Here methods are presented to understand anti-cancer effects of Lactobacillus cell-free supernatant (LCFS). Colorectal cancer cell lines show cell deaths when treated with LCFS in 3D cultures. The process of generating spheroids can be optimized depending on the scaffold and the analysis methods presented are useful for evaluating the involved signaling pathways.
This manuscript describes a protocol to evaluate cancer cell deaths in three dimensional (3D) spheroids of multicellular types of cancer cells using supernatants from Lactobacillus fermentum cell culture, considered as probiotics cultures. The use of 3D cultures to test Lactobacillus cell-free supernatant (LCFS) are a better option than testing in 2D monolayers, especially as L. fermentum can produce anti-cancer effects within the gut. L. fermentum supernatant was identified to possess increased anti-proliferative effects against several colorectal cancer (CRC) cells in 3D culture conditions. Interestingly, these effects were strongly related to the culture model, demonstrating the notable ability of L. fermentum to induce cancer cell death. Stable spheroids were generated from diverse CRCs (colorectal cancer cells) using the protocol presented below. This protocol of generating 3D spheroid is time saving and cost effective. This system was developed to easily investigate the anti-cancer effects of LCFS in multiple types of CRC spheroids. As expected, CRC spheroids treated with LCFS strongly induced cell death during the experiment and expressed specific apoptosis molecular markers as analyzed by qRT-PCR, western blotting, and FACS analysis. Therefore, this method is valuable for exploring cell viability and evaluating the efficacy of anti-cancer drugs.
Probiotics are the most advantageous microorganisms in the gut that improves immune homeostasis and host energy metabolism1. Probiotics from Lactobacillus and Bifidobacterium are the most advanced of its kind found in the intestine2,3. Previous investigations have shown that Lactobacillus has inhibitory and antiproliferative effects on several cancers, including colorectal cancer4. Moreover, probiotics prevent inflammatory bowel diseases, Crohn’s disease, and ulcerative colitis5,6. However, most studies with probiotics were performed in two dimensional (2D) monolayers that are grown on solid surfaces.
Artificial culture systems lack environmental features, which is not natural for cancer cells. To overcome this limitation, three dimensional (3D) culture systems have been developed7,8. Cancer cells in 3D show improvements in terms of basic biological mechanisms, such as cell viability, proliferation, morphology, cell-cell communication, drug sensitivity, and in vivo relevance9,10. Moreover, spheroids are made from multicellular types of colorectal cancer and are dependent on cell-cell interactions and the extracellular matrix (ECM)11. Our previous study has reported that probiotic cell-free supernatant (CFS) produced using Lactobacillus fermentum showed anti-cancer effects on 3D cultures of colorectal cancer (CRC) cells12. We proposed that CFS is a suitable alternative strategy for testing probiotic effects on 3D spheroids12.
Here, we present an approach that can accommodate multicellular types of 3D colorectal cancer for the analysis of therapeutic effects of probiotic cell-free supernatant (CFS) on several 3D colorectal cancer mimicry systems. This method provides a means for the analysis of related probiotic and anti-cancer effects in vitro.
1. Bacterial cell cultures and preparation of Lactobacillus cell-free supernatant (LCFS)
NOTE: Steps 1.2 – 1.9 are conducted in an anaerobic chamber.
2. Generation of spheroids
3. Treating 3D colorectal cancer cells with LCFS
4. Cell viability for spheroids
5. Quantitative real-time polymerase chain reaction analysis for spheroids
6. Western blotting from spheroids
NOTE: When collecting spheroids, use a 200 μL pipette and cut the end of the tips to avoid disturbing their structure.
7. Propidium Iodide (PI) staining of spheroids
8. FACS analysis of spheroids
We describe the protocol of obtaining spheroids from diverse colorectal cancer cell lines. Supplementation with methylcellulose was required to generate spheroids. We also present a method of LCFS preparation and present a model to study the correlation between probiotics and colorectal cancer. Spheroid formation and LCFS preparation protocols are schematically illustrated in Figure 1A,B. As shown in Figure 2A, methylcellulose concentration of 0.6% transforms the cancer cells into compact spheroids. This result indicates that spheroids can be generated from several types of colorectal cancer by using our methylcellulose protocol. Next, the spheroids were treated with 25% LCFS and the morphology was studied after 48 h using a light microscope. As shown in Figure 3A, the spheroids of the groups treated with LCFS exhibited disrupted surfaces. To investigate the anti-cancer effects of LCFS at suitable concentrations, the spheroids were treated for 48 h with various dosages of LCFS: 0 (control), 6%, 12.5%, and 25%. Disruptions in the spheroid morphology were observed in spheroids treated with 25% LCFS, as shown in Figure 3B. In addition, the spheroids were treated with 25% LCFS for 24 h and 48 h, and disruptions in spheroid morphology were observed after 48 h of treatment. Microscopic images of the spheroids are shown in Figure 3C.
After 48 h, the samples were assessed with cell viability assay, and colorectal cancer cell death was observed upon treatment with LCFS in a dose dependent manner, higher the LCFS amount higher the observed cell death (Figure 3D). We, then, stained the samples with propidium iodide (PI) to observe apoptosis. As expected, the induction of apoptosis was dependent on the LCFS dose (Figure 4A,B,C). RT-PCR was performed to detect the changes in molecular markers of apoptosis i.e., BAX, BAK and NOXA (Figure 5A,B). Lastly, apoptosis markers were studied using western blotting and Annexin V/7AAD through FACS (Figure 6A,B,C,D). These observations show that LCFS effectively induced apoptosis in the 3D model.
Figure 1: Schematic representation of spheroid formation and LCFS preparation.
(A) Schematic representation images of the LCFS generation protocol are marked by (i-iv) (B) Schematics of the methylcellulose-mediated spheroid formation are marked by (i-iii). Please click here to view a larger version of this figure.
Figure 2: Methylcellulose-mediated spheroid formation.
(A) Representative images of methylcellulose-mediated spheroid formation of HT-29, DLD1, and WiDr. Cells were seeded in ultra-low attachment 96-well round bottom plates with methylcellulose concentrations of 0.1-1.2% for 48 h. Scale bar 10 μm (n=3 for each experiment). Please click here to view a larger version of this figure.
Figure 3: Evaluation of LCFS concentration and spheroid morphology.
(A) Representative images of HT-29 treated with LCFS for 48 h. Scale bar 100 μm. (B) HT-29, DLD1, and WiDr spheroids treated with increasing doses of LCFS for 48 h. All spheroids had disrupted edges at 12.5-25% LCFS. Scale bar 20 μm (n=3 for each experiment) (C) Spheroid morphologies of HT-29, DLD1, and WiDr spheroids treated with 25% LCFS for 24 and 48 h. Scale bar 20 μm (n = 3) (D) Measured cell viability, shown as mean ± SEM. ***, P < 0.05 (n = 3 for each experiment). Please click here to view a larger version of this figure.
Figure 4: Propidium iodide staining of the spheroids.
Representative images of PI staining in (A) HT-29, (B) DLD1, and (C) WiDr spheroids after 48 h of LCFS treatment. The images were acquired using a fluorescence microscope and the increase in PI intensity was measured using Image J. Scale bar 10 μm. The mean ± SEM is shown. ***, P < 0.05 (n = 3 for each experiment). Please click here to view a larger version of this figure.
Figure 5: Apoptosis markers were identified using qRT-PCR.
Apoptosis markers, such as BAX, BAK and NOXA, were quantified. mRNA quantification is presented as a relative expression normalized to (A) β-actin and (B) 18s rRNA. The mean ± SEM is shown. ***, P < 0.05 (n=3 for each experiment). Please click here to view a larger version of this figure.
Figure 6: Apoptosis markers were determined via Western blotting and FACS analysis of the spheroids.
Shown in the figure are western blots of (A) HT-29, (B) DLD1, and (C) WiDr cells after LCFS treatment. PARP1, BCL-XL, and p-IκBα was detected. β-actin was used as an internal control. (D) FACS analysis of apoptosis in HT-29, DLD1, and WiDr spheroids incubated with LCFS. Apoptotic cells were detected by the increase in the fluorescence intensity of Annexin V-FITC. Please click here to view a larger version of this figure.
Reaction | Volume per single 20 μL |
2X qPCR mix | 10 μL |
Forward primer (10 pmols/µL) | 1 μL |
Reverse primer (10 pmols/µL) | 1 μL |
cDNA (50 ng/µL) | 1 μL |
PCR grade water | 7 μL |
Table 1: PCR reaction mixture.
Primer | Sequence |
BAX-Forward | CCCGAGAGGTCTTTTTCCGAG |
BAX-Reverse | CCAGCCCATGATGGTTCTGAT |
BAK-Forward | ATGGTCACCTTACCTCTGCAA |
BAK-Reverse | TCATAGCGTCGGTTGATGTCG |
NOXA-Forward | ACCAAGCCGGATTTGCGATT |
NOXA-Reverse | ACTTGCACTTGTTCCTCGTGG |
18s rRNA-Forward | GATGGGCGGCGGAAAATAG |
18s rRNA-Reverse | GCGTGGATTCTGCATAATGGT |
β-Actin-Forward | TCCTGTGGCATCCACGAAACT |
β-Actin-Reverse | GAAGCATTTGCGGTGGACGAT |
Table 2: Primer sequences used in qRT-PCR analysis.
Stage | Temp (ºC) | Time |
Initial denaturation | 95 | 10 min |
40 cycles: | ||
Step 1 | 95 | 15 sec |
Step 2 | 60 | 60 sec |
Melting curve stage | 95 | 15 sec |
60 | 60 sec | |
95 | 15 sec |
Table 3: qRT-PCR conditions.
Antibody | Dilution |
PARP 1 (C2-10) | 1:1000 |
BCL-XL (H-5) | 1:1000 |
p-IκBα (B-9) | 1:1000 |
β-actin (C4) | 1:1000 |
Goat Anti-Mouse IgG (H+L) | 1:2500 |
Goat Anti-Rabbit IgG (H+L) | 1:2500 |
Table 4: Antibodies used in western blot analysis.
The tissue microenvironment, including neighboring cells and the extracellular matrix (ECM), is fundamental to tissue generation and crucial in the control of cell growth and tissue development13. However, 2D cultures have several disadvantages, such as the disruption of cellular interactions, as well as alterations in cell morphology, extracellular environments, and the approach of division14. 3D cell culture systems have been rigorously studied to better reproduce in vivo effects, and have been proven as more precise systems for in vitro cancer testing15,16. There is a need for model systems to more accurately predict personalized responses to chemotherapeutics17.
3D scaffolding was developed for tissue engineering. It acts as a surrogate loss of ECM, representing the available space of tumor cells. In addition, the scaffolding provides physical interactions for cell adhesion and proliferation and causes cells to form appropriate spatial distributions and cell-ECM or cell-cell interactions18. The methylcellulose (MC) polymer has been continuously studied to determine its suitability in generating MC-based hydrogel systems for applications in 3D cell culture engineering19,20. However, the intact incorporation of these hydrogels into biomaterials like 3D cell networks remains technically challenging21. Therefore, the spheroid formation protocol presented here recommends the titration of MC concentrations and optimization with various time points for each CRC cell line. Cell line-specific characteristics, such as cell aggregation, viability, and death, can significantly affect each of the conditions we tested. This method can provide a means of generating uniform spheroids for testing LCFS on cancer cells.
Probiotics, which are beneficial bacteria, produce active metabolites that can potentially mimic anti-cancer effects. Thus, our study was designed to isolate lactic acid bacteria (LAB) and test the anti-cancer effects of their metabolic extracts from cell-free supernatants (CFS). Our studies provided a method for observing the effects of L. fermentum cell-free supernatants that induces apoptotic cell death in colorectal cancer cells in a 3D system. The mRNA levels of apoptosis markers involved in apoptotic pathways are dramatically induced after LCFS exposure in 3D conditions. Moreover, decreased levels of PARP1 and BCL-XL were expressed in the LCFS-treated 3D spheroid control compared to the control in Figure 4C,D,E. Inhibition of NF-κB activation was, also, observed in 3D cultures after treatment with LCFS. Taken all together, the advantages of culturing cells in 3D include increasing cell-cell interactions and responses to signaling molecules to better mimic in vivo systems. Western blotting using spheroids can lead to quantitative insights into the state of various signaling molecules.
Cell lines have certain limitations as preclinical models of cancer research. Recently, cancer organoids have been utilized in the modeling of personalized anti-cancer therapy22,23. The treatment of LCFS with probiotics in organoids is expected to be used as a powerful platform to test anti-cancer effects. Moreover, we only tested one of the Lactobacillus species among the various probiotics in the cancer model. Various probiotics are, also, being tested for the prevention of metabolic syndrome, immunological, and neurological disorders24,25,26. LCFS from Bifidobacterium, Saccharomyces, Streptococcus, Enterococcus, and Akkermansia species are potential candidates for the testing of health benefits through various types of disease models27,28,29.
Based on this study, it can be concluded that the understanding of signaling in spheroids and the various responses to LCFS treatment in 3D models may be beneficial for testing anti-cancer effects using the method that we proposed. Additionally, 3D cancer models can provide several advantages that are not possible with traditional 2D monolayers.
The authors have nothing to disclose.
This research was supported by the “Establishment of measurement standards for Chemistry and Radiation”, grant number KRISS-2020-GP2020-0003, and “Development of Measurement Standards and Technology for Biomaterials and Medical Convergence”, grant number KRISS-2020-GP2020-0004 programs, funded by the Korea Research Institute of Standards and Science. This research was also supported by the Ministry of Science and ICT (MSIT), National Research Foundation of Korea (NRF-2019M3A9F3065868), The Ministry of Health and Welfare (MOHW), the Korea Health Industry Development Institute (KHIDI, HI20C0558), the Ministry of Trade, Industry & Energy (MOTIE), and Korea Evaluation Institute of Industrial Technology (KEIT, 20009350). ORCID ID (Hee Min Yoo: 0000-0002-5951-2137; Dukjin Kang: 0000-0002-5924-9674; Seil Kim: 0000-0003-3465-7118; Joo-Eun Lee: 0000-0002-2495-1439; Jina Lee: 0000-0002-3661-3701). We thank Chang Woo Park for assistance with experiments.
10% Mini-PROTEAN TGX Precast Protein Gels, 15-well, 15 µl |
Biorad | 4561036 | Pkg of 10 |
Applied Biosystems MicroAmp Optical Adhesive Film | Thermo Fisher Scientific | 4311971 | 100 covers |
10x transfer buffer | Intron | IBS-BT031A | 1 L |
10X Tris-Glycine (W/SDS) | Intron | IBS-BT014 | 1 L |
Axygen 2.0 mL MaxyClear Snaplock Microcentrifuge Tube, Polypropylene, Clear, Nonsterile, 500 Tubes/Pack, 10 Packs/Case | Corning | SCT-200-C | 500 Tubes/Pack, 10 Packs/Case |
BD Difco Bacto Agar | BD | 214010 | 500 g |
BD Difco Lactobacilli MRS Broth | BD | DF0881-17-5 | 500 g |
CellTiter-Glo 3D Cell viability assay | Promega | G9681 | 100μl/assay in 96-well plates |
Complete Protease Inhibitor Cocktail | Sigma-Aldrich | 11697498001 | vial of 20 tablets |
Corning Phosphate-Buffered Saline, 1X without calcium and magnesium, PH 7.4 ± 0.1 | Corning | 21-040-CV | 500 mL |
EMD Millipore Immobilon-P PVDF Transfer Membranes | fisher Scientific | IPVH00010 | 26.5cm x 3.75m roll; Pore Size: 0.45um |
Falcon 5 mL Round Bottom Polystyrene Test Tube, with Cell Strainer Snap Cap | Corning | 352235 | 25/Pack, 500/Case |
Fetal Bovine Serum, certified, US origin | Thermo Fisher Scientific | 16000044 | 500 mL |
iScript cDNA Synthesis Kit, 25 x 20 µl rxns #1708890 | Biorad | 1708890 | 25 x 20 µL rxns |
iTaq Universal SYBR Green Supermix | Biorad | 1725121 | 5 x 1 mL |
Lactobacillus fermentum | Korean Collection for Type Cultures | KCTC 3112 | |
L-Cysteine hydrochloride monohydrate | Sigma-Aldrich | C6852-25G | 25 g |
Methyl Cellulose (3500-5600mPa·s, 2% in Water at 20°C) | TCI | M0185 | 500 g |
MicroAmp Fast Optical 96-Well Reaction Plate with Barcode, 0.1 mL | Applied Biosystems | 4346906 | 20 plates |
Millex-GS Syringe Filter Unit, 0.22 µm, mixed cellulose esters, 33 mm, ethylene oxide sterilized | Millipore | SLGS033SB | 250 |
PE Annexin V Apoptosis Detection Kit with 7-AAD | Biolegend | 640934 | 100 tests |
Penicillin-Streptomycin (10,000 U/mL) | Thermo Fisher Scientific | 15140122 | 100 mL |
Propidium Iodide | Introgen | P1304MP | 100 mg |
RIPA Lysis and Extraction Buffer | Thermo Fisher Scientific | 89901 | 250 mL |
RNeasy Mini Kit (250) | Qiagen | 74106 | 250 |
RPMI-1640 | Gibco | 11875-119 | 500 mL |
Trypsin-EDTA (0.25%), phenol red | Thermo Fisher Scientific | 25200056 | 100 mL |
Name of Materials/Equipment/Software | Company | Catalog Number | Comments/Description |
anti – p-IκBα (B-9) | Santa cruze | sc-8404 | 200 µg/mL |
anti-BclxL (H-5) | Santa cruze | sc-8392 | 200 µg/mL |
anti-PARP 1 (C2-10) | Santa cruze | sc-53643 | 50 µl ascites |
anti-β-actin (C4) | Santa cruze | sc-47778 | 200 µg/mL |
BD FACSVerse | BD Biosciences | San Diego, CA, USA | |
Synergy HTX Multi-Mode Microplate Reader | BioT | S1LFA | |
CO2 incubator | Thermo fisher | HERAcell 150i | |
Conical tube 15 ml | SPL | 50015 | |
Conical tube 50 ml | SPL | 50050 | |
Corning Costar Ultra-Low Attachment Multiple Well Plate | Sigma-Aldrich | CLS7007 | |
Corning Costar Ultra-Low Attachment Multiple Well Plate | Sigma-Aldrich | CLS3471 | |
Costar 50 mL Reagent Reservoirs, 5/Bag, Sterile | Costar | 4870 | |
Countess Cell Counting Chamber Slides | Thermofisher | C10228 | |
Countess II FL Automated Cell Counter | invitrogen | AMQAF1000 | |
EnSpire Multimode Reader | Perkin Elmer | Enspire 2300 | |
Eppendorf Research Plus Multi Channel Pipette, 8-channel | Eppendorf | 3122000051 | |
FlowJo software | TreeStar | Ashland, OR, USA | |
Goat Anti-Mouse IgG (H+L) | Jackson immunoresearch | 115-035-062 | 1.5 mL |
Goat Anti-Rabbit IgG (H+L) | Jackson immunoresearch | 111-035-144 | 2.0 mL |
GraphPad Prism 5 | GraphPad Software | Inc., San Diego, CA, USA | |
ImageJ | NIH | ||
ImageQuant LAS 4000 mini | Fujifilm | Tokyo, Japan | |
Incubated shaker | Lab companion | SIF-6000R | |
Multi Gauge Ver. 3.0, | Fujifilm | Tokyo, Japan | |
Optical density (OD)LAMBDA UV/Vis Spectrophotometers | Perkin Elmer | Waltham, MA, USA | |
Phase-contrast microscope | Olympus | Tokyo, Japan | |
SPL microcentrifuge tube 1.5mL | SPL | 60015 | |
SPL Multi Channel Reservoirs, 12-Chs, PS, Sterile | SPL | 21012 | |
StepOnePlus Real-Time PCR system | Thermo Fisher Scientific | Waltham, MA, USA | |
Vibra-Cell Ultrasonic Liquid Processors | SONICS-vibra cell | VC 505 | 500 Watt ultrasonic processor |
Vinyl Anaerobic Chamber | COY LAB PRODUCTS |