스핑고신 1-인산염 수용체의 구조와 신호전달 경로를 조사하는 파이프라인
Summary
S1P는 S1P 수용체(S1PRs) 서브패밀리를 통해 다양한 생리적 효과를 발휘한다. 여기에서는 S1PR의 구조와 기능에 대해 설명하기 위해 파이프 라인에 대해 설명합니다.
Abstract
리소포스포지질(LPLs)은 스핑고신 1-포스페이트(S1P), 리소포스파티드산 등을 포함하는 생리활성 지질이다. 세포막에서 스핑고지질의 대사 산물인 S1P는 스핑고신 1-인산염 수용체(S1PRs)에 의해 매개되는 신호전달 경로를 통해 다양한 세포 생리적 반응을 조절하는 가장 특징적인 LPL 중 하나이다. 이것은 S1P-S1PRs 신호 전달 시스템이 다발성 경화증 (MS), 자가면역 장애, 암, 염증 및 심지어 COVID-19를 포함한 장애에 대한 주목할만한 잠재적 치료 표적임을 암시했다. 클래스 A G 단백질 결합 수용체 (GPCR) 패밀리의 작은 서브세트인 S1PRs는 S1PR1, S1PR2, S1PR3, S1PR4 및 S1PR5의 다섯 가지 서브타입으로 구성된다. 그러나 상세한 구조 정보의 부족은 S1PR을 겨냥한 약물 발견을 방해합니다. 여기서는 S1P-S1PRs 복합체의 구조를 해결하기 위해 한전자현미경 방법을 적용하고, 세포 기반 기능성 분석법을 이용하여 활성화, 선택적 약물 인식 및 G-단백질 결합의 메카니즘을 해명하였다. 다른 lysophospholipid receptors (LPLRs) 및 GPCRs도 이 전략을 사용하여 연구될 수 있다.
Introduction
세포막에서 스핑고지질의 대사 산물인 스핑고신-1-포스페이트(S1P)는 림프구 밀매, 혈관 발달, 내피 완전성, 심박수1,2,3을 포함한 다양한 생물학적 활동을 수반하는 유비쿼터스 리소포스파티드 신호전달 분자이다. S1P는 5개의 S1P 수용체 아류형(S1PRs 1-5)을 통해 다양한 생리적 효과를 발휘한다. S1PR은 다양한 조직에서 발견되며 하류 G 단백질 4,5에 대한 독특한 선호도를 나타냅니다. S1PR1은 주로 Gi 단백질과 결합하며, 이는 후속적으로 cAMP 생산을 억제합니다. S1PR2 및 S1PR3은 Gi, Gq 및 G12/13과 결합되고, S1PR4 및 S1PR5는 Gi 및 G12/136을 통해 신호를 트랜스듀스한다.
S1P-S1PR 신호전달은 자가면역 장애7, 염증8, 암 9, 심지어 COVID-19 10을 포함한 다수의 질환에 대한 중요한 치료 표적이다. 2010년, 핀골리모드(FTY720)는 재발성 다발성 경화증(MS)11을 치료하기 위해 S1PR을 표적으로 하는 동급 최초의 약물로 허가되었습니다. 그러나, S1PR2를 제외한 모든 S1PR에 결합할 수 있는 반면, S1PR3에 대한 비특이적 결합은 대뇌 피질의 부종, 혈관 및 기관지 수축, 폐 상피 누출(12)을 초래한다. 치료 선택성을 증가시키기 위한 대안적인 전략으로서, 수용체에 대한 아류형 특이적 리간드가 생성되었다. 시포니모드 (BAF312)는 재발 MS 치료13에 대해 2019 년에 승인되었다; S1PR1 및 S1PR5를 효과적으로 타겟팅하는 반면, S1PR3에 대한 친화력은 없으므로 임상 실습14에서 부작용이 적습니다. 2020 년 미국 식품의 약국 (Food and Drug Administration)은 MS 요법15에 대한 ozanimod를 승인했습니다. ozanimod는 S1PR516보다 S1PR1에 대해 25 배 더 큰 선택성을 보유하고있다고보고되었습니다. 특히, 현재의 COVID-19 전염병의 맥락에서, S1PR을 표적으로 하는 작용제 약물이 면역조절 요법 기술(17)을 사용하여 COVID-19를 치료하는데 이용될 수 있다는 것이 발견되었다. 핀골리모드와 비교했을 때, 오자니모드는 COVID-19 환자의 증상을 낮추는 데 우월성을 보였으며, 현재 임상시험10을 진행 중이다. S1PR의 구조적 기초와 기능을 이해하는 것은 S1PRs(18)를 선택적으로 표적으로 하는 약물을 개발하기 위한 중요한 토대를 마련한다.
X선 결정학, 핵 자기 공명(NMR) 및 전자 현미경(EM)을 포함한 생체 거대분자의 구조 정보를 조사하기 위해 많은 기술이 사용됩니다. 2022년 3월 현재, 단백질 데이터뱅크(PDB)에 180,000개 이상의 구조물이 기탁되어 있으며, 대부분은 X선 결정학에 의해 해결되었다. 그러나 2013 년 Yifan Cheng과 David Julius가 201319 년에보고 한 TPRV1 (3.4 Å 해상도)의 첫 번째 근원자 분해능 구조로 인해 냉동 전자 현미경 (cryo-EM)은 단백질 구조의 주류 기술이되었으며 EM PDB 구조의 총 수는 10,000 개가 넘었습니다. 중요한 획기적인 분야는 직접 전자 감지 카메라 및 새로운 이미지 처리 알고리즘으로 알려진 이미징을위한 새로운 카메라 개발입니다. Cryo-EM은 지난20 년 동안 구조 생물학 및 구조 기반 약물 발견에 혁명을 일으켰습니다. 거대 분자 복합체가 살아있는 세포에서 복잡한 역할을 수행하는 방법을 이해하는 것이 생물 과학의 중심 주제이기 때문에 cryo-EM은 특히 막횡단 단백질21에 대한 동적 분자 복합체의 형태를 밝힐 수있는 잠재력을 가지고 있습니다. G-단백질 결합 수용체 (GPCRs)는 막횡단 단백질의 가장 큰 수퍼 패밀리이며 현재 시판되는 의약품22의 30 % 이상을 대상으로합니다. cryo-EM의 개발은 GPCR-G 단백질 복합체의 고해상도 구조의 파열에 기여하여 약물 설계23에서 X 선 결정 학적 분석에 여전히 접근 할 수없는 ‘난치성’표적에 대한 구조적 결정을 가능하게했습니다. 따라서, cryo-EM 애플리케이션은 원자 분해능(24)에 가까운 거의 네이티브 조건에서 GPCR의 입체 구조를 결정할 기회를 제공한다. cryo-EM의 발전은 GPCR 자극 또는 억제의 기계론적 토대를 시각화하는 것을 가능하게 하고, GPCR 표적 약물 생성(25)을 위한 신규한 결합 부위를 밝히는데 더 많은 이익을 가져온다.
cryo-EM 기술의 엄청난 진보에 의지하여, 우리는 최근26,27 개의 고뇌하는 S1PR1-, S1PR3- 및 S1PR5-Gi 신호 복합체의 구조를 확인했습니다. 인간에서, S1PR은 다양한 조직에서 발견되며 하류 G 단백질 4,5에 대한 독특한 선호도를 나타낸다. S1PR1은 주로 Gi 단백질과 결합하며, 이후 3′,5′-cyclic adenosine monophosphate (cAMP) 생산을 억제합니다. S1PR3 및 S1PR5는 Gi 6,28과도 결합할 수 있습니다. Gi 결합 수용체 활성화가 cAMP 29의 생산을 감소시키기 때문에, 기능적 변화를 포착하기 위한 cAMP 억제 효과를 측정하기 위해 Gi-억제 cAMP 분석법이 도입되었다26,27. cAMP 결합 단백질 모이어티가 삽입된 포티누스 피랄리스 루시퍼라제의 돌연변이 버전을 사용하여, 이 cAMP 분석은 세포내 cAMP 농도30의 변화를 통해 GPCR 활성을 모니터링하기 위한 간단하고 신뢰할 수 있는 방법을 제공한다. 이는 민감하고 비방사성 기능성 분석법이며, 약물 발견 목적을 위해 광범위한 GPCRs의 실시간 다운스트림 신호전달을 모니터링하는데 적용될 수 있다(31).
여기서, S1PRs의 활성화 및 약물 인식 모드를 해결하는데 있어서 중요한 방법들에 대한 요약이 제공되며, 주로 cryo-EM 조작 및 Gi-억제 cAMP 분석을 포함한다. 이 기사는 GPCR의 구조와 기능에 대한 추가 탐구를위한 포괄적 인 실험 지침을 제공하는 것을 목표로합니다.
Protocol
Representative Results
Discussion
이 프로토콜은 cryo-EM에 의한 S1PR의 구조를 결정하고 Gi 매개 cAMP 억제 분석법에 의해 S1PR의 활성화 효능을 측정하기 위한 1차 파이프라인을 기술한다. 일부 단계는 실험의 성공에 매우 중요합니다.
S1PRs-Gi 복합체를 정제하려면 바이러스의 품질과 sf9 세포의 건강에 더 많은주의를 기울여야합니다. 수용체의 발현은 불량한 sf9 세포에서 극적으로 감소된다. sf9 ?…
Offenlegungen
The authors have nothing to disclose.
Acknowledgements
S1PRs-Gi 복합체의 데이터는 쓰촨 대학의 서중국 Cryo-EM 센터와 남부 과학 기술 대학 (SUSTech)의 Cryo-EM 센터에서 수확되었으며 쓰촨 대학의 Duyu 고성능 컴퓨팅 센터에서 처리되었습니다. 이 연구는 중국 자연 과학 재단 (32100965 L.C., W.Y.에서 32100988, 31972916에서 Z.S.까지)과 쓰촨 대학의 전임 박사후 연구 기금 (2021SCU12003에서 L.C.까지)의 지원을 받았습니다.
Materials
| 0.05% trypsin-EDTA | GIBCO | Cat# 25300054 | |
| 0.22 µM filter | Thermo Fisher Scientific | Cat# 42213-PS | |
| 100 kDa cut-off concentrator | Thermo Fisher Scientific | Cat# 88533 | |
| 6-well plate | Corning | Cat# 43016 | |
| 96-well plate | Corning | Cat# 3917 | |
| Aprotinin | Sigma-Aldrich | Cat# 9087-70-1 | |
| Apyrase | NEB | Cat# M0398S | |
| Baculovirus transfection reagent | Thermo Fisher Scientific | Cat# 10362100 | For the preparation of P0 baculovirus |
| Benzamidine | Sigma-Aldrich | Cat# B6506 | |
| CHO-K1 | ATCC | N/A | |
| CHS | Sigma-Aldrich | Cat# C6512 | |
| CryoSPARC | Punjani, A., et al.,2017 | https://cryosparc.com/ | |
| DH5α competent E.coli | Thermo Fisher Scientific | Cat# EC0112 | |
| D-Luciferin-Potassium Salt | Sigma- Aldrich | Cat# 50227 | |
| DMSO | Sigma- Aldrich | Cat# D2438 | |
| EDTA | Thermo Fisher Scientific | Cat# S311-500 | |
| ESF921 cell culture medium | Expression Systems | Cat# 96-001 | |
| Excel | microsoft | N/A | |
| F12 medium | Invitrogen | Cat# 11765 | |
| FBS | Cell Box | Cat# SAG-01U-02 | |
| Flag resin | Sigma- Aldrich | Cat# A4596 | |
| Forskolin | APExBIO | Cat# B1421 | |
| Gctf | Zhang, 2016 | https://www.mrc-lmb.cam.ac.uk/kzhang/Gctf/ | |
| GDN | Anatrace | Cat# GDN101 | |
| Gel filtration column | GE healthcare | Cat# 28990944 | |
| Gen5 3.11 | BIO-TEK | N/A | |
| Gentamicin | Solarbio | Cat# L1312 | |
| GloSensor cAMP assay kit | Promega | Cat# E1291 | Gi-inhibition cAMP assay kit |
| GloSensor plasmid | Promega | Cat# E2301 | Sensor plasmid |
| Grace’s medium | GIBCO | Cat# 11595030 | |
| GraphPad Prism 8 | Graphpad | N/A | |
| HBSS | Thermo Fisher Scientific | Cat# 88284 | |
| HEPES | Sigma- Aldrich | Cat# H4034 | |
| jetPRIME Reagent | Polyplus Transfection | Cat# 114-15 | transfection reagent |
| Janamycin | Solarbio | Cat# K1030 | |
| LB medium | Invitrogen | Cat# 12780052 | |
| Leupeptin | Sigma-Aldrich | Cat# L2884 | |
| LMNG | Anatrace | Cat# NG310 | |
| MotionCor2 | (Zheng et al., 2017) | https://emcore.ucsf.edu/ucsf-software | |
| NanoCab | Thermo Fisher Scientific | Cat# 1121822 | |
| PBS | Invitrogen | Cat# 14190-144 | |
| pcDNA3.1-HA-FLAG-S1PRs | GenScript | N/A | |
| pFastBac1-Gαi | GenScript | N/A | |
| pFastBac1-HA-FLAG-T4L-S1PRs-His10 | GenScript | N/A | |
| pFastBacdual-Gβ1γ2 | GenScript | N/A | |
| PureLink HiPure Plasmid Miniprep Kit | Invitrogen | Cat# K210003 | For the preparation of plasmids and P0 baculovirus |
| Q5 site-Directed Mutagenesis kit | NEB | Cat# E0554S | For the preparation of plasmids |
| Quantifoil | Quantifoil | Cat# 251448 | |
| RELION-3.1 | (Zivanov et al., 2018) | https://www2.mrc-lmb.cam.ac.uk/relion | |
| S1PRs cDNA | addgene | N/A | |
| scFv16 | Invitrogen | Cat# 703976 | |
| Sf9 | Expression Systems | N/A | |
| Siponimod | Selleck | Cat# S7179 | |
| sodium cholate | Sigma-Aldrich | Cat# C1254 | |
| Synergy H1 microplate reader | BIO-TEK | N/A | |
| Synthetic T4L DNA (sequence) | N/A | N/A | Aacatcttcgagatgctgcgcatcgacgaagg cctgcgtctcaagatttacaagaataccgaagg ttattacacgattggcatcggccacctcctgaca aagagcccatcactcaacgctgccaagtctga actggacaaagccattggtcgcaacaccaac ggtgtcattacaaaggacgaggcggagaaac tcttcaaccaagatgtagatgcggctgtccgtgg catcctgcgtaatgccaagttgaagcccgtgt atgactcccttgatgctgttcgccgtgcagcctt gatcaacatggttttccaaatgggtgagaccgg agtggctggttttacgaactccctgcgcatgctcc agcagaagcgctgggacgaggccgcagtga atttggctaaatctcgctggtacaatcagacacc taaccgtgccaagcgtgtcatcactaccttccg tactggaacttgggacgcttac |
| TCEP | Thermo Fisher Scientific | Cat# 77720 | |
| Tetracycline | Solarbio | Cat# T8180 | |
| Vitrobot Mark IV | Thermo Fisher Scientific | N/A |
Referenzen
- Verstockt, B., et al. Sphingosine 1-phosphate modulation and immune cell trafficking in inflammatory bowel disease. Nature Reviews: Gastroenterology & Hepatology. , 1-16 (2022).
- Rosen, H., Stevens, R. C., Hanson, M., Roberts, E., Oldstone, M. B. Sphingosine-1-phosphate and its receptors: structure, signaling, and influence. Annual Review of Biochemistry. 82, 637-662 (2013).
- Cartier, A., Hla, T. Sphingosine 1-phosphate: Lipid signaling in pathology and therapy. Science. 366 (6463), 5551 (2019).
- Jozefczuk, E., Guzik, T. J., Siedlinski, M. Significance of sphingosine-1-phosphate in cardiovascular physiology and pathology. Pharmacological Research. 156, 104793 (2020).
- Kihara, Y., Maceyka, M., Spiegel, S., Chun, J. Lysophospholipid receptor nomenclature review: IUPHAR Review 8. British Journal of Pharmacology. 171 (15), 3575-3594 (2014).
- Bryan, A. M., Del Poeta, M. Sphingosine-1-phosphate receptors and innate immunity. Cellular Microbiology. 20 (5), 12836 (2018).
- Pelletier, D., Hafler, D. A. Fingolimod for multiple sclerosis. New England Journal of Medicine. 366 (4), 339-347 (2012).
- Obinata, H., Hla, T. Sphingosine 1-phosphate and inflammation. International Immunology. 31 (9), 617-625 (2019).
- Pyne, N. J., Pyne, S. Sphingosine 1-phosphate and cancer. Nature Reviews: Cancer. 10 (7), 489-503 (2010).
- Abu-Farha, M., et al. The role of lipid metabolism in COVID-19 virus infection and as a drug target. International Journal of Molecular Sciences. 21 (10), 3544 (2020).
- Chun, J., Kihara, Y., Jonnalagadda, D., Blaho, V. A. Fingolimod: lessons learned and new opportunities for treating Multiple Sclerosis and other disorders. Annual Review of Pharmacology and Toxicology. 59, 149-170 (2019).
- Murakami, A., et al. Sphingosine 1-phosphate (S1P) regulates vascular contraction via S1P3 receptor: investigation based on a new S1P3 receptor antagonist. Molecular Pharmacology. 77 (4), 704-713 (2010).
- Cao, L., et al. Siponimod for multiple sclerosis. Cochrane Database of Systematic Reviews. 11, (2021).
- Scott, L. J. Siponimod: a review in secondary progressive Multiple Sclerosis. CNS Drugs. 34 (11), 1191-1200 (2020).
- Lamb, Y. N. Ozanimod: first approval. Drugs. 80 (8), 841-848 (2020).
- Scott, F. L., et al. Ozanimod (RPC1063) is a potent sphingosine-1-phosphate receptor-1 (S1P1) and receptor-5 (S1P5) agonist with autoimmune disease-modifying activity. British Journal of Pharmacology. 173 (11), 1778-1792 (2016).
- McGowan, E. M., Haddadi, N., Nassif, N. T., Lin, Y. Targeting the SphK-S1P-SIPR pathway as a potential therapeutic approach for COVID-19. International Journal of Molecular Sciences. 21 (19), 7189 (2020).
- O’Sullivan, C., Dev, K. K. The structure and function of the S1P1 receptor. Trends in Pharmacological Sciences. 34 (7), 401-412 (2013).
- Liao, M., Cao, E., Julius, D., Cheng, Y. Structure of the TRPV1 ion channel determined by electron cryo-microscopy. Nature. 504 (7478), 107-112 (2013).
- Bai, X. C., McMullan, G., Scheres, S. H. How cryo-EM is revolutionizing structural biology. Trends in Biochemical Sciences. 40 (1), 49-57 (2015).
- Murata, K., Wolf, M. Cryo-electron microscopy for structural analysis of dynamic biological macromolecules. Biochimica et Biophysica Acta General Subjects. 1862 (2), 324-334 (2018).
- Zhang, M., et al. Cryo-EM structure of an activated GPCR-G protein complex in lipid nanodiscs. Nature Structural & Molecular Biology. 28 (3), 258-267 (2021).
- Renaud, J. P., et al. Cryo-EM in drug discovery: achievements, limitations and prospects. Nature Reviews: Drug Discovery. 17 (7), 471-492 (2018).
- Ishchenko, A., Gati, C., Cherezov, V. Structural biology of G protein-coupled receptors: new opportunities from XFELs and cryoEM. Current Opinion in Structural Biology. 51, 44-52 (2018).
- Yang, D., et al. G protein-coupled receptors: structure- and function-based drug discovery. Signal Transduction and Targeted Therapy. 6 (1), 7 (2021).
- Yuan, Y., et al. Structures of signaling complexes of lipid receptors S1PR1 and S1PR5 reveal mechanisms of activation and drug recognition. Cell Research. 31 (12), 1263-1274 (2021).
- Zhao, C., et al. Structural insights into sphingosine-1-phosphate recognition and ligand selectivity of S1PR3-Gi signaling complexes. Cell Research. 32 (2), 218-221 (2022).
- Xu, Z., et al. Structural basis of sphingosine-1-phosphate receptor 1 activation and biased agonism. Nature Chemical Biology. 18, 281-288 (2022).
- Liu, Y. F., Ghahremani, M. H., Rasenick, M. M., Jakobs, K. H., Albert, P. R. Stimulation of cAMP synthesis by Gi-coupled receptors upon ablation of distinct Galphai protein expression. Gi subtype specificity of the 5-HT1A receptor. Journal of Biological Chemistry. 274 (23), 16444-16450 (1999).
- Buccioni, M., et al. Innovative functional cAMP assay for studying G protein-coupled receptors: application to the pharmacological characterization of GPR17. Purinergic Signalling. 7 (4), 463-468 (2011).
- Wang, F. I., Ding, G., Ng, G. S., Dixon, S. J., Chidiac, P. Luciferase-based GloSensor cAMP assay: Temperature optimization and application to cell-based kinetic studies. Methods. , (2021).
- Audet, M., et al. Small-scale approach for precrystallization screening in GPCR X-ray crystallography. Nature Protocols. 15 (1), 144-160 (2020).
- Sgro, G. G., Costa, T. R. D. Cryo-EM grid preparation of membrane protein samples for single particle analysis. Frontiers in Molecular Biosciences. 5, 74 (2018).
- White, J. B. R., et al. Single particle cryo-electron microscopy: from sample to structure. Journal of Visualized Experiments. (171), e62415 (2021).
- Thompson, R. F., Iadanza, M. G., Hesketh, E. L., Rawson, S., Ranson, N. A. Collection, pre-processing and on-the-fly analysis of data for high-resolution, single-particle cryo-electron microscopy. Nature Protocols. 14 (1), 100-118 (2019).
- Fernandez-Leiro, R., Scheres, S. H. W. A pipeline approach to single-particle processing in RELION. Acta Crystallographica Section D. 73 (6), 496-502 (2017).
- Punjani, A., Rubinstein, J. L., Fleet, D. J., Brubaker, M. A. cryoSPARC: algorithms for rapid unsupervised cryo-EM structure determination. Nature Methods. 14 (3), 290-296 (2017).
- Brilot, A. F., et al. Beam-induced motion of vitrified specimen on holey carbon film. Journal of Structural Biology. 177 (3), 630-637 (2012).
- Zheng, S. Q., et al. MotionCor2: anisotropic correction of beam-induced motion for improved cryo-electron microscopy. Nature Methods. 14 (4), 331-332 (2017).
- Zhang, K. Gctf: Real-time CTF determination and correction. Journal of Structural Biology. 193 (1), 1-12 (2016).
- Scheres, S. H. Semi-automated selection of cryo-EM particles in RELION-1.3. Journal of Structural Biology. 189 (2), 114-122 (2015).
- Liu, S., et al. Differential activation mechanisms of lipid GPCRs by lysophosphatidic acid and sphingosine 1-phosphate. Nature Communications. 13 (1), 731 (2022).
- Duan, J., et al. Cryo-EM structure of an activated VIP1 receptor-G protein complex revealed by a NanoBiT tethering strategy. Nature Communications. 11 (1), 4121 (2020).
- DiIorio, M. C., Kulczyk, A. W. A robust single-particle cryo-electron microscopy (cryo-EM) processing workflow with cryoSPARC, RELION, and Scipion. Journal of Visualized Experiments. (179), e63387 (2022).
- Pradelles, P., Grassi, J., Chabardes, D., Guiso, N. Enzyme immunoassays of adenosine cyclic 3′,5′-monophosphate and guanosine cyclic 3′,5′-monophosphate using acetylcholinesterase. Analytical Chemistry. 61 (5), 447-453 (1989).
- Jiang, L. I., et al. Use of a cAMP BRET sensor to characterize a novel regulation of cAMP by the sphingosine 1-phosphate/G13 pathway. Journal of Biological Chemistry. 282 (14), 10576-10584 (2007).
