende tracer injecties in de ontwikkeling van de hersenen, de reproduceerbaarheid van de plaats van injectie, potentiële ontsteking op de injectieplaats en de meeste belang-tantly cytotoxiciteit veroorzaakt door neurotrope virussen beperken hun gebruik 4.
Een alternatieve methode is het transsynaptische tracers als transgenen in genetisch gemanipuleerde muizen tot expressie. We hebben recent gewijzigde deze techniek en ontwikkelde een binaire genetische transsynaptische tracing systeem om de neurale circuits van elk genetisch geïdentificeerd neuronale populatie 5 in kaart. Onze experimentele strategie is gebaseerd op twee nieuwe knock-in muizen stammen, die ofwel de bidirectionele merker gerst lectine (BL) 6 of retrograde tracer tetanustoxinefragment C gefuseerd aan GFP (GTT) 7 van de ROSA 26 locus kenbaar na Cre gemedieerde recombinatie. Hier gebruiken we deze muis stammen om selectief te uiten BL en GTT in neuronen die kisspeptin produceren, een neuropeptide dat betrokken is bij het reguleren van de rijping van de reproductieve as 8,9. We tonen aan dat deze techniek geschikt is voor de ontwikkeling en rijping van kiss visualiserenpeptin neurale circuits tijdens de embryonale ontwikkeling van de vrouwelijke hersenen van muizen 5.
Kweekstrategie
De R26-BL-IRES-τlacZ (BIZ) en de R26-GFP-TTC (GTT) tracer lijnen zijn knock-in stammen 5 dat recombinant ROSA26 allelen dragen. De R26-BIZ en R26-GTT allelen transcriptioneel stil door de aanwezigheid van een sterk transcriptie stopsignaal, die wordt geflankeerd door twee loxP plaatsen 5. Expressie van de BIZ en GTT transgen wordt geactiveerd door Cre gemedieerde verwijdering van de transcriptie stopsignaal. De R26-BIZ en R26-GTT allelen kunnen onafhankelijk door simpelweg kruising met een Cre bestuurder lijn worden gebruikt. Voor analyse dieren heterozygoot voor de respectievelijke Cre en R26 allelen kunnen worden gebruikt. Nestgenoten die één Cre of een allel R26, respectievelijk, worden gebruikt als controles. Als alternatief is het ook mogelijk om t genererenriple knock-in dieren die het Cre, R26-BIZ en R26-GTT allelen, maar dit zal een extra kruis nodig.
Protocol
Representative Results
Discussion
Uitdrukken transsynaptische tracers als transgenen naar de neurale circuits van genetisch bepaalde neuronale populatie traceren heeft een aantal voordelen ten opzichte van de stereotactische injectie van tracers of neurotopic virussen. Eerst wordt de tracer geproduceerd als een endogeen eiwit en dus geen immuunrespons opwekken en een selectieve neurale weg kan verschillende dieren met een hoge reproduceerbaarheid geanalyseerd. Ten tweede, aangezien dit een niet-invasieve methode kan worden gebruikt om de circuits tracer…
Disclosures
The authors have nothing to disclose.
Acknowledgements
We thank Michael Candlish for critical comments on the manuscript. This project was supported by the Deutsche Forschungsgemeinschaft grants BO1743/6 and SFB/TRR 152 P11 and Z02 to Ulrich Boehm.
Materials
| Name of Material/ Equipment | Company | Catalog Number | Comments/Description |
| Bisbenzimide (Hoechst 33258 dye) | Sigma | 14530-100MG | |
| Ethanol | Sigma | 32205-1L | |
| Cryo mold (Peel-a-way) | Polyscience Inc. | 18646A-1 | 22mm x 22mm x 20mm |
| DMSO | Sigma | D8418-100ML | |
| Dimethyl Formamide (DMF) | VWR Chemicals | 23470,293 | |
| EGTA | ROTH | 3054.3 | |
| Fluoromount G | Southern Biotech | 0100-01 | |
| Glutaraldehyde | Sigma | G5882-50ML | |
| Hydrogen peroxide | Sigma | 34988-7 | |
| Isopentane (Methyl 2-butane) | Sigma | M32631-2.5L | |
| Kaiser's Glycine gelatin | Merck | 1092420100 | |
| Methanol | Sigma | 494437-1L | |
| MgCl2 | Sigma | M2670-100G | |
| NaCl | ROTH | HN00.2 | |
| NBT | Sigma | 298-83-9 | |
| Nonidet P40 substitute | Fluka | 743.85 | |
| OCT | Leica | 14020108926 | |
| PAP pen | Dako | S2002 | |
| Parafarmaldehyde | Sigma | P6148-1KG | |
| Sodium deoxycholate | Sigma | D6750-25G | |
| Sucrose | Sigma | S7903-1KG | |
| Superfrost slides | Thermo Scientific | FT4981GLPLUS | |
| TSA kit | PerkinElmer | NEL700 | |
| TSA plus kit | PerkinElmer | NEL749A001KT | |
| Tris | ROTH | AE15.2 | |
| Triton-X 100 | ROTH | 3051.2 | |
| Tween 20 | ROTH | 9127.1 | |
| X-gal | ROTH | 2315.1 | |
| Cryostat | Leica | na | |
| Light microscope equipped with DIC imaging | Zeiss | Axioskop2 equipped with Axio Vision software | |
| Fluroscence microscope | Zeiss | Axioskop2 equipped with Axio Vision software | |
| Photoshop | Adobe | PS6 | |
| Goat anti-WGA (recognizes BL) | Vector Laboatories | AS-2024 | |
| Biotinylayted horse anti-goat IgG | Vector Laboatories | BA-9500 | |
| Biotinylated goat anti-rabbit IgG | Vector Laboatories | BA-1000 | |
| Rabbit anti-GFP (recognizes GTT) | Invitrogen | A11122 | |
| Rabbit anti-GnRH | Affinity Bio Reagent | PA1-121 | |
| Dylight488-donkey anti-rabbit IgG | Thermo Scientific | SA5-10038 | |
| SA-Alexa Fluor 546 | Life Technologies | S-11225 | |
| Primers | |||
| BL Fwd (for BIZ genotyping) | Eurofins MWG Operon | ATGAAGATGATGAGCACCAG GGC |
|
| BL Rev (for BIZ genotyping) | Eurofins MWG Operon | AGCCCTCGCCGCAGAACTC | |
| Cre Fwd (for Cre genotyping) | Eurofins MWG Operon | GTCGATGCAACGAGTGATGAG GTTCG |
|
| Cre Rev (for Cre genotyping) | Eurofins MWG Operon | CCAGGCTAAGTGCCTTCTCTAC ACCTGC |
|
| TTC Fwd (for GTT genotyping) | Eurofins MWG Operon | AGCAAGGGCGAGGAGCTGTT | |
| TTC Rev (for GTT genotyping) | Eurofins MWG Operon | GTCTTGTAGTTGCCGTCGTCCT TGAA |
|
| XY Fwd (for gender genotyping) | Eurofins MWG Operon | TGAAGCTTTTGGCTTTGA | |
| XY Rev (for gender genotyping) | Eurofins MWG Operon | CCGCTGCCAAATTCTTTG | |
| ROSA26 Fwd | Eurofins MWG Operon | CGAAGTCGCTCTGAGTTGTTATC | |
| ROSA26 Rev | Eurofins MWG Operon | GCAGATGGAGCGGGAGAAAT | |
| SA Rev | Eurofins MWG Operon | CGAAGTCGCTCTGAGTTGTTATC | |
References
- Vercelli, A., Repici, M., Garbossa, D., Grimaldi, A. Recent techniques for tracing pathways in the central nervous system of developing and adult mammals. Brain. Res. Bull. 51, 11-28 (2000).
- Huang, Z. J., Zeng, H. Genetic approaches to neural circuits in the mouse. Annu. Rev. Neurosci. 36, 183-215 (2013).
- Lanciego, J. L., Wouterlood, F. G. A half century of experimental neuroanatomical tracing. J. Chem. Neuroanat. 42, 157-183 (2011).
- DeFalco, J., et al. Virus-assisted mapping of neural inputs to a feeding center in the hypothalamus. Science. 291, 2608-2613 (2001).
- Kumar, D., et al. Murine arcuate nucleus kisspeptin neurons communicate with GnRH neurons in utero. J. Neurosci. 34, 3756-3766 (2014).
- Horowitz, L. F., Montmayeur, J. P., Echelard, Y., Buck, L. B. A genetic approach to trace neural circuits. Proc. Natl. Acad. Sci. U.S.A. 96, 3194-3199 (1999).
- Maskos, U., Kissa, K., ST Cloment, C., Brulet, P. Retrograde trans-synaptic transfer of green fluorescent protein allows the genetic mapping of neuronal circuits in transgenic mice. Proc. Natl. Acad. Sci. U.S.A. 99, 10120-10125 (2002).
- De Roux, N., et al. Hypogonadotropic hypogonadism due to loss of function of the KiSS1-derived peptide receptor GPR54. Proc. Natl. Acad. Sci. U.S.A. 100, 10972-10976 (2003).
- Seminara, S. B., et al. The GPR54 gene as a regulator of puberty. N. Engl. J. Med. 349, 1614-1627 (2003).
- Mayer, C., et al. Timing and completion of puberty in female mice depend on estrogen receptor alpha-signaling in kisspeptin neurons. Proc. Natl. Acad. Sci. U.S.A. 107, 22693-22698 (2010).
- Soriano, P. Generalized lacZ expression with the ROSA26 Cre reporter strain. Nat. Genet. 21, 70-71 (1999).
- Seibler, J., et al. Single copy shRNA configuration for ubiquitous gene knockdown in mice. Nucleic Acids Res. 33, e67 (2005).
- Semaan, S. J., Kauffman, A. S. Emerging concepts on the epigenetic and transcriptional regulation of the Kiss1 gene. Int. J. Dev. Neurosci. 31, 452-462 (2013).
- Feil, R., et al. Ligand-activated site-specific recombination in mice. Proc. Natl. Acad. Sci. U.S.A. 93, 10887-10890 (1996).
