Single-Copy Gene Locus Chromatine Zuivering in Saccharomyces cerevisiae
Summary
Dit protocol presenteert een locus-specifieke chromatine-isolatiemethode op basis van plaatsspecifieke recombinatie om een single-copy genlocus van belang in zijn natuurlijke chromatinecontext te zuiveren van ontluikende gist, Saccharomyces cerevisiae.
Abstract
De basisorganisatorische eenheid van eukaryotisch chromatine is het nucleosoomkerndeeltje (NCP), dat bestaat uit DNA dat ~1,7 keer rond een histon-octameer is gewikkeld. Chromatine wordt gedefinieerd als de entiteit van NCP’s en tal van andere eiwitcomplexen, waaronder transcriptiefactoren, chromatine-remodellering en modificerende enzymen. Het is nog onduidelijk hoe deze eiwit-DNA-interacties worden georkestreerd op het niveau van specifieke genomische loci tijdens verschillende stadia van de celcyclus. Dit is voornamelijk te wijten aan de huidige technische beperkingen, die het moeilijk maken om nauwkeurige metingen van dergelijke dynamische interacties te verkrijgen. Hier beschrijven we een verbeterde methode die plaatsspecifieke recombinatie combineert met een efficiënt single-step affiniteitszuiveringsprotocol om een single-copy genlocus van belang te isoleren in zijn oorspronkelijke chromatinetoestand. De methode maakt de robuuste verrijking van de doellocus ten opzichte van genoomchromatine mogelijk, waardoor deze techniek een effectieve strategie is voor het identificeren en kwantificeren van eiwitinteracties op een onbevooroordeelde en systematische manier, bijvoorbeeld door massaspectrometrie. Afgezien van dergelijke samenstellingsanalyses weerspiegelt het met deze methode gezuiverde natieve chromatine waarschijnlijk de in vivo situatie met betrekking tot nucleosoompositionering en histonmodificaties en is het daarom vatbaar voor verdere structurele en biochemische analyses van chromatine dat is afgeleid van vrijwel elke genomische locus in gist.
Introduction
De dynamische organisatie van eukaryote genomen in chromatine comprimeert het DNA om binnen de grenzen van de kern te passen, terwijl het zorgt voor voldoende dynamiek voor genexpressie en toegankelijkheid voor regulerende factoren. Voor een deel wordt deze veelzijdigheid gemedieerd door het nucleosoom, de basiseenheid van chromatine, die bestaat uit een kerndeeltje met 147 bp DNA dat ~1,7 keer rond het histonoctameer1 is gewikkeld. Het nucleosoom is een zeer dynamische structuur met betrekking tot zijn samenstelling, met talrijke histonvarianten en posttranslationele modificaties (PTM’s) op de N- en C-terminale histonstaarten. Bovendien interageert eukaryotisch chromatine met een groot aantal andere essentiële componenten, zoals transcriptiefactoren, DNA- en RNA-verwerkingsmachines, architecturale eiwitten, enzymen die betrokken zijn bij de remodellering en modificatie van chromatine, en RNA-moleculen die verband houden met chromatine. Deze cruciale machines die betrokken zijn bij transcriptie, replicatie en reparatie vereisen allemaal toegang tot chromatine, dat dient als het natuurlijke substraat voor deze processen. Bijgevolg vereist het begrijpen van de moleculaire mechanismen die ten grondslag liggen aan deze DNA-transacties een nauwkeurige definitie van de collectieve veranderingen in de chromatinestructuur in de specifieke genomische regio’s waar deze machines samenkomen en biologische reacties vergemakkelijken.
Ondanks de identificatie van talrijke chromatinefactoren door middel van genetica en eiwit-eiwitinteractiestudies, is het uitvoeren van directe, onbevooroordeelde en uitgebreide analyses van chromatine-interacties op bepaalde genomische locaties een belangrijk obstakel gebleven 2,3. Aanvankelijk konden alleen zeer overvloedige regio’s van het genoom (d.w.z. repetitieve loci) of plasmiden met meerdere kopieën in voldoende hoeveelheden en zuiverheid worden geïsoleerd voor massaspectrometrische identificatie van de geassocieerde eiwitten 4,5,6,7. Een reeks nieuwe benaderingen op basis van de directe hybridisatie van capture-sondes tot gechromatineerd DNA, nabijheidsbiotinylering met behulp van het CRISPR-dCas9-systeem of de binding van sequentiespecifieke adaptereiwitten aan de locus van belang zijn begonnen met het ontrafelen van het proteoom van single-copy loci uit het genoom van gist en zoogdieren 8,9,10. Al deze methoden vereisen echter formaldehyde-verknoping om de eiwit-DNA-interacties te stabiliseren en sonicatie om het chromatine op te lossen voor latere zuivering. Samen sluiten beide manipulaties de mogelijkheid uit van latere structurele en functionele studies van het gezuiverde chromatine.
Om deze beperkingen te overwinnen, hebben we eerder een methodologie bedacht die plaatsspecifieke recombinatie gebruikt om gerichte chromosomale domeinen uit gist11,12 te extraheren. In wezen is het genomische gebied van belang omgeven door herkenningsplaatsen (RS) voor de plaatsspecifieke R-recombinase van Zygosaccharomyces rouxi, terwijl tegelijkertijd een groep van drie DNA-bindingsplaatsen voor het prokaryote transcriptionele repressor-LexA-eiwit (LexA) in dezelfde regio wordt opgenomen. De gistcellen bevatten een expressiecassette voor de gelijktijdige expressie van R-recombinase en een LexA-eiwit dat is gefuseerd met een tandem affiniteitszuivering (TAP)-tag. Na de inductie van R-recombinase snijdt het enzym het beoogde gebied efficiënt uit het chromosoom in de vorm van een cirkelvormig chromatinedomein. Dit domein kan worden gezuiverd via het LexA-TAP-adaptereiwit, dat zich bindt aan de LexA-DNA-bindingsplaatsen, evenals aan een affiniteitsondersteuning. Deze methode is onlangs gebruikt om verschillende chromatinedomeinen te isoleren die geselecteerde replicatie-oorsprong van gistchromosoom III13 bevatten.
Een groot voordeel van deze ex vivo benadering is dat het functionele analyses van het geïsoleerde materiaal mogelijk maakt. Replicatieoorsprongsdomeinen die met deze methode zijn gezuiverd, kunnen bijvoorbeeld worden onderworpen aan in-vitroreplicatietests om de efficiëntie van het afvuren van de oorsprong in een reageerbuis te beoordelen op basis van native in vivo geassembleerde chromatinesjablonen. Uiteindelijk kan de biochemische en functionele karakterisering van het geïsoleerde materiaal de reconstitutie van nucleaire processen mogelijk maken met behulp van gezuiverde eiwitten samen met het native chromatine-sjabloon. Samenvattend opent deze methodologie een opwindende weg in chromatine-onderzoek, omdat het mogelijk zal zijn om de collectieve samenstellings- en structurele chromatineveranderingen van een specifiek genoomgebied dat een bepaalde chromosomale transactie ondergaat, te volgen.
Protocol
Representative Results
Discussion
De identificatie van de factoren en het chromatinelandschap van een specifieke genomische doelregio blijft een grote uitdaging vormen in het chromatineonderzoek18. Dit protocol beschrijft een efficiënt systeem om specifiek verschillende chromatinedomeinen uit gistchromosomen te snijden en te zuiveren. Voor zover wij weten, overwinnen de zuiverheid en opbrengst van deze eenstapszuivering veel van de beperkingen van locusspecifieke chromatinezuiveringsmethoden, waardoor een zeer hoge verrijking van…
Declarações
The authors have nothing to disclose.
Acknowledgements
Het werk in het S.H.-laboratorium werd ondersteund door de DFG via SFB1064 (project-ID 213249687), de European Research Council (ERC Starting Grant 852798 ConflictResolution) en de Helmholtz Gesellschaft.
Materials
| Yeast strains | |||
| Control Strain: MATa; ura3Δ0; leu2Δ0; his3Δ1; met15Δ0; bar1::kanMX4; Chr I 212kb::LEU2 pTEF2-LEXA-TAP pGAL1-10 RecR | Section 1, see references 13 and 14 | ||
| Recombination Strain: MATa; ura3Δ0; leu2Δ0; his3Δ1; met15Δ0; bar1::kanMX4; RS_LEXA_NS-3_ARS316_NS+3_RS; Chr I 212kb::LEU2 pTEF2-LEXA-TAP pGAL1-10 RecR | Section 1, see reference 13 and 14 | ||
| Plasmid | |||
| K238 plasmid | Section 1, see reference 13 Storage: Store at -20 °C |
||
| K071 Spike-in plasmid DNA | Section 7.1, see reference 13 Storage: Store at -20 °C |
||
| Reagents | |||
| Acetone | Carl Roth | 5025.1 | Section 2 Storage: Store at room temperature |
| Ammonium acetate (NH4Ac) | Sigma Aldrich | A7262 | Section 6 and 7.1 Storage: Store at room temperature |
| Ammonium solution (NH4OH) 25% | Merck Millipore | 533003 | Section 6 Storage: Store at room temperature |
| Ammonium sulfate | Santa Cruz | Sc-29085 | Section 2 Storage: Store at room temperature |
| Bacto agar | BD (VWR) | 90000-760 | Section 3 Storage: Store at room temperature |
| Bacto peptone | BD (VWR) | 211820 | Section 3 Storage: Store at room temperature |
| β-Mercaptoethanol | Sigma Aldrich | 07604 | Section 7.2 Storage: Store at 4 °C |
| Chemiluminescent substrate kit | ThermoFisher | 34580 | Section 7.2 Storage: Store at 4 °C |
| Di-Sodium Hydrogen phosphate dodecahydrate | Merck | 1.06579.1000 | Section 2 and 7.1 Storage: Store at room temperature |
| Dithiothreitol (DTT) | ThermoFisher | 15508013 | Section 4 Storage: Store at 4 °C |
| Ethanol | Merck | 100983 | Section 7.1 Storage: Store at room temperature |
| Ethylenediaminetetraacetic acid (EDTA) | Sigma Aldrich | ED | Section 7.1 Storage: Store at room temperature |
| Galactose (20% (w/v) stock) | Sigma Aldrich | G0625-1KG / 5KG | Section 3 Storage: Store at room temperature |
| Gel loading dye (6x) | BioLabs | B7024A | Section 7.1 Storage: Store at -20 °C |
| Glusose | Sigma-Aldrich | G8270 | Section Storage: Store at room temperature |
| Glycine | Carl Roth | .0079.4 | Section 2 Storage: Store at room temperature |
| Glycogen (5 mg/mL) | Invitrogen | AM9510 | Section 7.1 Storage: Store at -20 °C |
| Hydrochloric acid (HCl) | PanReac AppliChem | 182109.1211 | Section 2, 4 and 7.1 Storage: Store at room temperature |
| Magnesium Acetate (MgAc) | Bernd Kraft | 15274.2600/C035 | Section 4 Storage: Store at room temperature |
| Magnesium chloride (MgCl2) | Sigma Aldrich | M8266 | Section 6 Storage: Store at room temperature |
| Nu PAGE LDS sample buffer (4x) | Invitrogen | 2399549 | Section 7.2 Storage: Store at room temperature |
| Phenol/Chloroform/Isoamyl alcohol (25:24:1 v/v) | Invitrogen | 15593-031 | Section 7.1 Storage: Store at 4 °C |
| Potassium chloride (KCl) | Sigma | P9541 | Section 4 Storage: Store at room temperature |
| Radioactively labeled α-32P dATP (3,000 Ci/mmol, 10 mCi/mL) | Hartmann Analytic | SRP-203 | Section 7.1 Storage: Store at 4 °C |
| RadPrime labeling system | ThermoFisher | 18428-011 | Section 7.1 Storage: Store at -20 °C |
| Raffinose (20% (w/v) stock) | SERVA | 34140.03 | Section 3 Storage: Store at room temperature |
| Sodium chloride (NaCl) | Merck | K53710504142 | Section 7.1 Storage: Store at room temperature |
| Sodium citrate (Na3C6H5O7) | Sigma-Aldrich | 71402 | Section 7.1 Storage: Store at room temperature |
| Sodium hydroxide (NaOH) | Sigma Aldrich | S5881 | Section 7.1 Storage: Store at room temperature |
| Sodium n-dodecyl sulfate (SDS) (5% stock (w/v) ) | Alfa Aesar | A11183 | Section 7.1 Storage: Store at room temperature |
| Sodium phosphate monobasic | Sigma-Aldrich | 71496 | Section 2 and 7.1 Storage: Store at room temperature |
| Sodium azide | Santa Cruz Biotechnology | sc-208393 | Section 2 Storage: Store at -20 °C |
| Triethylamine | Sigma Aldrich | 90340 | Section 2 Storage: Store at room temperature |
| Tris base | Chem Cruz | SC-3715B | Section 2 and 4 Storage: Store at room temperature |
| Triton X-100 | Sigma Aldrich | X100 | Section 2 and 4 Storage: Store at room temperature |
| Tween-20 | Bernd Kraft | 18014332 | Section 4 Storage: Store at room temperature |
| Yeast extract | BD (VWR) | 212720 | Section 3 Storage: Store at room temperature |
| Yeast mating factor alpha (1 µg/mL stock ) | Biomol | Y2016.5 | Section 3 Storage: Store at -20 °C |
| Yeast Synthetic Drop-out medium Supplements without LEUCINE | Sigma Aldrich | Y1376 | Section 1, see reference 14 |
| Enzymes | |||
| HpaI restriction enzyme (5,000 U/mL) | NEB | R0105S | Section 7.1 Storage: Store at -20 °C |
| Protease and Phosphatase Inhibitor Cocktail (100x) | ThermoFisher Scientific | 78446 | Section 4 Storage: Store at4 °C |
| Proteinase K (10 mg/mL) | SERVA | 33756 | Section 7.1 Storage: Store at -20 °C |
| RNase A (10 mg/mL) | ThermoFisher | EN0531 | Section 7.1 Storage: Store at -20 °C |
| TEV protease (10000 U/µL) | NEB | P8112S | Section 5 Storage: Store at -20 °C |
| Materials | |||
| BcMag Epoxy-Activated Magnetic Beads | Bioclone Inc. | FC-102 | Section 2 Storage: Store at 4 °C |
| Dry ice | Section 4 | ||
| Low-binding centrifuge tubes 2.0 mL | Eppendorf | 22431102 | Section 4 |
| Microspin G-25 Columns | Cytiva | 27-5325-01 | Section 7.1 Storage: Store at room temperature |
| Parafilm | Merck | P7793 | Section 4 |
| Positive nylon membrane | Biozol | 11MEMP0001 | Section 7.1 Storage: Store at room temperature |
| PVDF transfer membrane | Immobilon-Merck Millipore | IPVH00010 | Section 7.2 Storage: Store at room temperature |
| SDS-PAGE gel 4-12% bis-tris (15 well, 1.5 mm) | Invitrogen | NP0336BOX | Section 7.2 Storage: Store at 4 °C |
| Syringe (25 mL) with luer fitting | Henke Sass Wolf | 4200-000V0 | Section 3 |
| Whatman paper (Grade 3MM CHR Cellulose Western Blotting Paper Sheet) | Cytiva | 3030-917 | Section 7.1 Storage: Store at room temperature |
| Antibodies | |||
| Anti-LexA, rabbit polyclonal IgG, DNA binding region antibody | Merck Millipore | 06-719 | Section 7.2 Storage: Store at -20 °C |
| Goat Anti-Rabbit IgG (H+L), Horseradish peroxidase conjugate | Invitrogen | G21234 | Section 7.2 Storage: Store at -20 °C |
| Peroxidase Anti-Peroxidase (PAP) antibody produced in rabbit for the detection of TAP-tagged proteins | Sigma Aldrich | P1291-500UL | Section 7.2 Storage: Store at -20 °C |
| Rabbit IgG antibodies | Sigma | I5006-100MG | Section 2 Storage: Store at 4 °C |
| Primers (10 µM) | |||
| ARS316: fwd 5'- CGGCATTATCGTACACAACCT, rev 5'- GTTCTTCGTTGCCTACATTTTCT | Section 7.1 | ||
| K071 Spike-in plasmid DNA: fwd: 5'-TTTTCGCTGCTTGTCCTTTT, rev 5'- CATTTTCGTCCTCCCAACAT | Section 7.1 | ||
| PCR fragment from yeast genomic DNA as a template for ARS316 amplification (for southern blot): fwd 5’- AAATTCTGCCCTTGATTCGT rev 5’- TTTGTTTATCTCATCACTAAT | Section 7.1 | ||
| PDC1: fwd 5'- CATGATCAGATGGGGCTTCA, rev 5'-ACCGGTGGTAGCGACTCTGT | Section 7.1 | ||
| Equipment | |||
| Coffee grinder | Gastroback | 42601 | Section 4 |
| Dewar flask | NAL GENE | 4150-2000 | Section 3 |
| DynaMag TM-2 magnetic rack | Invitrogen | 12321D | Section 4, 5 and 6 |
| Hybridization oven | Hybaid Mini10 | Ri418 | Section 2 |
| Microcentrifuge | Eppendorf | 5424R | Section 4 and 7.1 |
| UV-crosslinker | Analytikjena | 95-0174-02 | Section 7.1 |
Referências
- Kornberg, R. D., Lorch, Y. Twenty-five years of the nucleosome, fundamental particle of the eukaryote chromosome. Cell. 98 (3), 285-294 (1999).
- Gauchier, M., van Mierlo, G., Vermeulen, M., Déjardin, J. Purification and enrichment of specific chromatin loci. Nature Methods. 17 (4), 380-389 (2020).
- Korthout, T., et al. Decoding the chromatin proteome of a single genomic locus by DNA sequencing. PLoS Biology. 16 (7), e2005542 (2018).
- Antão, J. M., Mason, J. M., Déjardin, J., Kingston, R. E. Protein landscape at Drosophila melanogaster telomere-associated sequence repeats. Molecular and Cellular Biology. 32 (12), 2170-2182 (2012).
- Déjardin, J., Kingston, R. E. Purification of proteins associated with specific genomic loci. Cell. 136 (1), 175-186 (2009).
- Ide, S., Dejardin, J. End-targeting proteomics of isolated chromatin segments of a mammalian ribosomal RNA gene promoter. Nature Communications. 6, 6674 (2015).
- Unnikrishnan, A., Gafken, P. R., Tsukiyama, T. Dynamic changes in histone acetylation regulate origins of DNA replication. Nature Structural & Molecular Biology. 17 (4), 430 (2010).
- Buxton, K. E., et al. Elucidating protein-DNA interactions in human alphoid chromatin via hybridization capture and mass spectrometry. Journal of Proteome Research. 16 (9), 3433-3442 (2017).
- Kennedy-Darling, J., et al. Discovery of chromatin-associated proteins via sequence-specific capture and mass spectrometric protein identification in Saccharomyces cerevisiae. Journal of Proteome Research. 13 (8), 3810-3825 (2014).
- Liu, S. J., et al. CRISPRi-based genome-scale identification of functional long noncoding RNA loci in human cells. Science. 355, 7111 (2017).
- Hamperl, S., et al. Purification of specific chromatin domains from single-copy gene loci in Saccharomyces cerevisiae. Functional Analysis of DNA and Chromatin. 1094, 329-341 (2014).
- Hamperl, S., et al. Compositional and structural analysis of selected chromosomal domains from Saccharomyces cerevisiae. Nucleic Acids Research. 42 (1), 2 (2014).
- Weiβ, M. Single-copy locus proteomics of early- and late-firing DNA replication origins identifies a role of Ask1/DASH complex in replication timing control. Cell Reports. 42 (2), 112045 (2023).
- Gietz, R. D., Schiestl, R. H. High-efficiency yeast transformation using the LiAc/SS carrier DNA/PEG method. Nature Protocols. 2 (1), 31-34 (2007).
- Laemmli, U. K. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature. 227 (5259), 680-685 (1970).
- Towbin, H., Staehelin, T., Gordon, J. Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proceedings of the National Academy of Sciences of the United States of America. 76 (9), 4350-4354 (1979).
- Western blot membrane stripping for restaining protocol. Abcam Available from: https://www.abcam.com/protocols/western-blot-membrane-stripping-for-restaining-protocol (2023)
- Vermeulen, M., Déjardin, J. Locus-specific chromatin isolation. Nature Reviews. Molecular Cell Biology. 21 (5), 249-250 (2020).
