Condizionale genetica Transsynaptic Tracing nel cervello embrionali di topo
Summary
Capitalizing on a binary genetic strategy we provide a detailed protocol for neural circuit tracing in mice that express complementary transsynaptic tracers after Cre-mediated recombination. Because cell-specific tracer production is genetically encoded, our experimental approach is suitable to study the formation and maturation of neural circuitry during murine embryonic brain development at a single cell resolution.
Abstract
Anatomical path tracing is of pivotal importance to decipher the relationship between brain and behavior. Unraveling the formation of neural circuits during embryonic maturation of the brain however is technically challenging because most transsynaptic tracing methods developed to date depend on stereotaxic tracer injection. To overcome this problem, we developed a binary genetic strategy for conditional genetic transsynaptic tracing in the mouse brain. Towards this end we generated two complementary knock-in mouse strains to selectively express the bidirectional transsynaptic tracer barley lectin (BL) and the retrograde transsynaptic tracer Tetanus Toxin fragment C from the ROSA26 locus after Cre-mediated recombination. Cell-specific tracer production in these mice is genetically encoded and does not depend on mechanical tracer injection. Therefore our experimental approach is suitable to study neural circuit formation in the embryonic murine brain. Furthermore, because tracer transfer across synapses depends on synaptic activity, these mouse strains can be used to analyze the communication between genetically defined neuronal populations during brain development at a single cell resolution. Here we provide a detailed protocol for transsynaptic tracing in mouse embryos using the novel recombinant ROSA26 alleles. We have utilized this experimental technique in order to delineate the neural circuitry underlying maturation of the reproductive axis in the developing female mouse brain.
Introduction
Anatomico percorso tracciato è uno degli strumenti più comunemente utilizzati per decifrare il rapporto tra cervello e comportamento 1. Avanzamento in tecnologie dei circuiti neurali tracciatura ha concesso neuroscienziati con la possibilità di ricostruire i circuiti neurali da popolazioni di neuroni geneticamente identificati nei topi 2. Nonostante questi progressi tecnici rimane difficile da svelare la formazione dei circuiti neurali soprattutto durante la maturazione embrionale. Questo perché la maggior parte dei metodi di tracciamento sviluppati fino ad oggi sono basate su iniezione stereotassica di rivelatori transsynaptic o virus neurotropici geneticamente modificati (Figura 1) 2,3. Mentre queste tecniche raggiungono risoluzione spaziale e temporale della connettività, alcuni limiti intrinseci, come tecnicamente impegnativi iniezioni traccianti nel cervello in via di sviluppo, la riproducibilità del sito di iniezione, potenziale infiammazione al sito di iniezione e più importanza citotossicità causata da virus neurotropici limitare il loro utilizzo 4.
Un metodo alternativo è quello di esprimere i traccianti transsynaptic come transgeni in topi geneticamente modificati. Abbiamo recentemente modificato questa tecnica e sviluppato un sistema binario transsynaptic genetico analisi per mappare i circuiti neurali di qualsiasi popolazione neuronale geneticamente identificato 5. La nostra strategia sperimentale si basa su due nuovi ceppi di topi knock-in, che esprimono sia la lectina bidirezionale tracciante orzo (BL) 6 o il tracciante retrogrado tossina tetanica frammento C fusa a GFP (GTT) 7 dalla ROSA 26 locus dopo Cre-mediata ricombinazione. Qui abbiamo usato questi ceppi di topi per esprimere selettivamente BL e GTT in neuroni che producono kisspeptin, un neuropeptide che è implicato nella regolazione della maturazione dell'asse riproduttivo 8,9. Dimostriamo che questa tecnica è adatta per visualizzare lo sviluppo e la maturazione del baciopeptin circuiti neurali durante lo sviluppo embrionale del topo cervello femminile 5.
Strategia di allevamento
La R26-BL-IRES-τlacZ (BIZ) e R26-GFP-TTC (GTT) linee traccianti sono knock-in ceppi 5 che portano alleli ROSA26 ricombinanti. La R26-BIZ e gli alleli R26-GTT sono trascrizionalmente silente a causa della presenza di un forte segnale di arresto della trascrizione, che è affiancato da due siti loxP 5. Espressione del transgene BIZ e GTT è attivato dalla rimozione Cre-mediata del segnale di arresto trascrizionale. Gli alleli R26-BIZ e R26-GTT possono essere utilizzati indipendentemente attraversando semplicemente con una linea pilota Cre. Per gli animali di analisi eterozigoti per i rispettivi alleli Cre e R26 può essere utilizzato. Nidiata che trasportano una Cre o un allele R26, rispettivamente, dovrebbero essere utilizzati come controlli. In alternativa, è anche possibile generare tRiple knock-in animali portatori degli alleli Cre, R26-BIZ e R26-GTT, tuttavia ciò richiederà una croce supplementare.
Protocol
Representative Results
Discussion
Esprimendo traccianti transsynaptic come transgeni per rintracciare i circuiti neurali di popolazioni di neuroni geneticamente definiti ha diversi vantaggi rispetto alla iniezione stereotassica di traccianti o virus neurotopic. Innanzitutto, il tracciante viene prodotta come proteina endogena e pertanto non suscitare una risposta immunitaria e un percorso neurale selettiva può essere analizzato in diversi animali con elevata riproducibilità. In secondo luogo, perché questo è un metodo non invasivo può essere utiliz…
Disclosures
The authors have nothing to disclose.
Acknowledgements
We thank Michael Candlish for critical comments on the manuscript. This project was supported by the Deutsche Forschungsgemeinschaft grants BO1743/6 and SFB/TRR 152 P11 and Z02 to Ulrich Boehm.
Materials
| Name of Material/ Equipment | Company | Catalog Number | Comments/Description |
| Bisbenzimide (Hoechst 33258 dye) | Sigma | 14530-100MG | |
| Ethanol | Sigma | 32205-1L | |
| Cryo mold (Peel-a-way) | Polyscience Inc. | 18646A-1 | 22mm x 22mm x 20mm |
| DMSO | Sigma | D8418-100ML | |
| Dimethyl Formamide (DMF) | VWR Chemicals | 23470,293 | |
| EGTA | ROTH | 3054.3 | |
| Fluoromount G | Southern Biotech | 0100-01 | |
| Glutaraldehyde | Sigma | G5882-50ML | |
| Hydrogen peroxide | Sigma | 34988-7 | |
| Isopentane (Methyl 2-butane) | Sigma | M32631-2.5L | |
| Kaiser's Glycine gelatin | Merck | 1092420100 | |
| Methanol | Sigma | 494437-1L | |
| MgCl2 | Sigma | M2670-100G | |
| NaCl | ROTH | HN00.2 | |
| NBT | Sigma | 298-83-9 | |
| Nonidet P40 substitute | Fluka | 743.85 | |
| OCT | Leica | 14020108926 | |
| PAP pen | Dako | S2002 | |
| Parafarmaldehyde | Sigma | P6148-1KG | |
| Sodium deoxycholate | Sigma | D6750-25G | |
| Sucrose | Sigma | S7903-1KG | |
| Superfrost slides | Thermo Scientific | FT4981GLPLUS | |
| TSA kit | PerkinElmer | NEL700 | |
| TSA plus kit | PerkinElmer | NEL749A001KT | |
| Tris | ROTH | AE15.2 | |
| Triton-X 100 | ROTH | 3051.2 | |
| Tween 20 | ROTH | 9127.1 | |
| X-gal | ROTH | 2315.1 | |
| Cryostat | Leica | na | |
| Light microscope equipped with DIC imaging | Zeiss | Axioskop2 equipped with Axio Vision software | |
| Fluroscence microscope | Zeiss | Axioskop2 equipped with Axio Vision software | |
| Photoshop | Adobe | PS6 | |
| Goat anti-WGA (recognizes BL) | Vector Laboatories | AS-2024 | |
| Biotinylayted horse anti-goat IgG | Vector Laboatories | BA-9500 | |
| Biotinylated goat anti-rabbit IgG | Vector Laboatories | BA-1000 | |
| Rabbit anti-GFP (recognizes GTT) | Invitrogen | A11122 | |
| Rabbit anti-GnRH | Affinity Bio Reagent | PA1-121 | |
| Dylight488-donkey anti-rabbit IgG | Thermo Scientific | SA5-10038 | |
| SA-Alexa Fluor 546 | Life Technologies | S-11225 | |
| Primers | |||
| BL Fwd (for BIZ genotyping) | Eurofins MWG Operon | ATGAAGATGATGAGCACCAG GGC |
|
| BL Rev (for BIZ genotyping) | Eurofins MWG Operon | AGCCCTCGCCGCAGAACTC | |
| Cre Fwd (for Cre genotyping) | Eurofins MWG Operon | GTCGATGCAACGAGTGATGAG GTTCG |
|
| Cre Rev (for Cre genotyping) | Eurofins MWG Operon | CCAGGCTAAGTGCCTTCTCTAC ACCTGC |
|
| TTC Fwd (for GTT genotyping) | Eurofins MWG Operon | AGCAAGGGCGAGGAGCTGTT | |
| TTC Rev (for GTT genotyping) | Eurofins MWG Operon | GTCTTGTAGTTGCCGTCGTCCT TGAA |
|
| XY Fwd (for gender genotyping) | Eurofins MWG Operon | TGAAGCTTTTGGCTTTGA | |
| XY Rev (for gender genotyping) | Eurofins MWG Operon | CCGCTGCCAAATTCTTTG | |
| ROSA26 Fwd | Eurofins MWG Operon | CGAAGTCGCTCTGAGTTGTTATC | |
| ROSA26 Rev | Eurofins MWG Operon | GCAGATGGAGCGGGAGAAAT | |
| SA Rev | Eurofins MWG Operon | CGAAGTCGCTCTGAGTTGTTATC | |
References
- Vercelli, A., Repici, M., Garbossa, D., Grimaldi, A. Recent techniques for tracing pathways in the central nervous system of developing and adult mammals. Brain. Res. Bull. 51, 11-28 (2000).
- Huang, Z. J., Zeng, H. Genetic approaches to neural circuits in the mouse. Annu. Rev. Neurosci. 36, 183-215 (2013).
- Lanciego, J. L., Wouterlood, F. G. A half century of experimental neuroanatomical tracing. J. Chem. Neuroanat. 42, 157-183 (2011).
- DeFalco, J., et al. Virus-assisted mapping of neural inputs to a feeding center in the hypothalamus. Science. 291, 2608-2613 (2001).
- Kumar, D., et al. Murine arcuate nucleus kisspeptin neurons communicate with GnRH neurons in utero. J. Neurosci. 34, 3756-3766 (2014).
- Horowitz, L. F., Montmayeur, J. P., Echelard, Y., Buck, L. B. A genetic approach to trace neural circuits. Proc. Natl. Acad. Sci. U.S.A. 96, 3194-3199 (1999).
- Maskos, U., Kissa, K., ST Cloment, C., Brulet, P. Retrograde trans-synaptic transfer of green fluorescent protein allows the genetic mapping of neuronal circuits in transgenic mice. Proc. Natl. Acad. Sci. U.S.A. 99, 10120-10125 (2002).
- De Roux, N., et al. Hypogonadotropic hypogonadism due to loss of function of the KiSS1-derived peptide receptor GPR54. Proc. Natl. Acad. Sci. U.S.A. 100, 10972-10976 (2003).
- Seminara, S. B., et al. The GPR54 gene as a regulator of puberty. N. Engl. J. Med. 349, 1614-1627 (2003).
- Mayer, C., et al. Timing and completion of puberty in female mice depend on estrogen receptor alpha-signaling in kisspeptin neurons. Proc. Natl. Acad. Sci. U.S.A. 107, 22693-22698 (2010).
- Soriano, P. Generalized lacZ expression with the ROSA26 Cre reporter strain. Nat. Genet. 21, 70-71 (1999).
- Seibler, J., et al. Single copy shRNA configuration for ubiquitous gene knockdown in mice. Nucleic Acids Res. 33, e67 (2005).
- Semaan, S. J., Kauffman, A. S. Emerging concepts on the epigenetic and transcriptional regulation of the Kiss1 gene. Int. J. Dev. Neurosci. 31, 452-462 (2013).
- Feil, R., et al. Ligand-activated site-specific recombination in mice. Proc. Natl. Acad. Sci. U.S.A. 93, 10887-10890 (1996).
