JoVE Journal > Medicine
Summary
Abstract
Introduction
Protocol
Results
Discussion
Disclosures
Acknowledgements
Materials
References
Automatic Translation
Please note that all translations are automatically generated. Click here for the English version.
Medicine

Preparación y<em> In Vitro</em> Caracterización de Magnetized miR-modificado células endoteliales

Published: May 02, 2017
doi:
10.3791/55567
, , , , , ,
1Reference and Translation Center for Cardiac Stem Cell Therapy (RTC), Department of Cardiac Surgery,University of Rostock, 2Physikalisch-Technische Bundesanstalt, 3Department of Radiology and Neuroradiology,Ernst-Moritz-Arndt-University Greifswald, 4Electron Microscopy Center,University of Rostock

Summary

Este manuscrito describe la entrega eficiente, no viral de miR a las células endoteliales por un vector de PEI / MNP y su magnetización. Por lo tanto, además de la modificación genética, este enfoque permite la orientación magnética de las células y de detección de MRI. La técnica se puede utilizar para mejorar las características de los productos de células terapéuticas.

Abstract

Hasta la fecha, los tratamientos quirúrgicos y farmacológicos disponibles para las enfermedades cardiovasculares (ECV) son limitados y a menudo paliativo. Al mismo tiempo, el gen de terapias con células y son enfoques alternativos muy prometedores para el tratamiento de enfermedades cardiovasculares. Sin embargo, la amplia aplicación clínica de la terapia génica está limitada en gran medida por la falta de sistemas de suministro de genes adecuados. El desarrollo de vectores de suministro de genes adecuados puede proporcionar una solución a los retos actuales en la terapia celular. En particular, los inconvenientes existentes, como la eficiencia limitada y retención celular bajo en el órgano lesionado, podría ser superado por ingeniería celular apropiada (es decir, genética) antes del trasplante. El protocolo presentado describe la modificación transitoria eficiente y seguro de las células endoteliales usando una nanopartícula polietilenimina superparamagnético magnético (PEI / MNP) basada en vector de administración. Además, el algoritmo y métodos para la caracterización de células se definen. El éxito intracelluentrega lar de microARN (MIR) en las células endoteliales de la vena umbilical humana (HUVECs) se ha logrado sin afectar la viabilidad celular, la funcionalidad, o la comunicación intercelular. Por otra parte, este enfoque se ha demostrado que causa un efecto funcional fuertes en exógeno introducido MIR. Es importante destacar que la aplicación de este vector basado en MNP asegura magnetización celular, con posibilidades de orientación magnética y rastreo MRI no invasiva de acompañamiento. Esto puede proporcionar una base para la terapéutica de células magnéticamente guiadas, por ingeniería genética que pueden ser monitoreados de manera no invasiva con MRI.

Introduction

Terapia génica y celular son herramientas poderosas que tienen el potencial para resolver los retos actuales en el tratamiento de las enfermedades cardiovasculares. A pesar de que estos dos enfoques actualmente se están probando en ensayos clínicos, que todavía no están listos para una amplia aplicación clínica 1. En particular, un enfoque común para hacer frente a los retos de la terapia génica y celular es el desarrollo de vectores de suministro de genes multifuncionales adecuados para la aplicación clínica. La falta de sistemas de administración de genes segura y eficiente es la preocupación principal de la terapia génica. Al mismo tiempo, la ingeniería genética de productos celulares antes del transplante podría superar los serios desafíos de la terapia celular, tales como la baja eficiencia (por ejemplo, en el campo cardiaco, solamente ~ 5% de mejoría funcional se logra post-trasplante de célula 1 ) y mala retención / injerto al sitio de la lesión (es decir, retención celular cae por debajo de 5 – 10% en cuestión de minutos a horas post-aplicación, independientemente de la vía de administración 2, 3, 4).

Hasta la fecha, los vectores virales son muy superiores a los sistemas no virales en términos de eficiencia, que ha resultado en su aplicación más amplia en los ensayos clínicos (~ 67%) 5. Sin embargo, los vehículos virales conllevan riesgos graves, tales como la inmunogenicidad (y la respuesta inflamatoria posterior, con complicaciones graves), oncogenicidad, y las limitaciones en el tamaño del material genético llevado a 6. Debido a estas preocupaciones de seguridad y los altos costes de la producción del vector viral, el uso de sistemas no virales es preferible en ciertos casos 7, 8. Es especialmente adecuado para los trastornos que requieren corrección genética transitoria, tales como la expresión de factores de crecimiento que controlan la angiogénesis (por ejemplo, para el tratamiento CVD) o la deliveria de las vacunas.

En nuestro grupo, un sistema de entrega se diseñó por combinación ramificado polietilenimina 25-kDa (PEI) y nanopartículas de óxido de hierro superparamagnéticas (MNP) unidas entre sí por la interacción biotina-estreptavidina 9. Este vector es una herramienta potencial para la ingeniería genética de las células, lo que permite su magnetización simultánea antes del trasplante. Este último proporciona una base para la orientación / retención magnética, que es particularmente prometedor hoy en día, como técnicas de segmentación magnéticas avanzadas están siendo desarrollados con éxito 10. Además, las células magnéticamente sensibles resultantes tienen el potencial de ser no invasiva monitoreado por resonancia magnética (MRI) o formación de imágenes de partículas magnéticas 11, 12.

En el caso del vector de PEI / MNP, poliamina asegura de condensación de ácido nucleico y por lo tanto la protección de factor de degradantes s, internalización vector en las células, y endosomal escapar 5. El MNPs complementar las propiedades de PEI, no sólo en términos de orientación magnética, sino también por la reducción de la conocida toxicidad PEI 7, 13, 14. Anteriormente, PEI / MNP propiedades vector se ajustaron en términos de eficiencia en la entrega (es decir, pDNA y los genes miARN) y la seguridad mediante el uso de fibroblastos y células madre mesenquimatosas humanas 15, 16.

En este manuscrito, un protocolo detallado sobre la aplicación de PEI / MNPs para la generación de células miARN-modificado se describe 17. Para este propósito, HUVECs se utilizan y representan un modelo establecido para la angiogénesis in vitro. Son difíciles de transfectar y son susceptibles a la influencia tóxica 18, 19,culo = "xref"> 20. Además, proporcionamos un algoritmo para evaluar dichas células in vitro, incluyendo su orientación, la comunicación intercelular, y la detección de MRI.

Protocol

Cordones umbilicales humanos para el aislamiento de células se obtuvieron a partir de posparto informados, mujeres sanas que dieron su consentimiento por escrito para el uso de este material para la investigación de acuerdo con la Declaración de Helsinki. El comité de ética de la Universidad de Rostock ha aprobado el estudio presentado (Reg. No. A 2011, 06, 23 de prolongada de septiembre de 2013). 1. Preparación de Transfección Complejos La biotinilación de poliet…

Representative Results

El objetivo principal del protocolo propuesto es producir células modificadas-MIR magnéticamente sensibles y para llevar a cabo su caracterización precisa (Figura 1). Como resultado, las células transfectadas de manera eficiente, que responden a la selección y orientación magnética y detectables con MRI, se deben obtener. En primer lugar, las identidades de HUVECs aisladas se confirmaron mediante tinci?…

Discussion

La producción de células genéticamente cargados con nanopartículas superparamagnéticas por su orientación más controlada magnéticamente se presenta en el protocolo actual. La aplicación exitosa de esta estrategia permite la resolución de algunas dificultades de la terapia celular, tales como baja retención y pobres injerto en el área lesionada 2, 3, 4, proporcionando un producto de células objeto de orientación pa…

Disclosures

The authors have nothing to disclose.

Acknowledgements

Nos gustaría dar las gracias a G. Fulda (Microscopía Electrónica Center, Universidad de Rostock, Alemania) por el apoyo técnico en la adquisición de imágenes de TEM de nanopartículas superparamagnéticas filtrados y en la realización de sus análisis de rayos X. El trabajo llevado a cabo en el RTC Rostock fue apoyado por el Ministerio Federal de Educación e Investigación de Alemania (FKZ 0312138A, FKZ 316.159 y VIP + 03VP00241) y el Estado Mecklemburgo-Pomerania Occidental con fondos estructurales de la UE (FSE / IV-WM-B34- 0030/10 y ESF / IV-BM-B35-0010 / 12) y por la DFG (DA 1296-1), la humedad-Fundación, y la Fundación corazón alemán (F / 01/12). Frank Wiekhorst fue apoyado por el programa de investigación del 7PM de la UE "Nanomag" FP7-NMP-2013-LARGE-7.

Materials

PEI 25 kDa Sigma Aldrich 408727
EZ-Link Sulfo-NHS-LC-Biotin Thermo Scientific 21335
PD-10 Desalting Columns GE Healthcare 17085101 Containing Sephadex G-25 Medium
Ninhydrin Reagent solution 2% Sigma Aldrich 7285
Glycine Sigma Aldrich 410225
Pierce Biotin Quantitation Kit Thermo Scientific 28005
 Microplate reader Model 680 Bio-Rad
Streptavidin MagneSphere Paramagnetic Particles Promega Z5481
Millex-HV PVDF Filter Merck SLHV013SL 0.45µm
Libra 120 transmission electron microscope  Zeiss Acceleration Voltage 120KV
Sapphire X-ray detector EDAX-Amatek
Cell culture plastic TPP
NHS-Esther Atto 565 ATTO-TEC GmbH AD 565-31
NHS-Esther Atto 488  ATTO-TEC GmbH AD 488-31
Cy5 miRNA Label IT kit Mirus Bio MIR 9650
Biotin Atto 565 ATTO-TEC GmbH AD 565-71
Collagense Type IV Gibco Thermo Scientific 17104019
Endothelial growth medium, EGM-2 Lonza CC-3156 & CC-4176
Penicillin/Streptomycin Thermo Scientific 15140122 100 U/ml, 100µg/ml
Matrigel BD Biosciences 356234
anti-PECAM-1 antibody Santa Cruz sc-1506
MS MACS columns Miltenyi Biotec  130-042-201
Near-IR Live/Dead Cell Stain Kit Thermo Scientific L10119
Cy3 Dye-Labeled Pre-miR Negative Control Thermo Scientific AM17120 "Cy3-miR" or "Cyanine-miR3" in the manuscript
Pre-miR miRNA Precursor Molecules – Negative Control  Thermo Scientific AM17110 "scr-miR" in the manuscript
Anti-hsa-miR92a-3p synthetic Inhibitor  Thermo Scientific AM10916
LSM 780 ELYRA PS.1 system Zeiss
Paraformaldehyde Sigma Aldrich 158127 4% solution in PBS
DAPI nuclear stain Thermo Scientific D1306
NucleoSpin RNA isolation Kit Machery-Nagel 740955
mirVana miRNA Isolation Kit Thermo Scientific AM1560
TaqMan MicroRNA Reverse Transcription Kit Thermo Scientific 4366596
StepOnePlus Real-Time PCR System Applied Biosystems
High-Capacity cDNA Reverse Transcription Kit Thermo Scientific 4368814
hsa-miR-92a TaqMan assay Thermo Scientific 000431 Mature miRNA Sequence: UAUUGCACUUGUCCCGGCCUGU
FastGene Taq Ready Mix Nippon Genetics LS27
ITGA5 TaqMan assay Thermo Scientific Hs01547673_m1
RNU6B TaqMan assay Thermo Scientific 001093
18S rRNA Endogenous Control Thermo Scientific 4333760F
Gelatin Sigma Aldrich G7041
CellTrace Calcein Red-Orange Thermo Scientific C34851
PBS Pan Biotech P04-53500
BSA Sigma Aldrich
MACS buffer Miltenyi Biotec  130-091-221
Agarose Sigma Aldrich A9539
7.1 Tesla animal MRI system Bruker Corporation A7906
ImageJ software National Institutes of Health upgraded with an AngiogenesisAnalyzer (NIH)
MPS device Bruker Biospin
Matlab software Mathworks
Ring Neodym Magnet  magnets4you GmbH RM-10x04x05-G ø 10 mm; remanescence is ~1.3T, coercivity ≥ 955 kA/m
Click-iT EdU Alexa Fluor 647 Imaging Kit Thermo Scientific C10340
FluorSave Reagent Merck 345789
Ultrasonic bath Bandelin electronic Type: RK 100 SH
DOWNLOAD MATERIALS LIST

References

  1. Behfar, A., Crespo-Diaz, R., Terzic, A., Gersh, B. J. Cell therapy for cardiac repair-lessons from clinical trials. Nat Rev Cardiol. 11 (4), 232-246 (2014).
  2. Zeng, L., Hu, Q., et al. Bioenergetic and functional consequences of bone marrow-derived multipotent progenitor cell transplantation in hearts with postinfarction left ventricular remodeling. Circulation. 115 (14), 1866-1875 (2007).
  3. Dib, N., Khawaja, H., Varner, S., McCarthy, M., Campbell, A. Cell therapy for cardiovascular disease: a comparison of methods of delivery. J Cardiovasc Transl Res. 4 (2), 177-181 (2011).
  4. Terrovitis, J., Lautamäki, R., et al. Noninvasive Quantification and Optimization of Acute Cell Retention by In Vivo Positron Emission Tomography After Intramyocardial Cardiac-Derived Stem Cell Delivery. J Am Coll Cardiol. 54 (17), 1619-1626 (2009).
  5. Villate-Beitia, I., Puras, G., Zarate, J., Agirre, M., Ojeda, E., Pedraz, J. L. First Insights into Non-invasive Administration Routes for Non-viral Gene Therapy. Gene Therapy – Principles and Challenges. , (2015).
  6. Nayerossadat, N., Maedeh, T., Ali, P. A. Viral and nonviral delivery systems for gene delivery. Adv Biomed Res. 1, 27 (2012).
  7. Yin, H., Kanasty, R. L., Eltoukhy, A. A., Vegas, A. J., Dorkin, J. R., Anderson, D. G. Non-viral vectors for gene-based therapy. Nat Rev Genet. 15 (8), 541-555 (2014).
  8. Chira, S., Jackson, C. S., et al. Progresses towards safe and efficient gene therapy vectors. Oncotarget. 6 (31), 30675-30703 (2015).
  9. Li, W., Ma, N., et al. Enhanced thoracic gene delivery by magnetic nanobead-mediated vector. J Gene Med. 10 (8), 897-909 (2008).
  10. Muthana, M., Kennerley, A. J., et al. Use of magnetic resonance targeting to direct cell therapy to target sites in vivo. Nat Commun. 6, 1-11 (2013).
  11. Zheng, B., von See, M. P., et al. Quantitative Magnetic Particle Imaging Monitors the Transplantation, Biodistribution, and Clearance of Stem Cells In Vivo. Theranostics. 6 (3), 291-301 (2016).
  12. Almstätter, I., Mykhaylyk, O., et al. Characterization of magnetic viral complexes for targeted delivery in oncology. Theranostics. 5 (7), 667-685 (2015).
  13. Juliano, R. L. The delivery of therapeutic oligonucleotides. Nucleic Acids Res. , (2016).
  14. Chen, J., Guo, Z., Tian, H., Chen, X. Production and clinical development of nanoparticles for gene delivery. Mol Ther Methods Clin Dev. 3, 16023 (2016).
  15. Schade, A., Delyagina, E., et al. Innovative strategy for microRNA delivery in human mesenchymal stem cells via magnetic nanoparticles. Int J Mol Sci. 14 (6), 10710-10726 (2013).
  16. Delyagina, E., Schade, A., et al. Improved transfection in human mesenchymal stem cells: effective intracellular release of pDNA by magnetic polyplexes. Nanomedicine. 9 (7), 999-1017 (2014).
  17. Voronina, N., Lemcke, H., et al. Non-viral magnetic engineering of endothelial cells with microRNA and plasmid-DNA-An optimized targeting approach. Nanomedicine. 12 (8), 2353-2364 (2016).
  18. Hunt, M. A., Currie, M. J., Robinson, B. A., Dachs, G. U. Optimizing transfection of primary human umbilical vein endothelial cells using commercially available chemical transfection reagents. J Biomol Tech. 21 (2), 66-72 (2010).
  19. Zhang, J., Wang, Z., Lin, W., Chen, S. Gene transfection in complex media using PCBMAEE-PCBMA copolymer with both hydrolytic and zwitterionic blocks. Biomaterials. 35 (27), 7909-7918 (2014).
  20. Lim, J., Dobson, J. Improved transfection of HUVEC and MEF cells using DNA complexes with magnetic nanoparticles in an oscillating field. J Genet. 91 (2), 223-227 (2012).
  21. Moore, S., Stein, W. H. A modified ninhydrin reagent for the photometric determination of amino acids and related compounds. J Biol Chem. 211 (2), 907-913 (1954).
  22. Jones, D. L., Owen, A. G., Farrar, J. F. Simple method to enable the high resolution determination of total free amino acids in soil solutions and soil extracts. Soil Biol Biochem. 34 (12), 1893-1902 (2002).
  23. Kircheis, R., Wightman, L., et al. Polyethylenimine/DNA complexes shielded by transferrin target gene expression to tumors after systemic application. Gene Ther. 8 (1), 28-40 (2001).
  24. Green, N. M. A SPECTROPHOTOMETRIC ASSAY FOR AVIDIN AND BIOTIN BASED ON BINDING OF DYES BY AVIDIN. Biochem J. 94, 23 (1965).
  25. Haugland, R. P., You, W. W. Coupling of Antibodies with Biotin. Methods Mol Biol. 418, 13-23 (2008).
  26. Braunschweig, J., Bosch, J., Heister, K., Kuebeck, C., Meckenstock, R. U. Reevaluation of colorimetric iron determination methods commonly used in geomicrobiology. J Microbiol Methods. 89 (1), 41-48 (2012).
  27. Andrade, &. #. 1. 9. 4. ;. L., Valente, M. A., Ferreira, J. M. F., Fabris, J. D. Preparation of size-controlled nanoparticles of magnetite. J Magn Magn Mater. 324 (10), 1753-1757 (2012).
  28. Barbaro, D., Di Bari, L., et al. Glucose-coated superparamagnetic iron oxide nanoparticles prepared by metal vapour synthesis are electively internalized in a pancreatic adenocarcinoma cell line expressing GLUT1 transporter. PLoS ONE. 10 (4), e0123159 (2015).
  29. Gaebel, R., Ma, N., et al. Patterning human stem cells and endothelial cells with laser printing for cardiac regeneration. Biomaterials. 32 (35), 9218-9230 (2011).
  30. Martín de Llano, J. J., Fuertes, G., Torró, I., García Vicent, C., Fayos, J. L., Lurbe, E. Birth weight and characteristics of endothelial and smooth muscle cell cultures from human umbilical cord vessels. J Transl Med. 7, 30 (2009).
  31. Bonauer, A., Carmona, G., et al. MicroRNA-92a controls angiogenesis and functional recovery of ischemic tissues in mice. Science. 324 (5935), 1710-1713 (2009).
  32. Wang, W., Li, W., et al. Polyethylenimine-mediated gene delivery into human bone marrow mesenchymal stem cells from patients. J Cell Mol Med. 15 (9), 1989-1998 (2011).
  33. Lemcke, H., Peukert, J., Voronina, N., Skorska, A., Steinhoff, G., David, R. Applying 3D-FRAP microscopy to analyse gap junction-dependent shuttling of small antisense RNAs between cardiomyocytes. J Mol Cell Cardiol. 98, 117-127 (2016).
  34. Cheng, K., Li, T. -. S., Malliaras, K., Davis, D. R., Zhang, Y., Marbán, E. Magnetic targeting enhances engraftment and functional benefit of iron-labeled cardiosphere-derived cells in myocardial infarction. Circ Res. 106 (10), 1570-1581 (2010).
  35. Strober, W. Trypan Blue Exclusion Test of Cell Viability. Curr Protoc Immunol. , A.3B.1-A.3B.2 (2001).
  36. Chorny, M., Alferiev, I. S., et al. Formulation and in vitro characterization of composite biodegradable magnetic nanoparticles for magnetically guided cell delivery. Pharm Res. 29 (5), 1232-1241 (2012).
  37. Poller, W., Löwa, N., et al. Magnetic Particle Spectroscopy Reveals Dynamic Changes in the Magnetic Behavior of Very Small Superparamagnetic Iron Oxide Nanoparticles During Cellular Uptake and Enables Determination of Cell-Labeling Efficacy. J Biomed Nanotechnol. 12 (2), 337-346 (2016).
  38. Lobsien, D., Dreyer, A. Y., Stroh, A., Boltze, J., Hoffmann, K. T. Imaging of VSOP Labeled Stem Cells in Agarose Phantoms with Susceptibility Weighted and T2* Weighted MR Imaging at 3T: Determination of the Detection Limit. PLoS ONE. 8 (5), 1-10 (2013).
  39. Hernando, D., Kühn, J. -. P., et al. R2* estimation using "in-phase" echoes in the presence of fat: the effects of complex spectrum of fat. J Magn Reson Imaging. 37 (3), 717-726 (2013).
  40. Soenen, S. J., Rivera-Gil, P., Montenegro, J. -. M., Parak, W. J., De Smedt, S. C., Braeckmans, K. Cellular toxicity of inorganic nanoparticles: Common aspects and guidelines for improved nanotoxicity evaluation. Nano Today. 6 (5), 446-465 (2011).
  41. Robert, D., Kirkton, N. B. Genetic Engineering and Stem Cells: Combinatorial Approaches for Cardiac Cell Therapy. IEEE Eng Med Biol Mag. 27 (3), 85 (2008).
  42. Chen, Y., Wang, W., et al. Development of an MRI-visible nonviral vector for siRNA delivery targeting gastric cancer. Int J Nanomedicine. 7, 359-368 (2012).
  43. Diener, Y., Jurk, M., et al. RNA-based, transient modulation of gene expression in human haematopoietic stem and progenitor cells. Sci Rep. 5, 17184 (2015).
  44. Müller, P., Voronina, N., et al. Magnet-Bead Based MicroRNA Delivery System to Modify CD133+ Stem Cells. Stem Cells Int. 2016, 1-16 (2016).
  45. Yang, H., Vonk, L. A., et al. Cell type and transfection reagent-dependent effects on viability, cell content, cell cycle and inflammation of RNAi in human primary mesenchymal cells. Eur J Pharm Sci. 53, 35-44 (2014).
  46. Chen, C. -. H., Sereti, K. -. I., Wu, B. M., Ardehali, R. Translational aspects of cardiac cell therapy. J Cell Mol Med. 19 (8), 1757-1772 (2015).
  47. Alaiti, M. A., Ishikawa, M., et al. Up-regulation of miR-210 by vascular endothelial growth factor in ex vivo expanded CD34+ cells enhances cell-mediated angiogenesis. J Cell Mol Med. 16 (10), 2413-2421 (2012).
  48. Landázuri, N., Tong, S., et al. Magnetic targeting of human mesenchymal stem cells with internalized superparamagnetic iron oxide nanoparticles. Small. 9 (23), 4017-4026 (2013).
  49. Carenza, E., Barceló, V., et al. In vitro angiogenic performance and in vivo brain targeting of magnetized endothelial progenitor cells for neurorepair therapies. Nanomedicine. 10 (1), 225-234 (2014).
  50. Kyrtatos, P. G., Lehtolainen, P., et al. Magnetic Tagging Increases Delivery of Circulating Progenitors in Vascular Injury. JACC Cardiovasc Interv. 2 (8), 794-802 (2009).
  51. Huang, Z., Shen, Y., et al. Magnetic targeting enhances retrograde cell retention in a rat model of myocardial infarction. Stem Cell Res Ther. 4 (6), 149 (2013).
  52. Wu, X., Tan, Y., Mao, H., Zhang, M. Toxic effects of iron oxide nanoparticles on human umbilical vein endothelial cells. Int J Nanomedicine. 5, 385-399 (2010).
  53. Soenen, S. J. H., Nuytten, N., De Meyer, S. F., De Smedt, S. C., De Cuyper, M. High Intracellular Iron Oxide Nanoparticle Concentrations Affect Cellular Cytoskeleton and Focal Adhesion Kinase-Mediated Signaling. Small. 6 (7), 832-842 (2010).
  54. Cheng, K., Malliaras, K., et al. Magnetic enhancement of cell retention, engraftment, and functional benefit after intracoronary delivery of cardiac-derived stem cells in a rat model of ischemia/reperfusion. Cell Transplant. 21 (6), 1121-1135 (2012).
  55. Vandergriff, A. C., Hensley, T. M., et al. Magnetic targeting of cardiosphere-derived stem cells with ferumoxytol nanoparticles for treating rats with myocardial infarction. Biomaterials. 35 (30), 8528-8539 (2014).

Tags

Keywords: Magnetized CellsMiR-modified CellsEndothelial CellsCell MagnetizationMicroRNA TransfectionPolyethyleneimeneSuper Paramagnetic Iron Oxide NanoparticlesCell TherapyRegenerative MedicineCell RetentionCell SurvivalConfocal MicroscopyStructured Illumination Microscopy
check_url/55567?article_type=t

Play Video
PDF
DOI
DOWNLOAD MATERIALS LIST
Cite This Article
Voronina, N., Lemcke, H., Wiekhorst, F., Kühn, J., Frank, M., Steinhoff, G., David, R. Preparation and In Vitro Characterization of Magnetized miR-modified Endothelial Cells. J. Vis. Exp. (123), e55567, doi:10.3791/55567 (2017).
Download Citation
Reprints and Permissions

View Video

✖

To prove you're not a robot, please enter the text in the image below

CAPTCHA Image
Play CAPTCHA Audio
Refresh Image