Generation of Discriminative Human Monoclonal Antibodies from Rare Antigen-specific B Cells Circulating in Blood

Summary

We describe a method for the production of human antibodies specific for an antigen of interest, starting from rare B cells circulating in human blood. Generation of these natural antibodies is efficient and rapid, and the antibodies obtained can discriminate between highly related antigens.

Abstract

Monoclonal antibodies (mAbs) are powerful tools useful for both fundamental research and in biomedicine. Their high specificity is indispensable when the antibody needs to distinguish between highly related structures (e.g., a normal protein and a mutated version thereof). The current way of generating such discriminative mAbs involves extensive screening of multiple Ab-producing B cells, which is both costly and time consuming. We propose here a rapid and cost-effective method for the generation of discriminative, fully human mAbs starting from human blood circulating B lymphocytes. The originality of this strategy is due to the selection of specific antigen binding B cells combined with the counter-selection of all other cells, using readily available Peripheral Blood Mononuclear Cells (PBMC). Once specific B cells are isolated, cDNA (complementary deoxyribonucleic acid) sequences coding for the corresponding mAb are obtained using single cell Reverse Transcription-Polymerase Chain Reaction (RT-PCR) technology and subsequently expressed in human cells. Within as little as 1 month, it is possible to produce milligrams of highly discriminative human mAbs directed against virtually any desired antigen naturally detected by the B cell repertoire.

Introduction

The method described here allows the rapid and versatile production of fully human monoclonal antibodies (mAbs) against a desired antigen (Ag). mAbs are essential tools in many fundamental research applications in vitro and in vivo: flow cytometry, histology, western-blotting, and blocking experiments for example. Furthermore, mAbs are being used more and more in medicine to treat autoimmune diseases, cancer, and to control transplantation rejection¹. For example, anti-CTLA-4 and anti-PD-1 (or anti-PD-L1) mAbs were recently used as immune checkpoint inhibitors in cancer treatments².

The first mAbs were produced by immunoglobulin (Ig)-secreting hybridomas obtained from the splenic cells of immunized mice or rats. However, the strong immune response against murine or rat mAbs hampers their therapeutic use in humans, due to their rapid clearance and the probable induction of hypersensitivity reactions³. To tackle this problem, animal protein sequences of mAbs have been partially replaced by human ones to generate so-called chimeric mouse-human or humanized antibodies. However, this strategy only partially decreases immunogenicity, while substantially increasing both the cost and the time-scale of production. A better solution is to generate human mAbs directly from human B cells and several strategies for this are available. One of them is the use of phage or yeast display. This involves displaying variable domains from a combinatorial library of random human Ig heavy and light chains on phages or yeasts, and carrying out a selection step using the specific antigen of interest. A major drawback of this strategy is that heavy and light chains are randomly associated, leading to a very large increase in the diversity of generated antibodies. Antibodies obtained are unlikely to correspond to those that would arise from a natural immune response against a particular Ag. Moreover, human protein folding and post-translational modifications are not systematically reproduced in prokaryotes or even in yeasts. A second human mAb production method is the immortalization of natural human B cells, by Epstein-Barr virus infection or expression of the anti-apoptotic factors BCL-6 and BCL-XL⁴. However, this method is applicable only to memory B cells and is inefficient, requiring screening of numerous mAb-producing immortalized B cells to identify the few (if any) mAb clones with the desired antigenic specificity. The method is thus both costly and time consuming.

A new protocol has recently been described for production of human mAbs from isolated single B cells⁵. It relies on an optimized single-cell Reverse Transcription-Polymerase Chain Reaction (RT-PCR) for amplification of both the heavy- and light-chain encoding segments from a single sorted B cell. This is followed by the cloning and expression of these segments in a eukaryotic expression system, thus allowing reconstruction of a fully human mAb. This protocol has been used successfully starting from B cells from vaccinated donors. Cells were harvested several weeks after vaccination to obtain higher frequencies of B cells directed against the desired Ag, and thus limit the time required for screening⁶. Other fully human mAbs have also been produced from HIV⁺ (Human Immunodeficiency Virus) infected patients⁷ and melanoma patients⁸. Despite these advances, there is still no procedure available that enables the isolation of Ag-specific B cells independent of their memory phenotype or frequency.

The procedure described here leads to efficient ex vivo isolation of human circulating B cells based on their BCR specificity, followed by the production of fully human antigen-specific mAbs in high yield and with a low screening time. The method is not restricted to memory B cells or antibody-secreting B cells induced after an immune response, but can also be applied to the human naïve B cell repertoire. That it works even starting from Ag-specific B cells present at very low frequencies is a good indication of its efficiency. The principle of the method is as follows: Peripheral Blood Mononuclear Cells (PBMC) are stained with two tetramers presenting the antigen of interest, each labeled with a different fluorochrome (e.g., Phycoerythrin (PE) and Allophycocyanin (APC)), and a third tetramer presenting a closely related antigen conjugated with a third fluorochrome (e.g., Brillant Violet 421 (BV421)). To enrich for antigen-binding cells, cells are then incubated with beads coated with anti-PE and anti-APC Abs, and sorted in cell separation columns. The PE⁺ APC⁺ cell fraction is selected, stained with a variety of mAbs specific for different PBMC cell types to permit identification of B cells, and subjected to flow cytometry cell sorting. B cells which are PE⁺ and APC⁺, but Brilliant Violet^–, are isolated. This step counter-selects cells which are not B cells or do not bind to the tetramerized antigen, but do bind to either PE or APC (these cells will be PE⁺ APC^– or PE^– APC⁺) or to the non-antigen part of the tetramers used (these cells will be BV421⁺). B cells not highly specific for the epitope of interest are also counter-selected at this step (these cells will also be BV421⁺). Thus, this method can purify highly specific B cells expressing B-cell Receptors (BCRs) able to discriminate between two very closely related antigens. Single specific B cells are collected in tubes and their PCR-amplified Ig cDNAs (complementary deoxyribonucleic acids) cloned and expressed by a human cell line as secreted IgG mAbs.

As a proof of concept, this study describes the efficient generation of human mAbs, which recognize a peptide presented by a major histocompatibility complex class I (MHC-I) molecule and can discriminate between this peptide and other peptides loaded on the same MHC-I allele. Although the level of complexity of this Ag is important, this method allows (i) high yield recovery of Ag-specific mAbs; (ii) production of mAbs able to discriminate between two structurally close Ags. This approach can be extended to vaccinated or infected patients without any protocol modification, and has also already been successfully implemented in a humanized rat system⁹. Thus, this study describes a versatile and efficient approach to generate fully human mAbs that can be used in basic research and immunotherapy.

Protocol

All human peripheral blood samples were obtained from anonymous adult donors after informed consent, in accordance with the local ethics committee (Etablissement Français du Sang, EFS, Nantes, procedure PLER NTS-2016-08). 1. Isolation of Human Peripheral Blood Mononuclear Cells NOTE: Starting material can be total human peripheral blood or cytapheresis samples. Samples should not be older than 8 h and supplemented with anticoagulants (e.g., heparin)….

Representative Results

Starting from PBMC from healthy donors, this project presents the generation of human mAbs, which recognize the peptide Pp65495 (Pp65, from human cytomegalovirus) presented by the major histocompatibility complex class I (MHC-I) molecule HLA-A*0201 (HLA-A2). These mAbs can discriminate between this complex and complexes representing other peptides loaded onto the same MHC-I molecule. PBMC were stained with HLA-A2/Pp65…

Discussion

The proposed protocol is a powerful method for the generation of human mAbs directly from Ag-specific B cells circulating in the blood. It combines three important aspects: (i) the use of a tetramer-associated magnetic enrichment, which allows an ex vivo isolation of even rare Ag-binding B cells; (ii) a gating strategy that uses three Ag tetramers (two relevant ones and one irrelevant one) labelled with three different fluorochromes to isolate, by flow cytometry, only the B cells expressing a BCR specific for th…

Materials

HEK 293A cell line	Thermo Fisher scientific	R70507
DMEM (1X) Dulbecco's Modified Eagle Medium	Gibco by life technologies	21969-035	(+) 4,5g/L D-Glucose 0,11g/L Sodium Pyruvate (-) L-Glutmine
RPMI medium1640 (1X)	Gibco by life technologies	31870-025
Bovine Serum Albumine (BSA)	PAA	K45-001
Nutridoma-SP	Roche	11011375001	100X Conc
PBS-Phosphate Buffered Saline (10X) pH 7,4	Ambion	AM9624
EDTA (Ethylenediaminetetraacetic acid) 0,5M pH=8	Invitrogen by Life Technologies	15575-020
Fetal Bovine serum (FBS)	Dominique Dutscher	S1810-500
Ficoll – lymphocytes separation medium	EuroBio	CMSMSL01-01	density 1,0777+/-0,001
streptavidin R-phycoerythrin conjugate	Invitrogen by Life Technologies	S21388	premiun grade 1mg/ml contains 5mM sodium azide
Streptavidin, allophycocyanin conjugate	Invitrogen by thermoFisher scientific	S32362	1mg/ml 2mM azide premium grade
Brilliant violet 421 streptavidin	Biolegend	405225	conc : 0,5mg/ml
Anti-PE conjugated magnetic MicroBeads	Miltenyi Biotec	130-048-801
Anti-APC conjugated magnetic MicroBeads	Miltenyi Biotec	130-090-855
MidiMACs or QuadroMACS separotor	Miltenyi Biotec	130-042-302/130-090-976
LS Columns	Miltenyi Biotec	130-042-401
CD3 BV510 BD horizon	BD Pharmingen / BD Biosciences	563109	Used dilution 1:20
CD19 FITC	BD Pharmingen / BD Biosciences	345788	Used dilution 1:20
CD14 PerCPCy5.5	BD Pharmingen / BD Biosciences	561116	Used dilution 1:50
CD16 PerCPCy5.5	BD Pharmingen / BD Biosciences	338440	Used dilution 1:50
7AAD	BD Pharmingen / BD Biosciences	51-68981E (559925)	Used dilution 1:1000
FACS ARIA III Cell Sorter Cytometer	BD Biosciences
8-strip PCR tubes	Axygen	321-10-061
Racks for 96 microtubes	Dominique Dutscher	45476
RNAseOUT Ribonuclease Inhibitor (recombinant)	Invitrogen by thermoFisher scientific	10777-019	qty:5000U (40U/ul)
Distilled Water Dnase/Rnase Free	Gibco	10977-035
Oligod(T)18 mRNA Primer	New England BioLabs	S1316S	5.0 A260unit
Random hexamers	Invitrogen by thermoFisher scientific	N8080127	qty : 50uM, 5nmoles
Superscript III Reverse transcriptase	Invitrogen by thermoFisher scientific	18080-044	qty : 10000U (200U/ul)
GoTaq G2 Flexi DNA polymerase	Promega	M7805
dNTP Set, Molecular biology grade	Thermo Scientific	R0182	4*100umol
5LVH1	Eurofins	ACAGGTGCCCACT CCCAGGTGCAG	First round of PCR – Amplification of heavy chains – Outer primers – Forward Prmers
5LVH3	Eurofins	AAGGTGTCCAGTG TGARGTGCAG	First round of PCR – Amplification of heavy chains – Outer primers – Forward Prmers
5LVL4_6	Eurofins	CCCAGATGGGTCC TGTCCCAGGTGCAG	First round of PCR – Amplification of heavy chains – Outer primers – Forward Prmers
5LVH5	Eurofins	CAAGGAGTCTGTT CCGAGGTGCAG	First round of PCR – Amplification of heavy chains – Outer primers – Forward Prmers
3HuIgG_const_anti	Eurofins	TCTTGTCCACCTT GGTGTTGCT	First round of PCR – Amplification of heavy chains – Outer primers -Reverse primers for human Ig- Bacteria PCR screening
3CuCH1	Eurofins	GGGAATTCTCACA GGAGACGA	First round of PCR – Amplification of heavy chains – Outer primers -Reverse primers for human Ig
5AgeIVH1_5_7	Eurofins	CTGCAACCGGTGTACATTCC GAGGTGCAGCTGGTGCAG	Second round of PCR – Amplification of heavy chains – Inner primers -Forward primers
5AgeIVH3	Eurofins	CTGCAACCGGTGTACATTCT GAGGTGCAGCTGGTGGAG	Second round of PCR – Amplification of heavy chains – Inner primers -Forward primers
5AgeIVH3_23	Eurofins	CTGCAACCGGTGTACATTCT GAGGTGCAGCTGTTGGAG	Second round of PCR – Amplification of heavy chains – Inner primers -Forward primers
5AgeIVH4	Eurofins	CTGCAACCGGTGTACATTCC CAGGTGCAGCTGCAGGAG	Second round of PCR – Amplification of heavy chains – Inner primers -Forward primers
5AgeIVH4_34	Eurofins	CTGCAACCGGTGTACATTCC CAGGTGCAGCTACAGCAGTG	Second round of PCR – Amplification of heavy chains – Inner primers -Forward primers
5AgeIVH1_18	Eurofins	CTGCAACCGGTGTACATTCC CAGGTTCAGCTGGTGCAG	Second round of PCR – Amplification of heavy chains – Inner primers -Forward primers
5AgeIVH1_24	Eurofins	CTGCAACCGGTGTACATTCC CAGGTCCAGCTGGTACAG	Second round of PCR – Amplification of heavy chains – Inner primers -Forward primers
5AgeIVH3__9_30_33	Eurofins	CTGCAACCGGTGTACATTCT GAAGTGCAGCTGGTGGAG	Second round of PCR – Amplification of heavy chains – Inner primers -Forward primers
5AgeIVH6_1	Eurofins	CTGCAACCGGTGTACATTCC CAGGTACAGCTGCAGCAG	Second round of PCR – Amplification of heavy chains – Inner primers -Forward primers
3SalIJH1_2_4_5	Eurofins	TGCGAAGTCGACG CTGAGGAGACGGTGACCAG	Second round of PCR – Amplification of heavy chains – Inner primers -Reverse primers
3SalIJH3	Eurofins	TGCGAAGTCGACG CTGAAGAGACGGTGACCATTG	Second round of PCR – Amplification of heavy chains – Inner primers -Reverse primers
3SalIJH6	Eurofins	TGCGAAGTCGACG CTGAGGAGACGGTGACCGTG	Second round of PCR – Amplification of heavy chains – Inner primers -Reverse primers
5'LVk1_2	Eurofins	ATGAGGSTCCCYG CTCAGCTGCTGG	First round of PCR – Amplification of light chains k – Outer primers -Forward primers
5'LVk3	Eurofins	CTCTTCCTCCTGC TACTCTGGCTCCCAG	First round of PCR – Amplification of light chains k – Outer primers -Forward primers
5'LVk4	Eurofins	ATTTCTCTGTTGC TCTGGATCTCTG	First round of PCR – Amplification of light chains k – Outer primers -Forward primers
3'Ck543_566	Eurofins	GTTTCTCGTAGTC TGCTTTGCTCA	First round of PCR – Amplification of light chains k – Outer primers -Reverse primers- Bacteria PCR screening
5'AgeIVk1	Eurofins	CTGCAACCGGTGTACATTCT GACATCCAGATGACCCAGTC	Second round of PCR – Amplification of light chains k – Inner primers -Forward primers
5'AgeIVk1_9_1–13	Eurofins	TTGTGCTGCAACCGGTGTAC ATTCAGACATCCAGTTGACCCAGTCT	Second round of PCR – Amplification of light chains k – Inner primers -Forward primers
5'AgeIVk1D_43_1_8	Eurofins	CTGCAACCGGTGTACATTGT GCCATCCGGATGACCCAGTC	Second round of PCR – Amplification of light chains k – Inner primers -Forward primers
5'AgeIVk2	Eurofins	CTGCAACCGGTGTACATGGG GATATTGTGATGACCCAGAC	Second round of PCR – Amplification of light chains k – Inner primers -Forward primers
5'AgeIVk2_28_2_30	Eurofins	CTGCAACCGGTGTACATGGG GATATTGTGATGACTCAGTC	Second round of PCR – Amplification of light chains k – Inner primers -Forward primers
5'AgeVk3_11_3D_11	Eurofins	TTGTGCTGCAACCGGTGTAC ATTCAGAAATTGTGTTGACACAGTC	Second round of PCR – Amplification of light chains k – Inner primers -Forward primers
5'AgeVk3_15_3D_15	Eurofins	CTGCAACCGGTGTACATTCA GAAATAGTGATGACGCAGTC	Second round of PCR – Amplification of light chains k – Inner primers -Forward primers
5'AgeVk3_20_3D_20	Eurofins	TTGTGCTGCAACCGGTGTAC ATTCAGAAATTGTGTTGACGCAGTCT	Second round of PCR – Amplification of light chains k – Inner primers -Forward primers
5'AgeVk4_1	Eurofins	CTGCAACCGGTGTACATTCG GACATCGTGATGACCCAGTC	Second round of PCR – Amplification of light chains k – Inner primers -Forward primers
3'BsiWIJk1_2_4	Eurofins	GCCACCGTACGTT TGATYTCCACCTTGGTC	Second round of PCR – Amplification of light chains k – Inner primers -Forward primers
3'BsiWIJk3	Eurofins	GCCACCGTACGTT TGATATCCACTTTGGTC	Second round of PCR – Amplification of light chains k – Inner primers -Forward primers
3'BsiWIJk5	Eurofins	GCCACCGTACGTT TAATCTCCAGTCGTGTC	Second round of PCR – Amplification of light chains k – Inner primers -Forward primers
5'LVl1	Eurofins	GGTCCTGGGCCCA GTCTGTGCTG	First round of PCR – Amplification of light chains λ – Outer primers -Forward primers
5'LVl2	Eurofins	GGTCCTGGGCCCA GTCTGCCCTG	First round of PCR – Amplification of light chains λ – Outer primers -Forward primers
5'LVl3	Eurofins	GCTCTGTGACCTC CTATGAGCTG	First round of PCR – Amplification of light chains λ – Outer primers -Forward primers
5'LVl4_5	Eurofins	GGTCTCTCTCSCA GCYTGTGCTG	First round of PCR – Amplification of light chains λ – Outer primers -Forward primers
5'LVl6	Eurofins	GTTCTTGGGCCAA TTTTATGCTG	First round of PCR – Amplification of light chains λ – Outer primers -Forward primers
5'LVl7	Eurofins	GGTCCAATTCYCA GGCTGTGGTG	First round of PCR – Amplification of light chains λ – Outer primers -Forward primers
5LVl8	Eurofins	GAGTGGATTCTCA GACTGTGGTG	First round of PCR – Amplification of light chains λ – Outer primers -Forward primers
3'Cl	Eurofins	CACCAGTGTGGCC TTGTTGGCTTG	First round of PCR – Amplification of light chains λ – Outer primers -Forward primers
5'AgeIVl1	Eurofins	CTGCTACCGGTTCCTGGGCC CAGTCTGTGCTGACKCAG	Second round of PCR – Amplification of light chains λ – Inner primers -forward primers
5'AgeIVl2	Eurofins	CTGCTACCGGTTCCTGGGCC CAGTCTGCCCTGACTCAG	Second round of PCR – Amplification of light chains λ – Inner primers -forward primers
5'AgeIVl3	Eurofins	CTGCTACCGGTTCTGTGACC TCCTATGAGCTGACWCAG	Second round of PCR – Amplification of light chains λ – Inner primers -forward primers
5'AgeIVl4_5	Eurofins	CTGCTACCGGTTCTCTCTCS CAGCYTGTGCTGACTCA	Second round of PCR – Amplification of light chains λ – Inner primers -forward primers
5'AgeIVl6	Eurofins	CTGCTACCGGTTCTTGGGCC AATTTTATGCTGACTCAG	Second round of PCR – Amplification of light chains λ – Inner primers -forward primers
5'AgeIVl8	Eurofins	CTGCTACCGGTTCCAATTCY CAGRCTGTGGTGACYCAG	Second round of PCR – Amplification of light chains λ – Inner primers -forward primers
3'XhoICl	Eurofins	CTCCTCACTCGAG GGYGGGAACAGAGTG	Second round of PCR – Amplification of light chains λ – Inner primers -Reverse primers – Bacteria PCR screening
Ab-vec-sense	Eurofins	GCTTCGTTAGAAC GCGGCTAC	Bacteria PCR screening
QA Agarose-TM, Molecular Biology Grade	MP Bio	AGAH0500
NucleoFast 96 PCR Plate	Macherey Nagel	743.100.100
Enzyme Age I HF	New England Biolabs	R3552L	20000U/ml
Enzyme SalI HF	New England Biolabs	R3138L	20000U/ml
Enzyme Xho I	New England Biolabs	R0146L	20000U/ml
Enzyme BSIWI	New England Biolabs	R0553L	10000U/ml
HCg1 (Genbank accession number FJ475055)
LCk (Genbank accession number FJ475056 )
LCl (Genbank accession number FJ517647)
T4 DNA ligase	Invitrogen by thermoFisher scientific	15224.017	100U (1U/ul)
2X YT medium	Sigma Aldrich	Y1003-500ML
Ampicillin	Sigma Aldrich	10835242001
LB (Luria Bertani) Broth (Lennox)	Sigma Aldrich	L3022-250G
Nucleospin Plasmid DNA, RNA and protein purification	Macherey Nagel	740588.250
Jet PEI DNA transfection reagent	PolyPlus	101-40
Flat bottom96-well plate	Falcon	353072
V-bottom 96-well plate	Nunc/Thermofisher	055142
Nunc easy 175 cm2 flasks	Nunc/Thermofisher	12-562-000
ELISA/ELISPOT coating buffer	eBiosciences	00-0044-59
Nunc maxisorp flat bottom 96 well ELISA plates	Nunc/Thermofisher	44-2404-21	high protein binding
Anti-human IgG Ab conjugated to horseradish peroxidase (HRP)	BD Pharmingen / BD Biosciences	55788
TMB substrate	BD Biosciences	555214
Streptavidin	Sigma	S0677
1 mL-HiTrap protein A HP column	GE Healthcare	17-0402-01
ÄKTA FPLC	GE Healthcare	18190026
Superdex 200 10/300 GL column	GE Healthcare	17517501
NGC Quest 10 Plus Chromatography System	BioRad	7880003