Een pijplijn om de structuren en signaalroutes van sfingosine-1-fosfaatreceptoren te onderzoeken
Summary
S1P oefent zijn diverse fysiologische effecten uit via de S1P-receptoren (S1PR’s) subfamilie. Hier wordt een pijplijn beschreven om de structuren en functie van S1PR’s uit te leggen.
Abstract
Lysofosfolipiden (LPL’s) zijn bioactieve lipiden die sfingosine-1-fosfaat (S1P), lysofosfatidisch zuur, enz. Omvatten. S1P, een metabolisch product van sfingolipiden in het celmembraan, is een van de best gekarakteriseerde LPL’s die een verscheidenheid aan cellulaire fysiologische reacties reguleert via signaalroutes gemedieerd door sfingosine 1-fosfaatreceptoren (S1PR’s). Dit impliceerde dat het S1P-S1PR-signaleringssysteem een opmerkelijk potentieel therapeutisch doelwit is voor aandoeningen, waaronder multiple sclerose (MS), auto-immuunziekten, kanker, ontsteking en zelfs COVID-19. S1PR’s, een kleine subset van de klasse A G-eiwit gekoppelde receptor (GPCR) familie, zijn samengesteld uit vijf subtypen: S1PR1, S1PR2, S1PR3, S1PR4 en S1PR5. Het gebrek aan gedetailleerde structurele informatie belemmert echter de ontdekking van geneesmiddelen gericht op S1PR’s. Hier pasten we de cryo-elektronenmicroscopiemethode toe om de structuur van het S1P-S1PR-complex op te lossen en het mechanisme van activering, selectieve medicijnherkenning en G-eiwitkoppeling op te helderen met behulp van celgebaseerde functionele assays. Andere lysofosfolipidereceptoren (LPLRs) en GPCR’s kunnen ook worden bestudeerd met behulp van deze strategie.
Introduction
Sfingosine-1-fosfaat (S1P), een metabolisch product van sfingolipiden in het celmembraan, is een alomtegenwoordig lysofosfatidisch signaalmolecuul dat verschillende biologische activiteiten omvat, waaronder lymfocytenhandel, vasculaire ontwikkeling, endotheelintegriteit en hartslag 1,2,3. S1P oefent zijn diverse fysiologische effecten uit via vijf S1P-receptorsubtypen (S1PR’s 1-5); S1PR’s worden aangetroffen in een verscheidenheid aan weefsels en vertonen unieke voorkeuren voor downstream G-eiwitten 4,5. S1PR1 is voornamelijk gekoppeld aan het Gi-eiwit, dat vervolgens de cAMP-productie remt; S1PR2 en S1PR3 zijn gekoppeld aan Gi, Gq en G12/13, en S1PR4 en S1PR5 transduce signaal via Gi en G12/136.
S1P-S1PR-signalering is een cruciaal therapeutisch doelwit voor meerdere ziekten, waaronder auto-immuunziekten7, ontsteking8, kanker9 en zelfs COVID-1910. In 2010 werd fingolimod (FTY720) gelicentieerd als een eersteklas medicijn gericht op S1PR’s voor de behandeling van recidief multiple sclerose (MS)11. Het is echter in staat om zich te binden aan alle S1PRRs behalve S1PR2, terwijl niet-specifieke binding aan S1PR3 resulteert in oedeem van de hersenschors, vasculaire en bronchiale vernauwing en longepitheellekkage12. Als alternatieve strategie voor het verhogen van de therapeutische selectiviteit zijn subtype-specifieke liganden voor de receptor geproduceerd. Siponimod (BAF312) werd in 2019 goedgekeurd voor de recidief MS behandeling13; het richt zich effectief op S1PR1 en S1PR5, terwijl het geen affiniteit heeft met S1PR3 en minder bijwerkingen vertoont in de klinische praktijk14. In 2020 heeft de Amerikaanse Food and Drug Administration ozanimod goedgekeurd voor MS-therapie15. Er is gemeld dat ozanimod een 25-voudig grotere selectiviteit heeft voor S1PR1 dan voor S1PR516. Met name in de context van de huidige COVID-19-pandemie is ontdekt dat agonisten die gericht zijn op S1PR’s kunnen worden gebruikt om COVID-19 te behandelen met behulp van immunomodulerende therapietechnieken17. In vergelijking met fingolimod heeft de ozanimod superioriteit getoond in het verlagen van de symptomen bij COVID-19-patiënten en ondergaat nu klinische onderzoeken10. Inzicht in de structurele basis en functie van S1PR’s legt een belangrijke basis voor het ontwikkelen van een medicijn dat zich selectief richt op S1PR’s18.
Veel technieken worden gebruikt om de structurele informatie van biomacromolecules te onderzoeken, waaronder röntgenkristallografie, nucleaire magnetische resonantie (NMR) en elektronenmicroscopie (EM). Vanaf maart 2022 zijn er meer dan 180.000 structuren gedeponeerd op de Protein Databank (PDB), en de meeste daarvan zijn opgelost door röntgenkristallografie. Echter, met de eerste bijna-atomaire resolutiestructuur van TPRV1 (3,4 Å-resolutie) gerapporteerd door Yifan Cheng en David Julius in 201319, is cryo-elektronenmicroscopie (cryo-EM) een mainstream techniek geworden voor eiwitstructuren, en het totale aantal EM PDB-structuren was meer dan 10.000. De kritieke doorbraakgebieden zijn de ontwikkeling van nieuwe camera’s voor beeldvorming die bekend staan als directe elektronendetectiecamera’s en nieuwe beeldverwerkingsalgoritmen. Cryo-EM heeft in het afgelopen decennium een revolutie teweeggebracht in de structuurbiologie en op structuur gebaseerde geneesmiddelenontdekking20. Omdat het begrijpen hoe macromoleculaire complexen hun gecompliceerde rollen in de levende cel vervullen een centraal thema is in de biologische wetenschappen, heeft cryo-EM het potentieel om conformaties van dynamische moleculaire complexen te onthullen, met name voor transmembraaneiwitten21. G-eiwit gekoppelde receptoren (GPCR’s) zijn de grootste superfamilie van transmembraaneiwitten en de doelen van meer dan 30% van de momenteel op de markt gebrachte geneesmiddelen22. De ontwikkeling van cryo-EM heeft bijgedragen aan een uitbarsting van hoge-resolutie structuren van GPCR-G eiwitcomplexen, waardoor structurele bepaling mogelijk is voor ‘hardnekkige’ doelen die nog steeds niet toegankelijk zijn voor röntgenkristallografische analyse in medicijnontwerp23. Daarom biedt de cryo-EM-toepassing een kans om de driedimensionale structuur van GPCR’s te bepalen in bijna-inheemse omstandigheden bij bijna atomaire resolutie24. Vooruitgang in cryo-EM maakt het mogelijk om mechanistische onderbouwing van GPCR-stimulatie of -remming te visualiseren, en verder voordeel bij het ontdekken van de nieuwe bindingsplaatsen voor GPCR-gerichte medicijncreatie25.
Vertrouwend op de enorme vooruitgang van cryo-EM-technologie, hebben we structuren van gekwelde S1PR1-, S1PR3- en S1PR5-Gi-signaleringscomplexen geïdentificeerd die onlangs26,27 zijn. Bij mensen worden S1PR’s gevonden in verschillende weefsels en vertonen ze unieke voorkeuren voor downstream G-eiwitten 4,5. S1PR1 wordt voornamelijk gekoppeld aan het Gi-eiwit, dat vervolgens de productie van 3′,5′-cyclisch adenosinemonofosfaat (cAMP) remt. S1PR3 en S1PR5 kunnen ook worden gekoppeld aan Gi 6,28. Omdat Gi-gekoppelde receptoractivering de productie van cAMP29 vermindert, werd een Gi-inhibitie cAMP-test geïntroduceerd om cAMP-remmingseffecten te meten voor het vastleggen van functionele veranderingen26,27. Met behulp van een gemuteerde versie van Photinus pyralis luciferase waarin een cAMP-bindende eiwitgroep is ingebracht, biedt deze cAMP-test een eenvoudige en betrouwbare methode voor het monitoren van GPCR-activiteit door veranderingen in intracellulaire cAMP-concentratie30. Het is een gevoelige en niet-radioactieve functionele test en kan worden toegepast om de real-time downstream signalering van een breed scala aan GPCR’s te monitoren voor het ontdekken van geneesmiddelen31.
Hier wordt een samenvatting gegeven van de kritieke methoden voor het oplossen van de activerings- en medicijnherkenningsmodi van S1PR’s, voornamelijk inclusief cryo-EM-manipulaties en een Gi-inhibition cAMP-test. Dit artikel is bedoeld als uitgebreide experimentele leidraad voor verdere verkenningen van de structuren en functies van GPCR’s.
Protocol
Representative Results
Discussion
Dit protocol beschrijft een primaire pijplijn voor het bepalen van de structuren van S1PR’s door cryo-EM en het meten van de activeringspotentie van S1PR’s door Gi-gemedieerde cAMP-remmingstest. Sommige stappen zijn cruciaal voor het succes van het experiment.
Om het S1PR-Gi-complex te zuiveren, moet meer aandacht worden besteed aan de kwaliteit van het virus en de gezondheid van sf9-cellen . De expressie van de receptor is dramatisch verminderd in arme sf9-cellen . De gezond…
Offenlegungen
The authors have nothing to disclose.
Acknowledgements
De gegevens van het S1PR-Gi-complex werden geoogst in het West China Cryo-EM Center in Sichuan University en Cryo-EM Center in de Southern University of Science and Technology (SUSTech) en verwerkt in het Duyu High-Performance Computing Center in Sichuan University. Dit werk werd ondersteund door de Natural Science Foundation of China (32100965 tot L.C., 32100988 tot W.Y., 31972916 tot Z.S.) en het fulltime Postdoctoraal Onderzoeksfonds van Sichuan University (2021SCU12003 tot L.C.)
Materials
| 0.05% trypsin-EDTA | GIBCO | Cat# 25300054 | |
| 0.22 µM filter | Thermo Fisher Scientific | Cat# 42213-PS | |
| 100 kDa cut-off concentrator | Thermo Fisher Scientific | Cat# 88533 | |
| 6-well plate | Corning | Cat# 43016 | |
| 96-well plate | Corning | Cat# 3917 | |
| Aprotinin | Sigma-Aldrich | Cat# 9087-70-1 | |
| Apyrase | NEB | Cat# M0398S | |
| Baculovirus transfection reagent | Thermo Fisher Scientific | Cat# 10362100 | For the preparation of P0 baculovirus |
| Benzamidine | Sigma-Aldrich | Cat# B6506 | |
| CHO-K1 | ATCC | N/A | |
| CHS | Sigma-Aldrich | Cat# C6512 | |
| CryoSPARC | Punjani, A., et al.,2017 | https://cryosparc.com/ | |
| DH5α competent E.coli | Thermo Fisher Scientific | Cat# EC0112 | |
| D-Luciferin-Potassium Salt | Sigma- Aldrich | Cat# 50227 | |
| DMSO | Sigma- Aldrich | Cat# D2438 | |
| EDTA | Thermo Fisher Scientific | Cat# S311-500 | |
| ESF921 cell culture medium | Expression Systems | Cat# 96-001 | |
| Excel | microsoft | N/A | |
| F12 medium | Invitrogen | Cat# 11765 | |
| FBS | Cell Box | Cat# SAG-01U-02 | |
| Flag resin | Sigma- Aldrich | Cat# A4596 | |
| Forskolin | APExBIO | Cat# B1421 | |
| Gctf | Zhang, 2016 | https://www.mrc-lmb.cam.ac.uk/kzhang/Gctf/ | |
| GDN | Anatrace | Cat# GDN101 | |
| Gel filtration column | GE healthcare | Cat# 28990944 | |
| Gen5 3.11 | BIO-TEK | N/A | |
| Gentamicin | Solarbio | Cat# L1312 | |
| GloSensor cAMP assay kit | Promega | Cat# E1291 | Gi-inhibition cAMP assay kit |
| GloSensor plasmid | Promega | Cat# E2301 | Sensor plasmid |
| Grace’s medium | GIBCO | Cat# 11595030 | |
| GraphPad Prism 8 | Graphpad | N/A | |
| HBSS | Thermo Fisher Scientific | Cat# 88284 | |
| HEPES | Sigma- Aldrich | Cat# H4034 | |
| jetPRIME Reagent | Polyplus Transfection | Cat# 114-15 | transfection reagent |
| Janamycin | Solarbio | Cat# K1030 | |
| LB medium | Invitrogen | Cat# 12780052 | |
| Leupeptin | Sigma-Aldrich | Cat# L2884 | |
| LMNG | Anatrace | Cat# NG310 | |
| MotionCor2 | (Zheng et al., 2017) | https://emcore.ucsf.edu/ucsf-software | |
| NanoCab | Thermo Fisher Scientific | Cat# 1121822 | |
| PBS | Invitrogen | Cat# 14190-144 | |
| pcDNA3.1-HA-FLAG-S1PRs | GenScript | N/A | |
| pFastBac1-Gαi | GenScript | N/A | |
| pFastBac1-HA-FLAG-T4L-S1PRs-His10 | GenScript | N/A | |
| pFastBacdual-Gβ1γ2 | GenScript | N/A | |
| PureLink HiPure Plasmid Miniprep Kit | Invitrogen | Cat# K210003 | For the preparation of plasmids and P0 baculovirus |
| Q5 site-Directed Mutagenesis kit | NEB | Cat# E0554S | For the preparation of plasmids |
| Quantifoil | Quantifoil | Cat# 251448 | |
| RELION-3.1 | (Zivanov et al., 2018) | https://www2.mrc-lmb.cam.ac.uk/relion | |
| S1PRs cDNA | addgene | N/A | |
| scFv16 | Invitrogen | Cat# 703976 | |
| Sf9 | Expression Systems | N/A | |
| Siponimod | Selleck | Cat# S7179 | |
| sodium cholate | Sigma-Aldrich | Cat# C1254 | |
| Synergy H1 microplate reader | BIO-TEK | N/A | |
| Synthetic T4L DNA (sequence) | N/A | N/A | Aacatcttcgagatgctgcgcatcgacgaagg cctgcgtctcaagatttacaagaataccgaagg ttattacacgattggcatcggccacctcctgaca aagagcccatcactcaacgctgccaagtctga actggacaaagccattggtcgcaacaccaac ggtgtcattacaaaggacgaggcggagaaac tcttcaaccaagatgtagatgcggctgtccgtgg catcctgcgtaatgccaagttgaagcccgtgt atgactcccttgatgctgttcgccgtgcagcctt gatcaacatggttttccaaatgggtgagaccgg agtggctggttttacgaactccctgcgcatgctcc agcagaagcgctgggacgaggccgcagtga atttggctaaatctcgctggtacaatcagacacc taaccgtgccaagcgtgtcatcactaccttccg tactggaacttgggacgcttac |
| TCEP | Thermo Fisher Scientific | Cat# 77720 | |
| Tetracycline | Solarbio | Cat# T8180 | |
| Vitrobot Mark IV | Thermo Fisher Scientific | N/A |
Referenzen
- Verstockt, B., et al. Sphingosine 1-phosphate modulation and immune cell trafficking in inflammatory bowel disease. Nature Reviews: Gastroenterology & Hepatology. , 1-16 (2022).
- Rosen, H., Stevens, R. C., Hanson, M., Roberts, E., Oldstone, M. B. Sphingosine-1-phosphate and its receptors: structure, signaling, and influence. Annual Review of Biochemistry. 82, 637-662 (2013).
- Cartier, A., Hla, T. Sphingosine 1-phosphate: Lipid signaling in pathology and therapy. Science. 366 (6463), 5551 (2019).
- Jozefczuk, E., Guzik, T. J., Siedlinski, M. Significance of sphingosine-1-phosphate in cardiovascular physiology and pathology. Pharmacological Research. 156, 104793 (2020).
- Kihara, Y., Maceyka, M., Spiegel, S., Chun, J. Lysophospholipid receptor nomenclature review: IUPHAR Review 8. British Journal of Pharmacology. 171 (15), 3575-3594 (2014).
- Bryan, A. M., Del Poeta, M. Sphingosine-1-phosphate receptors and innate immunity. Cellular Microbiology. 20 (5), 12836 (2018).
- Pelletier, D., Hafler, D. A. Fingolimod for multiple sclerosis. New England Journal of Medicine. 366 (4), 339-347 (2012).
- Obinata, H., Hla, T. Sphingosine 1-phosphate and inflammation. International Immunology. 31 (9), 617-625 (2019).
- Pyne, N. J., Pyne, S. Sphingosine 1-phosphate and cancer. Nature Reviews: Cancer. 10 (7), 489-503 (2010).
- Abu-Farha, M., et al. The role of lipid metabolism in COVID-19 virus infection and as a drug target. International Journal of Molecular Sciences. 21 (10), 3544 (2020).
- Chun, J., Kihara, Y., Jonnalagadda, D., Blaho, V. A. Fingolimod: lessons learned and new opportunities for treating Multiple Sclerosis and other disorders. Annual Review of Pharmacology and Toxicology. 59, 149-170 (2019).
- Murakami, A., et al. Sphingosine 1-phosphate (S1P) regulates vascular contraction via S1P3 receptor: investigation based on a new S1P3 receptor antagonist. Molecular Pharmacology. 77 (4), 704-713 (2010).
- Cao, L., et al. Siponimod for multiple sclerosis. Cochrane Database of Systematic Reviews. 11, (2021).
- Scott, L. J. Siponimod: a review in secondary progressive Multiple Sclerosis. CNS Drugs. 34 (11), 1191-1200 (2020).
- Lamb, Y. N. Ozanimod: first approval. Drugs. 80 (8), 841-848 (2020).
- Scott, F. L., et al. Ozanimod (RPC1063) is a potent sphingosine-1-phosphate receptor-1 (S1P1) and receptor-5 (S1P5) agonist with autoimmune disease-modifying activity. British Journal of Pharmacology. 173 (11), 1778-1792 (2016).
- McGowan, E. M., Haddadi, N., Nassif, N. T., Lin, Y. Targeting the SphK-S1P-SIPR pathway as a potential therapeutic approach for COVID-19. International Journal of Molecular Sciences. 21 (19), 7189 (2020).
- O’Sullivan, C., Dev, K. K. The structure and function of the S1P1 receptor. Trends in Pharmacological Sciences. 34 (7), 401-412 (2013).
- Liao, M., Cao, E., Julius, D., Cheng, Y. Structure of the TRPV1 ion channel determined by electron cryo-microscopy. Nature. 504 (7478), 107-112 (2013).
- Bai, X. C., McMullan, G., Scheres, S. H. How cryo-EM is revolutionizing structural biology. Trends in Biochemical Sciences. 40 (1), 49-57 (2015).
- Murata, K., Wolf, M. Cryo-electron microscopy for structural analysis of dynamic biological macromolecules. Biochimica et Biophysica Acta General Subjects. 1862 (2), 324-334 (2018).
- Zhang, M., et al. Cryo-EM structure of an activated GPCR-G protein complex in lipid nanodiscs. Nature Structural & Molecular Biology. 28 (3), 258-267 (2021).
- Renaud, J. P., et al. Cryo-EM in drug discovery: achievements, limitations and prospects. Nature Reviews: Drug Discovery. 17 (7), 471-492 (2018).
- Ishchenko, A., Gati, C., Cherezov, V. Structural biology of G protein-coupled receptors: new opportunities from XFELs and cryoEM. Current Opinion in Structural Biology. 51, 44-52 (2018).
- Yang, D., et al. G protein-coupled receptors: structure- and function-based drug discovery. Signal Transduction and Targeted Therapy. 6 (1), 7 (2021).
- Yuan, Y., et al. Structures of signaling complexes of lipid receptors S1PR1 and S1PR5 reveal mechanisms of activation and drug recognition. Cell Research. 31 (12), 1263-1274 (2021).
- Zhao, C., et al. Structural insights into sphingosine-1-phosphate recognition and ligand selectivity of S1PR3-Gi signaling complexes. Cell Research. 32 (2), 218-221 (2022).
- Xu, Z., et al. Structural basis of sphingosine-1-phosphate receptor 1 activation and biased agonism. Nature Chemical Biology. 18, 281-288 (2022).
- Liu, Y. F., Ghahremani, M. H., Rasenick, M. M., Jakobs, K. H., Albert, P. R. Stimulation of cAMP synthesis by Gi-coupled receptors upon ablation of distinct Galphai protein expression. Gi subtype specificity of the 5-HT1A receptor. Journal of Biological Chemistry. 274 (23), 16444-16450 (1999).
- Buccioni, M., et al. Innovative functional cAMP assay for studying G protein-coupled receptors: application to the pharmacological characterization of GPR17. Purinergic Signalling. 7 (4), 463-468 (2011).
- Wang, F. I., Ding, G., Ng, G. S., Dixon, S. J., Chidiac, P. Luciferase-based GloSensor cAMP assay: Temperature optimization and application to cell-based kinetic studies. Methods. , (2021).
- Audet, M., et al. Small-scale approach for precrystallization screening in GPCR X-ray crystallography. Nature Protocols. 15 (1), 144-160 (2020).
- Sgro, G. G., Costa, T. R. D. Cryo-EM grid preparation of membrane protein samples for single particle analysis. Frontiers in Molecular Biosciences. 5, 74 (2018).
- White, J. B. R., et al. Single particle cryo-electron microscopy: from sample to structure. Journal of Visualized Experiments. (171), e62415 (2021).
- Thompson, R. F., Iadanza, M. G., Hesketh, E. L., Rawson, S., Ranson, N. A. Collection, pre-processing and on-the-fly analysis of data for high-resolution, single-particle cryo-electron microscopy. Nature Protocols. 14 (1), 100-118 (2019).
- Fernandez-Leiro, R., Scheres, S. H. W. A pipeline approach to single-particle processing in RELION. Acta Crystallographica Section D. 73 (6), 496-502 (2017).
- Punjani, A., Rubinstein, J. L., Fleet, D. J., Brubaker, M. A. cryoSPARC: algorithms for rapid unsupervised cryo-EM structure determination. Nature Methods. 14 (3), 290-296 (2017).
- Brilot, A. F., et al. Beam-induced motion of vitrified specimen on holey carbon film. Journal of Structural Biology. 177 (3), 630-637 (2012).
- Zheng, S. Q., et al. MotionCor2: anisotropic correction of beam-induced motion for improved cryo-electron microscopy. Nature Methods. 14 (4), 331-332 (2017).
- Zhang, K. Gctf: Real-time CTF determination and correction. Journal of Structural Biology. 193 (1), 1-12 (2016).
- Scheres, S. H. Semi-automated selection of cryo-EM particles in RELION-1.3. Journal of Structural Biology. 189 (2), 114-122 (2015).
- Liu, S., et al. Differential activation mechanisms of lipid GPCRs by lysophosphatidic acid and sphingosine 1-phosphate. Nature Communications. 13 (1), 731 (2022).
- Duan, J., et al. Cryo-EM structure of an activated VIP1 receptor-G protein complex revealed by a NanoBiT tethering strategy. Nature Communications. 11 (1), 4121 (2020).
- DiIorio, M. C., Kulczyk, A. W. A robust single-particle cryo-electron microscopy (cryo-EM) processing workflow with cryoSPARC, RELION, and Scipion. Journal of Visualized Experiments. (179), e63387 (2022).
- Pradelles, P., Grassi, J., Chabardes, D., Guiso, N. Enzyme immunoassays of adenosine cyclic 3′,5′-monophosphate and guanosine cyclic 3′,5′-monophosphate using acetylcholinesterase. Analytical Chemistry. 61 (5), 447-453 (1989).
- Jiang, L. I., et al. Use of a cAMP BRET sensor to characterize a novel regulation of cAMP by the sphingosine 1-phosphate/G13 pathway. Journal of Biological Chemistry. 282 (14), 10576-10584 (2007).
