Систематические крупномасштабные синтетические генетические (ген-ген или эпистаза) экранов взаимодействия может быть использована для изучения генетической избыточности и пути перекрестных помех. Здесь мы описываем высокой пропускной количественные синтетических генетических технологий скрининга массив, называемый eSGA, которые мы разработали для выяснения отношений эпистатических и изучение генных сетей взаимодействия в<em> Кишечной палочки</em>.
Phenotypes are determined by a complex series of physical (e.g. protein-protein) and functional (e.g. gene-gene or genetic) interactions (GI)1. While physical interactions can indicate which bacterial proteins are associated as complexes, they do not necessarily reveal pathway-level functional relationships1. GI screens, in which the growth of double mutants bearing two deleted or inactivated genes is measured and compared to the corresponding single mutants, can illuminate epistatic dependencies between loci and hence provide a means to query and discover novel functional relationships2. Large-scale GI maps have been reported for eukaryotic organisms like yeast3-7, but GI information remains sparse for prokaryotes8, which hinders the functional annotation of bacterial genomes. To this end, we and others have developed high-throughput quantitative bacterial GI screening methods9, 10.
Here, we present the key steps required to perform quantitative E. coli Synthetic Genetic Array (eSGA) screening procedure on a genome-scale9, using natural bacterial conjugation and homologous recombination to systemically generate and measure the fitness of large numbers of double mutants in a colony array format. Briefly, a robot is used to transfer, through conjugation, chloramphenicol (Cm) – marked mutant alleles from engineered Hfr (High frequency of recombination) ‘donor strains’ into an ordered array of kanamycin (Kan) – marked F- recipient strains. Typically, we use loss-of-function single mutants bearing non-essential gene deletions (e.g. the ‘Keio’ collection11) and essential gene hypomorphic mutations (i.e. alleles conferring reduced protein expression, stability, or activity9, 12, 13) to query the functional associations of non-essential and essential genes, respectively. After conjugation and ensuing genetic exchange mediated by homologous recombination, the resulting double mutants are selected on solid medium containing both antibiotics. After outgrowth, the plates are digitally imaged and colony sizes are quantitatively scored using an in-house automated image processing system14. GIs are revealed when the growth rate of a double mutant is either significantly better or worse than expected9. Aggravating (or negative) GIs often result between loss-of-function mutations in pairs of genes from compensatory pathways that impinge on the same essential process2. Here, the loss of a single gene is buffered, such that either single mutant is viable. However, the loss of both pathways is deleterious and results in synthetic lethality or sickness (i.e. slow growth). Conversely, alleviating (or positive) interactions can occur between genes in the same pathway or protein complex2 as the deletion of either gene alone is often sufficient to perturb the normal function of the pathway or complex such that additional perturbations do not reduce activity, and hence growth, further. Overall, systematically identifying and analyzing GI networks can provide unbiased, global maps of the functional relationships between large numbers of genes, from which pathway-level information missed by other approaches can be inferred9.
Мы наметили поэтапное протокол для использования роботов скрининга eSGA для исследования бактериальной функции гена в пути уровне путем опроса GI. Этот подход может быть использован для изучения отдельных генов и целых биологических систем в E. палочки. Осторожно выполнения экспери…
The authors have nothing to disclose.
Эта работа была поддержана за счет средств Геном Канада, Онтарио геномики Института и Канадский институт исследований в области здравоохранения грантов JG и AE AG является получателем стипендии Ванье Канаде Высшее.
I. Antibiotics | 2 | 36471 Remove |
||||
Chloramphenicol | Bioshop | #CLR201 | 3 | 36472 Remove |
||
Kanamycin | #KAN201 | 4 | 36480 Remove |
|||
Ampicillin | # AMP201 | 5 | 36473 Remove |
|||
2. Luria-Bertani medium | 6 | 36474 Remove |
||||
LB powder | Bioshop | #LBL405 | 7 | 36478 Remove |
||
Agar | Bioshop | #AGR003 | 8 | 36481 Remove |
||
3. Bacterial Strains and Plasmids | 9 | 36475 Remove |
||||
Hfr Cavalli strain λred system (JL238) | Babu et al.14. | 10 | 36476 Remove |
|||
pKD3 | E. coli Genetic Stock Centre, Yale | 11 | 36477 Remove |
|||
Keio E. coli F- recipient collection | National BioResource Project (NBRP) of Japan11 | 12 | 36479 Remove |
|||
Hypomorphic E. coli F- SPA-tag strains | Open biosystems; Babu et al.14 | 13 | 36491 Remove |
|||
4. Primers | 14 | 36486 Remove |
||||
pKD3-based desalted constant primers | F1: 5′-GGCTGACATGGGAATTAGC-3′ R1: 5′-AGATTGCAGCATTACACGTCTT-3′ |
15 | 36482 Remove |
|||
Desalted custom primers | Cm-R: 5′-TTATACGCAAGGCGACAAGG-3′ Cm-F: 5′- GATCTTCCGTCACAGGTAGG-3′ |
16 | 36483 Remove |
|||
Desalted custom primers | F2 and R2: 20 nt constant regions based on pKD3 sequence and 45 nt custom homology regions F2 constant region: 5′-CATATGAATATCCTCCTTA-3′ R2 constant region: 5′-TGTGTAGGCTGGAGCTGCTTC-3’S1 and S2: 27 nt constant regions for priming the amplification of the SPA-Cm cassette and 45 nt custom homology regions S1 constant region: 5’AGCTGGAGGATCCATGGAAAAGAGAAG -3′ S2 constant region: 5′- GGCCCCATATGAATATCCTCCTTAGTT -3′ KOCO-F and KOCO-C: 20 nt primers 200 bp away from the non-essential gene deletion site or the essential gene SPA-tag insertion site |
17 | 36484 Remove |
|||
5. PCR and Electrophoresis Reagents | 18 | 36485 Remove |
||||
Taq DNA polymerase | Fermentas | # EP0281 | 19 | 36487 Remove |
||
10X PCR buffer | Fermentas | # EP0281 | 20 | 36488 Remove |
||
10 mM dNTPs | Fermentas | # EP0281 | 21 | 36489 Remove |
||
25 mM MgCl2 | Fermentas | # EP0281 | 22 | 36490 Remove |
||
Agarose | Bioshop | # AGA002 | 23 | 36492 Remove |
||
Loading dye | NEB | #B7021S | 24 | 36493 Remove |
||
Ethidium bromide | Bioshop | # ETB444 | 25 | 36497 Remove |
||
10X TBE buffer | Bioshop | # ETB444.10 | 26 | 36494 Remove |
||
Tris Base | Bioshop | # TRS001 | 27 | 36495 Remove |
||
Boric acid | Sigma | # T1503-1KG | 28 | 36496 Remove |
||
0.5 M EDTA (pH 8.0) | Sigma | # B6768-500G | 29 | 36498 Remove |
||
DNA ladder | NEB | #N3232L | 30 | 36499 Remove |
||
6. DNA isolation and Clean-up Kits | 31 | 36500 Remove |
||||
Genomic DNA isolation and purification kit | Promega | #A1120 | 32 | 36501 Remove |
||
Plasmid Midi kit | Qiagen | # 12143 | 33 | 36502 Remove |
||
QIAquick PCR purification kit | Qiagen | #28104 | 34 | 36512 Remove |
||
7. Equipment for PCR, Transformation and Replica-pinning | 35 | 36503 Remove |
||||
Thermal cycler | BioRad, iCycler | 36 | 36504 Remove |
|||
Agarose gel electrophoresis | BioRad | 37 | 36505 Remove |
|||
Electroporator | Bio-Rad GenePulser II | 38 | 36506 Remove |
|||
0.2 cm electroporation cuvette | Bio-Rad | 39 | 36507 Remove |
|||
42 °C water bath shaker | Innova 3100 | 40 | 36508 Remove |
|||
Beckman Coulter TJ-25 centrifuge | Beckman Coulter | 41 | 36519 Remove |
|||
32 °C shaker | New Brunswick Scientific, USA | 42 | 36509 Remove |
|||
32 °C plate incubator | Fisher Scientific | 43 | 36510 Remove |
|||
RoToR-HDA benchtop robot | Singer Instruments | 44 | 36511 Remove |
|||
96, 384 and 1,536 pin density pads | Singer Instruments | 45 | 36513 Remove |
|||
96 or 384 long pins | Singer Instruments | 46 | 36514 Remove |
|||
8. Imaging Equipments | 47 | 36515 Remove |
||||
Camera stand | Kaiser | 48 | 36516 Remove |
|||
Digital camera, 10 megapixel | Any Vendor | 49 | 36517 Remove |
|||
Light boxes, Testrite 16″ x 24″ units | Testrite | 50 | 36527 Remove |
|||
9. Pads or Plates Recycling | 51 | 36518 Remove |
||||
10% bleach | Any Vendor | 52 | 36520 Remove |
|||
70% ethanol | Any Vendor | 53 | 36521 Remove |
|||
Sterile distilled water | Any Vendor | 54 | 36522 Remove |
|||
Flow hood | Any Vendor | 55 | 36523 Remove |
|||
Ultraviolet lamp | Any Vendor | 56 | 36524 Remove |
|||
10. Labware | 57 | 36525 Remove |
||||
50 ml polypropylene tubes | Any Vendor | 58 | 36526 Remove |
|||
1.5 ml micro-centrifuge tubes | Any Vendor | 59 | 36528 Remove |
|||
250 ml conical flaks | VWR | # 29140-045 | 60 | 36529 Remove |
||
15 ml sterile culture tubes | Thermo Scientific | # 366052 | 61 | 36530 Remove |
||
Cryogenic vials | VWR | # 479-3221 | 62 | 36531 Remove |
||
Rectangular Plates | Singer Instruments | 63 | 36532 Remove |
|||
96-well and 384-well microtitre plates | Singer Instruments | Nunc | 64 | 36533 Remove |
||
Plate roller for sealing multi-well | Sigma | #R1275 | 65 | 36535 Remove |
||
plates | ABgene | # AB-0580 | 66 | 36534 Remove |
||
Adhesive plate seals | Fisher Scientific | # 13-990-14 | 67 | 36537 Remove |
||
-80 °C freezer | Any Vendor | 68 | 36536 Remove |