레트로 바이러스 스캐닝 : MLV 통합 사이트 맵핑으로 세포 특정 규제 지역 정의
Summary
여기, 우리는 인간 세포에서 Moloney 뮤린 백혈병 바이러스 기반의 레트로 바이러스 벡터의 통합 사이트의 게놈 전체 매핑을위한 프로토콜을 설명합니다.
Abstract
Moloney murine leukemia (MLV) 바이러스 기반 레트로 바이러스 벡터는 주로 아세틸 화 된 인핸서와 프로모터에 통합됩니다. 이러한 이유로 mLV 통합 사이트는 능동적 인 규제 요소의 기능적 표지자로 사용될 수 있습니다. 여기에 우리는 세포 특이 적 인핸서 (enhancer)와 프로모터 (promoter)에 대한 게놈 차원의 식별을 가능하게하는 레트로 바이러스 스캐닝 도구를 제시한다. 간단히 말해, 표적 세포 집단은 mLV 유래 벡터로 형질 도입되고 게놈 DNA는 절단 제한 효소로 절단된다. 호환 DNA 링커와 게놈 조각의 연결 후, 링커 중재 폴리머 라제 연쇄 반응 (LM-PCR)은 바이러스 – 호스트 게놈 교차점의 증폭을 허용합니다. amplicons의 대규모 시퀀싱은 게놈 전체 mLV 통합 프로필을 정의하는 데 사용됩니다. 마지막으로, 반복적 통합의 클러스터는 세포 유형 특이적인 전사 프로그램의 활성화를 담당하는 세포 특이 적 조절 영역을 확인하기 위해 정의된다.
<p class= "jove_content"> 레트로 바이러스 스캐닝 도구는 전향 적으로 격리 된 표적 세포 집단에서 세포 특이 적 프로모터 및 인핸서의 게놈 전체 식별을 허용합니다. 주목할 만하게, retroviral 스캐닝은 예비 고립을위한 튼튼한 감적이없는 희소 한 인구 ( 예를 들면 체세포 줄기 세포)의 회고 확인을위한 도구 기술을 대표한다.Introduction
세포 동일성은 특정 유전자 세트의 발현에 의해 결정됩니다. 프로모터 및 인핸서와 같은 시스 조절 요소의 역할은 세포 유형 특이 적 전사 프로그램의 활성화에 결정적이다. 이러한 조절 부위는 특이적인 히스톤 변형, 전사 인자 및 보조 인자 결합, 염색질 접근성과 같은 특이적인 염색질 특징을 특징으로하는데, 이는 여러 세포 유형 1 , 2 , 3 에서 게놈 전체의 식별을 위해 널리 사용되어왔다. 특히 히스톤 H3 라이신 27 (H3K27ac)의 게놈 전체 프로파일은 활성 프로모터, 인핸서 및 슈퍼 인핸서 4 , 5 , 6 을 정의하는 데 일반적으로 사용됩니다.
Moloney murine leukemia virus (MLV)는 유전자에 널리 사용되는 감마 – 레트로 바이러스입니다포유 동물 세포에서 전달. 표적 세포를 감염시킨 후 retroviral RNA genome은 pre-integration complex (PIC)를 조립하기 위해 바이러스 및 세포 단백질에 결합하는 이중 가닥의 DNA 분자에서 역전사된다. PIC는 핵을 입력하고 숙주 세포 염색질을 바인딩합니다. 여기에서 중요한 PIC 성분 인 바이러스 인테그라 아제 (viral integrase)는 프로 바이러스 DNA의 숙주 세포 게놈으로의 통합을 매개한다. 게놈 DNA에서의 mLV 통합은 무작위 적이 지 않지만 세포 특이적인 방식으로 활성 cis 조절 요소, 예를 들어 프로모터 및 인핸서에서 일어난다 7 , 8 , 9 , 10 . 이 특이 적 통합 프로파일은 mLV integrase와 세포 bromodomain 및 외쪽 끝 도메인 (BET) 단백질 11 , 12 , 13 사이의 직접적인 상호 작용에 의해 매개됩니다. BET 단백질 (BRD2, BRD3 및BRD4)는 숙주 염색질과 mLV PIC 사이의 가교 역할을한다. 브롬 도메인을 통해 고도로 아세틸 화 된 시스 조절 영역을 인식하고 외측 말단 도메인은 mLV 인테그라 아제 11 , 12 , 13 과 상호 작용한다.
여기에서, 우리는 mLV의 통합 특성에 기초하여 활성 cis- 조절 영역을 매핑하는 새로운 도구 인 레트로 바이러스 스캐닝을 기술한다. 간략하게, 세포는 강화 된 녹색 형광 단백질 (eGFP) 리포터 유전자를 발현하는 mLV 유래 레트로 바이러스 벡터로 형질 도입된다. 게놈 DNA 추출 후, mLV 벡터의 3 '긴 말단 반복 (LTR)과 게놈 DNA 간의 연결 부위는 링커 매개 PCR (LM-PCR)에 의해 증폭되고 대량으로 서열 분석된다. mLV 통합 사이트는 인간 게놈에 매핑되며 mLV에 의해 표적화되는 게놈 영역은 mLV 통합 사이트의 클러스터로 정의됩니다.
레트로 바이러스 검사ning은 여러 인간의 일차 세포에서 세포 특이 적 활성 조절 요소를 정의하는 데 사용되었습니다 14 , 15 . mLV 클러스터는 후생 적으로 정의 된 프로모터 및 인핸서와 함께 매핑되었으며, 대부분은 H3K27ac과 같은 활성 히스톤 마커를 가지며 세포 특이 적이었다. 레트로 바이러스 스캐닝은 전향 적으로 정제 된 세포 집단 7,14뿐 아니라 예비 격리 15 에 효과적인 마커가없는 케라틴 틴틴 줄기 세포와 같은 후 향적으로 정의 된 세포 집단에서 DNA 조절 요소의 게놈 전체 식별을 허용합니다.
Protocol
Representative Results
Discussion
여기에서 우리는 염색질 부위를 표적으로하는 레트로 바이러스 인 mLV의 통합 사이트의 게놈 – 전체 매핑을위한 프로토콜을 설명했으며, 활성 프로모터 및 인핸서로 후생적으로 표시했습니다. 프로토콜의 중요한 단계 및 / 또는 한계는 다음을 포함합니다 : (i) 표적 세포 집단의 mLV 형질 도입; (ii) LM-PCR에 의한 바이러스 – 숙주 접합부의 증폭; (iii) 통합 사이트의 높은 비율의 검색. mLV- 기반 레트로 ?…
Disclosures
The authors have nothing to disclose.
Acknowledgements
이 연구는 이탈리아 교육, 대학 및 연구부 (FIRB-Futuro in Ricerca 2010-RBFR10OS4G, FIRB-Futuro in Ricerca 2012-RBFR126B8I_003)의 유럽 연구위원회 (ERC-2010-AdG, GT-SKIN) , EPIGEN Epigenomics 대표 프로젝트), 이탈리아 보건부 (젊은 연구자는 2011 GR-2011-02352026) 및 Imagine Institute Foundation (프랑스, 파리).
Materials
| PBS, pH 7.4 | ThermoScientific | 10010031 | or equivalent |
| Fetal Bovine Serum | ThermoScientific | 16000044 | or equivalent |
| 0.2 ml tubes | general lab supplier | ||
| 1.5 ml tubes | general lab supplier | ||
| QIAGEN QIAmp DNA mini Kit | QIAGEN | 51306 | or equivalent |
| T4 DNA ligase | New England BioLabs | M0202T | |
| T4 DNA Ligase Reaction buffer | New England BioLabs | M0202T | |
| Linker Plus Strand oligonucleotide | general lab supplier | 5’-PO4-TAGTCCCTTAAGCGGAG-3’ (Purification grade: SDS-PAGE) | |
| Linker Minus Strand oligonucleotide | general lab supplier | 5’-GTAATACGACTCACTATAGGGCTCCGCTTAAGGGAC-3’ (Purification grade: SDS-PAGE) | |
| Tru9I | Roche-Sigma-Aldrich | 11464825001 | |
| SuRE/Cut Buffer M | Roche-Sigma-Aldrich | 11417983001 | |
| PstI | Roche-Sigma-Aldrich | 10798991001 | |
| SuRE/Cut Buffer H | Roche-Sigma-Aldrich | 11417991001 | |
| Platinum Taq DNA Polimerase High Fidelity | Invitrogen | 11304011 | |
| 10mM dNTP Mix | Invitrogen | 18427013 | or equivalent |
| PCR grade water | general lab supplier | ||
| 96-well thermal cycler (with heated lid) | general lab supplier | ||
| linker primer | general lab supplier | 5’-GTAATACGACTCACTATAGGGC-3’ (Purification grade: PCR grade) | |
| MLV-3’ LTR primer | general lab supplier | 5’-GACTTGTGGTCTCGCTGTTCCTTGG-3’ (Purification grade: PCR grade) | |
| linker nested primer 454 | general lab supplier | 5’-GCCTTGCCAGCCCGCTCAG[AGGGCTCCGCTTAAGGGAC](Purification grade: SDS-PAGE) | |
| MLV-3’ LTR nested primer 454 | general lab supplier | 5’-GCCTCCCTCGCGCCATCAGTAGC[GGTCTCCTCTGAGTGATTGACTACC](Purification grade: SDS-PAGE) | |
| linker nested primer Illumina | general lab supplier | 5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-[AGGGCTCCGCTTAAGGGAC](Purification grade: SDS-PAGE) | |
| MLV-3’ LTR nested primer Illumina | general lab supplier | 5'-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-[GGTCTCCTCTGAGTGATTGACTACC](Purification grade: SDS-PAGE) | |
| Sodium Acetate Solution (3M) pH 5.2 | general lab supplier | ||
| Ethanol (absolute) for molecular biology | Sigma-Aldrich | E7023 | or equivalent |
| Topo TA Cloning kit (with pCR2.1-TOPO vector) | Invitrogen | K4500-01 | |
| QIAquick Gel Extraction kit | QIAGEN | 28704 | |
| Agarose | Sigma-Aldrich | A9539 | or equivalent |
| Ethidium bromide | Sigma-Aldrich | E1510 | or equivalent |
| 100 bp DNA ladder | Invitrogen | 15628019 | or equivalent |
| 6X Loading Buffer | ThermoScientific | R0611 | or equivalent |
| NanoDrop 2000 UV-Vis Spectrophotometer | ThermoScientific | ND-2000 | |
| Nextera XT Index kit | Illumina | FC-131-1001 or FC-131-1002 | |
| 2x KAPA HiFi Hot Start Ready Mix | KAPA Biosystems | KK2601 | |
| Dynal magnetic stand for 2 ml tubes | Invitrogen | 12321D | or equivalent |
| Agencourt AMPure XP 60 ml kit | Beckman Coulter Genomics | A63881 | |
| Tris-HCl 10 mM, pH 8.5 | general lab supplier | ||
| Agilent 2200 TapeStation system | Agilent Technologies | G2964AA | or equivalent |
| D1000 ScreenTape | Agilent Technologies | 5067-5582 | or equivalent |
| D1000 Reagents | Agilent Technologies | 5067-5583 | or equivalent |
| KAPA Library Quantification Kit for Illumina platforms (ABI Prism) | KAPA Biosystems | KK4835 | |
| ABI Prism 7900HT Fast Real-Time PCR System | Applied Biosystems | 4329003 | |
| NaOH 1.0 N, molecular biology-grade | general lab supplier | ||
| HT1 (Hybridization Buffer) | Illumina | Provided in the MiSeq Reagent Kit | |
| MiSeq Reagent Kit v3 (150 cycles) | Illumina | MS-102-3001 | |
| MiSeq System | Illumina | SY-410-1003 | |
| PhiX Control v3 | Illumina | FC-110-3001 |
References
- Ernst, J., et al. Mapping and analysis of chromatin state dynamics in nine human cell types. Nature. 473 (7345), 43-49 (2011).
- Shlyueva, D., Stampfel, G., Stark, A. Transcriptional enhancers: from properties to genome-wide predictions. Nat Rev Genet. 15 (4), 272-286 (2014).
- Roadmap Epigenomics Consortium. Integrative analysis of 111 reference human epigenomes. Nature. 518 (7539), 317-330 (2015).
- Heintzman, N. D., et al. Histone modifications at human enhancers reflect global cell-type-specific gene expression. Nature. 459 (7243), 108-112 (2009).
- Creyghton, M. P., et al. Histone H3K27ac separates active from poised enhancers and predicts developmental state. Proc Natl Acad Sci U S A. 107 (50), 21931-21936 (2010).
- Hnisz, D., et al. Super-enhancers in the control of cell identity and disease. Cell. 155 (4), 934-947 (2013).
- Cattoglio, C., et al. High-definition mapping of retroviral integration sites identifies active regulatory elements in human multipotent hematopoietic progenitors. Blood. 116 (25), 5507-5517 (2010).
- Biasco, L., et al. Integration profile of retroviral vector in gene therapy treated patients is cell-specific according to gene expression and chromatin conformation of target cell. EMBO Mol Med. 3 (2), 89-101 (2011).
- De Ravin, S. S., et al. Enhancers are major targets for murine leukemia virus vector integration. J Virol. 88 (8), 4504-4513 (2014).
- LaFave, M. C., et al. mLV integration site selection is driven by strong enhancers and active promoters. Nucleic Acids Res. 42 (7), 4257-4269 (2014).
- Gupta, S. S., et al. Bromo- and extraterminal domain chromatin regulators serve as cofactors for murine leukemia virus integration. J Virol. 87 (23), 12721-12736 (2013).
- Sharma, A., et al. BET proteins promote efficient murine leukemia virus integration at transcription start sites. Proc Natl Acad Sci U S A. 110 (29), 12036-12041 (2013).
- De Rijck, J., et al. The BET family of proteins targets moloney murine leukemia virus integration near transcription start sites. Cell reports. 5 (4), 886-894 (2013).
- Romano, O., et al. Transcriptional, epigenetic and retroviral signatures identify regulatory regions involved in hematopoietic lineage commitment. Sci Rep. 6, 24724 (2016).
- Cavazza, A., et al. Dynamic Transcriptional and Epigenetic Regulation of Human Epidermal Keratinocyte Differentiation. Stem Cell Reports. 6 (4), 618-632 (2016).
- Miller, A. D., Law, M. F., Verma, I. M. Generation of helper-free amphotropic retroviruses that transduce a dominant-acting, methotrexate-resistant dihydrofolate reductase gene. Mol Cell Biol. 5 (3), 431-437 (1985).
- Cattoglio, C., et al. High-definition mapping of retroviral integration sites defines the fate of allogeneic T cells after donor lymphocyte infusion. PLoS One. 5 (12), e15688 (2010).
- Aiuti, A., et al. Lentiviral hematopoietic stem cell gene therapy in patients with Wiskott-Aldrich syndrome. Science. 341 (6148), 1233151 (2013).
- Biffi, A., et al. Lentiviral hematopoietic stem cell gene therapy benefits metachromatic leukodystrophy. Science. 341 (6148), 1233158 (2013).
- Gabriel, R., et al. Comprehensive genomic access to vector integration in clinical gene therapy. Nat Med. 15 (12), 1431-1436 (2009).
- Gillet, N. A., et al. The host genomic environment of the provirus determines the abundance of HTLV-1-infected T-cell clones. Blood. 117 (11), 3113-3122 (2011).
