Mappatura batteriche reti funzionali e sulle vie di<em> Escherichia Coli</em> Utilizzando matrici sintetiche genetiche
Summary
Sistematiche e su larga scala di sintesi genetica (gene-gene o epistasi) schermi di interazione può essere utilizzato per esplorare la ridondanza genetica e via di cross-talk. Qui, descriviamo un high-throughput quantitativa sintetica genetica tecnologia di retinatura array, definito eSGA che abbiamo sviluppato per chiarire i rapporti epistatiche ed esplorare reti di interazione genetici in<em> Escherichia coli</em>.
Abstract
Fenotipi sono determinati da una serie complessa di fisica (ad esempio proteina-proteina) e funzionali (ad esempio gene-gene o genetico) interazioni (GI) 1. Mentre interazioni fisiche in grado di indicare quali proteine batteriche sono associati come complessi, non necessariamente rivelano percorso a livello di relationships1 funzionali. GI schermi, in cui si misura la crescita dei doppi mutanti recanti due geni cancellati o inattivato e rispetto ai corrispondenti singoli mutanti, in grado di illuminare le dipendenze epistatiche tra loci e, quindi, fornire un mezzo per interrogare e scoprire nuove relazioni funzionali 2. Mappe a grande scala GI sono stati riportati per gli organismi eucarioti, come lievito 3-7, ma le informazioni GI rimangono sparse per procarioti 8, che ostacola l'annotazione funzionale dei genomi batterici. A tal fine, noi e altri hanno sviluppato high-throughput quantitative batteriche metodi di screening GI 9, 10 </sup>.
Qui, presentiamo i passaggi chiave necessari per eseguire quantitativa E. coli sintetico Genetic Array (eSGA) Procedura di screening su un genoma scala 9, utilizzando naturale coniugazione batterica e ricombinazione omologa per generare sistemica e misurare l'idoneità di un gran numero di doppi mutanti in un formato matrice colonia. Brevemente, un robot è utilizzato per trasferire , attraverso la coniugazione, cloramfenicolo (Cm) – segnato da alleli mutanti Hfr ingegneria (ad alta frequenza di ricombinazione) 'ceppi donatori in un array ordinato di kanamicina (Kan) – marcati F-destinatario ceppi. In genere, si usa la perdita di funzione singoli mutanti recanti non essenziali delezioni del gene (ad esempio, la collezione 'Keio' 11) e le mutazioni geniche essenziali hypomorphic alleli (cioè conferiscono ridotta espressione della proteina, la stabilità, o attività 9, 12, 13) a interrogare le associazioni funzionali di geni non essenziali ed essenziali, resture rispettivamente. Dopo coniugazione mediata e conseguente scambio genetico mediante ricombinazione omologa, i mutanti risultanti doppie sono selezionati su terreno solido contenente entrambi gli antibiotici. Dopo conseguenza, le piastre vengono create digitalmente delle immagini e le dimensioni delle colonie sono quantitativamente valutato con un proprio sistema automatico di elaborazione delle immagini 14. IG si rivelano quando il tasso di crescita di un doppio mutante o è significativamente migliore o peggiore del previsto 9. Aggravanti (o negativo) GIS spesso il risultato tra la perdita-di-funzione mutazioni in coppie di geni provenienti da percorsi di compensazione che incidono sullo stesso processo essenziale 2. Qui, la perdita di un singolo gene è tamponata, in modo tale che sia mutante singolo è praticabile. Tuttavia, la perdita di entrambi i percorsi è deleteria e provoca letalità sintetica o malattia (ovvero crescita lenta). Viceversa, alleviare (o positivo) possono verificarsi interazioni tra i geni della via stessa o proteina complessa 2 comedelezione del gene o da solo è spesso sufficiente a perturbare la normale funzione della via o complesso tale che perturbazioni supplementari non ridurre l'attività, e quindi la crescita, ulteriormente. Nel complesso, l'identificazione sistematica e l'analisi delle reti GI in grado di fornire, località turistiche, mappe globali delle relazioni funzionali tra un gran numero di geni, da cui percorso informazioni a livello di perdere per altri approcci possono dedurre 9.
Protocol
Representative Results
Discussion
Abbiamo delineato un graduale protocollo per l'utilizzo di robot per studiare lo screening eSGA funzioni geniche batteriche a livello percorso interrogando GI. Questo approccio può essere utilizzato per studiare singoli geni sia interi sistemi biologici in E. coli. Cura l'esecuzione delle fasi sperimentali di cui sopra, tra cui tutti i controlli del caso, e rigorosamente in maniera indipendente l'analisi e la validazione dei dati GI sono aspetti chiave per il successo di eSGA nel fare nuove scopert…
Divulgations
The authors have nothing to disclose.
Acknowledgements
Questo lavoro è stato sostenuto da fondi del Genome Canada, l'Ontario Institute Genomica e Istituti canadesi di borse di ricerca per la salute e JG AE AG è un destinatario della borsa di studio Vanier Canada Graduate.
Materials
| I. Antibiotics | 2 | 36471 Remove |
||||
| Chloramphenicol | Bioshop | #CLR201 | 3 | 36472 Remove |
||
| Kanamycin | #KAN201 | 4 | 36480 Remove |
|||
| Ampicillin | # AMP201 | 5 | 36473 Remove |
|||
| 2. Luria-Bertani medium | 6 | 36474 Remove |
||||
| LB powder | Bioshop | #LBL405 | 7 | 36478 Remove |
||
| Agar | Bioshop | #AGR003 | 8 | 36481 Remove |
||
| 3. Bacterial Strains and Plasmids | 9 | 36475 Remove |
||||
| Hfr Cavalli strain λred system (JL238) | Babu et al.14. | 10 | 36476 Remove |
|||
| pKD3 | E. coli Genetic Stock Centre, Yale | 11 | 36477 Remove |
|||
| Keio E. coli F- recipient collection | National BioResource Project (NBRP) of Japan11 | 12 | 36479 Remove |
|||
| Hypomorphic E. coli F- SPA-tag strains | Open biosystems; Babu et al.14 | 13 | 36491 Remove |
|||
| 4. Primers | 14 | 36486 Remove |
||||
| pKD3-based desalted constant primers | F1: 5′-GGCTGACATGGGAATTAGC-3′ R1: 5′-AGATTGCAGCATTACACGTCTT-3′ |
15 | 36482 Remove |
|||
| Desalted custom primers | Cm-R: 5′-TTATACGCAAGGCGACAAGG-3′ Cm-F: 5′- GATCTTCCGTCACAGGTAGG-3′ |
16 | 36483 Remove |
|||
| Desalted custom primers | F2 and R2: 20 nt constant regions based on pKD3 sequence and 45 nt custom homology regions F2 constant region: 5′-CATATGAATATCCTCCTTA-3′ R2 constant region: 5′-TGTGTAGGCTGGAGCTGCTTC-3’S1 and S2: 27 nt constant regions for priming the amplification of the SPA-Cm cassette and 45 nt custom homology regions S1 constant region: 5’AGCTGGAGGATCCATGGAAAAGAGAAG -3′ S2 constant region: 5′- GGCCCCATATGAATATCCTCCTTAGTT -3′ KOCO-F and KOCO-C: 20 nt primers 200 bp away from the non-essential gene deletion site or the essential gene SPA-tag insertion site |
17 | 36484 Remove |
|||
| 5. PCR and Electrophoresis Reagents | 18 | 36485 Remove |
||||
| Taq DNA polymerase | Fermentas | # EP0281 | 19 | 36487 Remove |
||
| 10X PCR buffer | Fermentas | # EP0281 | 20 | 36488 Remove |
||
| 10 mM dNTPs | Fermentas | # EP0281 | 21 | 36489 Remove |
||
| 25 mM MgCl2 | Fermentas | # EP0281 | 22 | 36490 Remove |
||
| Agarose | Bioshop | # AGA002 | 23 | 36492 Remove |
||
| Loading dye | NEB | #B7021S | 24 | 36493 Remove |
||
| Ethidium bromide | Bioshop | # ETB444 | 25 | 36497 Remove |
||
| 10X TBE buffer | Bioshop | # ETB444.10 | 26 | 36494 Remove |
||
| Tris Base | Bioshop | # TRS001 | 27 | 36495 Remove |
||
| Boric acid | Sigma | # T1503-1KG | 28 | 36496 Remove |
||
| 0.5 M EDTA (pH 8.0) | Sigma | # B6768-500G | 29 | 36498 Remove |
||
| DNA ladder | NEB | #N3232L | 30 | 36499 Remove |
||
| 6. DNA isolation and Clean-up Kits | 31 | 36500 Remove |
||||
| Genomic DNA isolation and purification kit | Promega | #A1120 | 32 | 36501 Remove |
||
| Plasmid Midi kit | Qiagen | # 12143 | 33 | 36502 Remove |
||
| QIAquick PCR purification kit | Qiagen | #28104 | 34 | 36512 Remove |
||
| 7. Equipment for PCR, Transformation and Replica-pinning | 35 | 36503 Remove |
||||
| Thermal cycler | BioRad, iCycler | 36 | 36504 Remove |
|||
| Agarose gel electrophoresis | BioRad | 37 | 36505 Remove |
|||
| Electroporator | Bio-Rad GenePulser II | 38 | 36506 Remove |
|||
| 0.2 cm electroporation cuvette | Bio-Rad | 39 | 36507 Remove |
|||
| 42 °C water bath shaker | Innova 3100 | 40 | 36508 Remove |
|||
| Beckman Coulter TJ-25 centrifuge | Beckman Coulter | 41 | 36519 Remove |
|||
| 32 °C shaker | New Brunswick Scientific, USA | 42 | 36509 Remove |
|||
| 32 °C plate incubator | Fisher Scientific | 43 | 36510 Remove |
|||
| RoToR-HDA benchtop robot | Singer Instruments | 44 | 36511 Remove |
|||
| 96, 384 and 1,536 pin density pads | Singer Instruments | 45 | 36513 Remove |
|||
| 96 or 384 long pins | Singer Instruments | 46 | 36514 Remove |
|||
| 8. Imaging Equipments | 47 | 36515 Remove |
||||
| Camera stand | Kaiser | 48 | 36516 Remove |
|||
| Digital camera, 10 megapixel | Any Vendor | 49 | 36517 Remove |
|||
| Light boxes, Testrite 16″ x 24″ units | Testrite | 50 | 36527 Remove |
|||
| 9. Pads or Plates Recycling | 51 | 36518 Remove |
||||
| 10% bleach | Any Vendor | 52 | 36520 Remove |
|||
| 70% ethanol | Any Vendor | 53 | 36521 Remove |
|||
| Sterile distilled water | Any Vendor | 54 | 36522 Remove |
|||
| Flow hood | Any Vendor | 55 | 36523 Remove |
|||
| Ultraviolet lamp | Any Vendor | 56 | 36524 Remove |
|||
| 10. Labware | 57 | 36525 Remove |
||||
| 50 ml polypropylene tubes | Any Vendor | 58 | 36526 Remove |
|||
| 1.5 ml micro-centrifuge tubes | Any Vendor | 59 | 36528 Remove |
|||
| 250 ml conical flaks | VWR | # 29140-045 | 60 | 36529 Remove |
||
| 15 ml sterile culture tubes | Thermo Scientific | # 366052 | 61 | 36530 Remove |
||
| Cryogenic vials | VWR | # 479-3221 | 62 | 36531 Remove |
||
| Rectangular Plates | Singer Instruments | 63 | 36532 Remove |
|||
| 96-well and 384-well microtitre plates | Singer Instruments | Nunc | 64 | 36533 Remove |
||
| Plate roller for sealing multi-well | Sigma | #R1275 | 65 | 36535 Remove |
||
| plates | ABgene | # AB-0580 | 66 | 36534 Remove |
||
| Adhesive plate seals | Fisher Scientific | # 13-990-14 | 67 | 36537 Remove |
||
| -80 °C freezer | Any Vendor | 68 | 36536 Remove |
References
- Bandyopadhyay, S., Kelley, R., Krogan, N. J., Ideker, T. Functional maps of protein complexes from quantitative genetic interaction data. PLoS Comput. Biol. 4, e1000065 (2008).
- Costanzo, M., Baryshnikova, A., Myers, C. L., Andrews, B., Boone, C. Charting the genetic interaction map of a cell. Curr. Opin. Biotechnol. 22, 66-74 (2011).
- Costanzo, M., et al. The genetic landscape of a cell. Science. 327, 425-4231 (2010).
- Fiedler, D., et al. Functional organization of the S. cerevisiae phosphorylation network. Cell. 136, 952-963 (2009).
- Roguev, A., et al. Conservation and rewiring of functional modules revealed by an epistasis map in fission yeast. Science. 322, 405-4010 (2008).
- Schuldiner, M., et al. Exploration of the function and organization of the yeast early secretory pathway through an epistatic miniarray profile. Cell. 123, 507-519 (2005).
- Wilmes, G. M., et al. A genetic interaction map of RNA-processing factors reveals links between Sem1/Dss1-containing complexes and mRNA export and splicing. Mol. Cell. 32, 735-746 (2008).
- Babu, M., et al. Systems-level approaches for identifying and analyzing genetic interaction networks in Escherichia coli and extensions to other prokaryotes. Mol. Biosyst. 12, 1439-1455 (2009).
- Butland, G., et al. coli synthetic genetic array analysis. Nat. Methods. 5, 789-7895 (2008).
- Typas, A., et al. Regulation of peptidoglycan synthesis by outer-membrane proteins. Cell. 143, 1097-10109 (2010).
- Baba, T., et al. Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2, 2006-200008 (2006).
- Babu, M., et al. Genetic interaction maps in Escherichia coli reveal functional crosstalk among cell envelope biogenesis pathways. PLoS Genet. 7, e1002377 (2011).
- Nichols, R. J., et al. Phenotypic landscape of a bacterial cell. Cell. 144, 143-156 (2011).
- Babu, M., Gagarinova, A., Greenblatt, J., Emili, A. Array-based synthetic genetic screens to map bacterial pathways and functional networks in Escherichia coli. Methods Mol Biol. 765, 125-153 (2011).
- Datsenko, K. A., Wanner, B. L. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. U.S.A. 97, 6640-665 (2000).
- Yu, D., et al. An efficient recombination system for chromosome engineering in Escherichia coli. Proc. Natl. Acad. Sci. U.S.A. 97, 5978-5983 (2000).
- Typas, A., et al. quantitative analyses of genetic interactions in. E. coli. Nat. Methods. 5, 781-787 (2008).
- Zeghouf, M., et al. Sequential Peptide Affinity (SPA) system for the identification of mammalian and bacterial protein complexes. J. Proteome Res. 3, 463-468 (2004).
- Davierwala, A. P., et al. . , 1147-1152 (2005).
- Breslow, D. K., et al. A comprehensive strategy enabling high-resolution functional analysis of the yeast genome. Nat. Methods. 5, 711-718 (2008).
- Babu, M., et al. Sequential peptide affinity purification system for the systematic isolation and identification of protein complexes from Escherichia coli. Methods Mol. Biol. 564, 373-400 (2009).
- Butland, G., et al. Interaction network containing conserved and essential protein complexes in Escherichia coli. Nature. 433, 531-537 (2005).
- Hu, P., Janga, S. C., Babu, M., Diaz-Mejia, J. J., Butland, G., et al. Global functional atlas of Escherichia coli encompassing previously uncharacterized proteins. PLoS Biol. 7, (2009).
- Anderson, R. P., Roth, J. R. Tandem genetic duplications in phage and bacteria. Annu. Rev. Microbiol. 31, 473-505 (1977).
- Boone, C., Bussey, H., Andrews, B. J. Exploring genetic interactions and networks with yeast. Nat. Rev. Genet. 8, 437-449 (2007).
- Collins, S. R., et al. Functional dissection of protein complexes involved in yeast chromosome biology using a genetic interaction map. Nature. 446, 806-8010 (2007).
- Le Meur, N., Gentleman, R. Modeling synthetic lethality. Genome Biol. 9, R135 (2008).
- Tong, A. H., et al. Systematic genetic analysis with ordered arrays of yeast deletion mutants. Science. 294, 2364-2368 (2001).
- Tong, A. H., et al. Global mapping of the yeast genetic interaction network. Science. 303, 808-813 (2004).
- Wong, S. L., et al. Combining biological networks to predict genetic interactions. Proc. Natl. Acad. Sci. U.S.A. 101, 15682-15687 (2004).
- van Opijnen, T., Bodi, K. L., Camilli, A. Tn-seq: high-throughput parallel sequencing for fitness and genetic interaction studies in microorganisms. Nat. Methods. 6, 767-772 (2009).
- Gagarinova, A., Emili, A. Genome-scale genetic manipulation methods for exploring bacterial molecular biology. Mol. Biosyst. 8, 1626-1638 (2012).
- Dewey, C. N., et al. Positional orthology: putting genomic evolutionary relationships into context. Brief Bioinform. 12, 401-412 (2011).
- St Onge, R. P., et al. Systematic pathway analysis using high-resolution fitness profiling of combinatorial gene deletions. Nat. Genet. 39, 199-206 (2007).
