Einzelkopien-Genlocus-Chromatin-Aufreinigung in Saccharomyces cerevisiae
Summary
Dieses Protokoll stellt eine Locus-spezifische Chromatin-Isolierungsmethode vor, die auf ortsspezifischer Rekombination basiert, um einen interessierenden Single-Copy-Genlocus in seinem nativen Chromatinkontext aus knospender Hefe, Saccharomyces cerevisiae, zu reinigen.
Abstract
Die grundlegende Organisationseinheit des eukaryotischen Chromatins ist das Nukleosomenkernpartikel (NCP), das aus DNA besteht, die ~1,7-mal um ein Histon-Oktamer gewickelt ist. Chromatin ist definiert als die Entität von NCPs und zahlreichen anderen Proteinkomplexen, einschließlich Transkriptionsfaktoren, Chromatin-Remodeling und modifizierenden Enzymen. Es ist noch unklar, wie diese Protein-DNA-Interaktionen auf der Ebene spezifischer genomischer Loci in verschiedenen Stadien des Zellzyklus orchestriert werden. Dies ist vor allem auf die derzeitigen technischen Einschränkungen zurückzuführen, die es schwierig machen, präzise Messungen solcher dynamischen Wechselwirkungen zu erhalten. Hier beschreiben wir eine verbesserte Methode, die ortsspezifische Rekombination mit einem effizienten einstufigen Affinitätsreinigungsprotokoll kombiniert, um einen Genlocus von Interesse in seinem nativen Chromatinzustand zu isolieren. Die Methode ermöglicht die robuste Anreicherung des Zielortes über genomisches Chromatin, was diese Technik zu einer effektiven Strategie zur unvoreingenommenen und systematischen Identifizierung und Quantifizierung von Proteininteraktionen macht, z. B. durch Massenspektrometrie. Zusätzlich zu solchen Zusammensetzungsanalysen spiegelt natives Chromatin, das mit dieser Methode gereinigt wurde, wahrscheinlich die In-vivo-Situation in Bezug auf Nukleosomenpositionierung und Histonmodifikationen wider und ist daher für weitere strukturelle und biochemische Analysen von Chromatin zugänglich, das von praktisch jedem genomischen Locus in Hefe stammt.
Introduction
Die dynamische Organisation eukaryotischer Genome in Chromatin verdichtet die DNA, um in die Grenzen des Zellkerns zu passen, während gleichzeitig eine ausreichende Dynamik für die Genexpression und die Zugänglichkeit für regulatorische Faktoren gewährleistet wird. Diese Vielseitigkeit wird zum Teil durch das Nukleosom vermittelt, die Grundeinheit des Chromatins, das aus einem Kernpartikel mit 147 bp DNA besteht, das ~1,7-mal um das Histon-Oktamer1 gewickelt ist. Das Nukleosom ist eine hochdynamische Struktur in Bezug auf seine Zusammensetzung, mit zahlreichen Histonvarianten und posttranslationalen Modifikationen (PTMs) an den N- und C-terminalen Histonschwänzen. Darüber hinaus interagiert das eukaryotische Chromatin mit einer Vielzahl anderer essentieller Komponenten, wie z. B. Transkriptionsfaktoren, DNA- und RNA-Verarbeitungsmaschinen, Architekturproteinen, Enzymen, die am Umbau und der Modifikation von Chromatin beteiligt sind, und RNA-Molekülen, die mit Chromatin assoziiert sind. Diese wichtigen Mechanismen, die an der Transkription, Replikation und Reparatur beteiligt sind, benötigen alle Zugang zu Chromatin, das als natürliches Substrat für diese Prozesse dient. Um die molekularen Mechanismen zu verstehen, die diesen DNA-Transaktionen zugrunde liegen, ist daher eine genaue Definition der kollektiven Veränderungen in der Chromatinstruktur in den spezifischen Genomregionen erforderlich, in denen diese Maschinerien konvergieren und biologische Reaktionen erleichtern.
Trotz der Identifizierung zahlreicher Chromatinfaktoren durch genetische und Protein-Protein-Interaktionsstudien ist die Durchführung direkter, unvoreingenommener und umfassender Analysen von Chromatininteraktionen an bestimmten genomischen Stellen nach wie vor ein erhebliches Hindernis 2,3. Ursprünglich konnten nur sehr häufig vorkommende Regionen des Genoms (d.h. repetitive Loci) oder Multikopienplasmide in ausreichender Menge und Reinheit für die massenspektrometrische Identifizierung der assoziierten Proteine isoliertwerden 4,5,6,7. Eine Reihe neuer Ansätze, die auf der direkten Hybridisierung von Fängersonden mit chromatinisierter DNA, der Proximity-Biotinylierung mit dem CRISPR-dCas9-System oder der Bindung sequenzspezifischer Adapterproteine an den interessierenden Locus basieren, haben begonnen, das Proteom von Einzelkopien-Loci aus Hefe- und Säugetiergenomen zu entschlüsseln 8,9,10. Alle diese Methoden erfordern jedoch eine Formaldehydvernetzung, um die Protein-DNA-Wechselwirkungen zu stabilisieren, und eine Beschallung, um das Chromatin für die anschließende Reinigung zu lösen. Beide Manipulationen zusammen schließen die Möglichkeit nachfolgender struktureller und funktioneller Studien des gereinigten Chromatins aus.
Um diese Einschränkungen zu überwinden, haben wir zuvor eine Methode entwickelt, die ortsspezifische Rekombination verwendet, um gezielte chromosomale Domänen aus Hefe zu extrahieren11,12. Im Wesentlichen ist die interessierende genomische Region von Erkennungsstellen (RS) für die ortsspezifische R-Rekombinase aus Zygosaccharomyces rouxi umgeben, während gleichzeitig eine Gruppe von drei DNA-Bindungsstellen für den prokaryotischen Transkriptionsrepressor LexA-Protein (LexA) innerhalb derselben Region eingebaut wird. Die Hefezellen enthalten eine Expressionskassette für die gleichzeitige Expression von R-Rekombinase und einem LexA-Protein, das mit einem Tandem-Affinitätsreinigungstag (TAP) fusioniert ist. Nach der Induktion der R-Rekombinase schneidet das Enzym die Zielregion in Form einer zirkulären Chromatindomäne effizient aus dem Chromosom heraus. Diese Domäne kann über das LexA-TAP-Adapterprotein, das an die LexA-DNA-Bindungsstellen bindet, sowie an einen Affinitätsträger gereinigt werden. Diese Methode wurde kürzlich verwendet, um verschiedene Chromatindomänen zu isolieren, die ausgewählte Replikationsursprünge des Hefechromosoms III13 enthalten.
Ein großer Vorteil dieses Ex-vivo-Ansatzes besteht darin, dass er funktionelle Analysen des isolierten Materials ermöglicht. Zum Beispiel können Replikationsursprungsdomänen, die mit dieser Methode gereinigt wurden, In-vitro-Replikationsassays unterzogen werden, um die Effizienz des Ursprungsfeuers in einem Reagenzglas aus nativen in vivo assemblierten Chromatin-Matrizen zu bewerten. Letztendlich könnte die biochemische und funktionelle Charakterisierung des isolierten Materials die Rekonstitution von Kernprozessen unter Verwendung von gereinigten Proteinen zusammen mit dem nativen Chromatin-Template ermöglichen. Zusammenfassend lässt sich sagen, dass diese Methodik einen spannenden Weg in der Chromatinforschung eröffnet, da es möglich sein wird, die kollektiven Veränderungen der Zusammensetzung und der Struktur des Chromatins einer bestimmten Genomregion zu verfolgen, die eine bestimmte chromosomale Transaktion durchläuft.
Protocol
Representative Results
Discussion
Die Identifizierung der Faktoren und der Chromatinlandschaft einer bestimmten genomischen Zielregion stellt nach wie vor eine große Herausforderung in der Chromatinforschungdar 18. Dieses Protokoll beschreibt ein effizientes System zur gezielten Exzision und Reinigung bestimmter Chromatindomänen aus Hefechromosomen. Unseres Wissens nach überwinden die Reinheit und Ausbeute dieser einstufigen Aufreinigung viele der Einschränkungen von Locus-spezifischen Chromatin-Aufreinigungsmethoden, wodurch …
Declarações
The authors have nothing to disclose.
Acknowledgements
Die Arbeiten im S.H.-Labor wurden von der DFG durch SFB1064 (Projekt-ID 213249687), den Europäischen Forschungsrat (ERC Starting Grant 852798 ConflictResolution) und die Helmholtz Gesellschaft unterstützt.
Materials
| Yeast strains | |||
| Control Strain: MATa; ura3Δ0; leu2Δ0; his3Δ1; met15Δ0; bar1::kanMX4; Chr I 212kb::LEU2 pTEF2-LEXA-TAP pGAL1-10 RecR | Section 1, see references 13 and 14 | ||
| Recombination Strain: MATa; ura3Δ0; leu2Δ0; his3Δ1; met15Δ0; bar1::kanMX4; RS_LEXA_NS-3_ARS316_NS+3_RS; Chr I 212kb::LEU2 pTEF2-LEXA-TAP pGAL1-10 RecR | Section 1, see reference 13 and 14 | ||
| Plasmid | |||
| K238 plasmid | Section 1, see reference 13 Storage: Store at -20 °C |
||
| K071 Spike-in plasmid DNA | Section 7.1, see reference 13 Storage: Store at -20 °C |
||
| Reagents | |||
| Acetone | Carl Roth | 5025.1 | Section 2 Storage: Store at room temperature |
| Ammonium acetate (NH4Ac) | Sigma Aldrich | A7262 | Section 6 and 7.1 Storage: Store at room temperature |
| Ammonium solution (NH4OH) 25% | Merck Millipore | 533003 | Section 6 Storage: Store at room temperature |
| Ammonium sulfate | Santa Cruz | Sc-29085 | Section 2 Storage: Store at room temperature |
| Bacto agar | BD (VWR) | 90000-760 | Section 3 Storage: Store at room temperature |
| Bacto peptone | BD (VWR) | 211820 | Section 3 Storage: Store at room temperature |
| β-Mercaptoethanol | Sigma Aldrich | 07604 | Section 7.2 Storage: Store at 4 °C |
| Chemiluminescent substrate kit | ThermoFisher | 34580 | Section 7.2 Storage: Store at 4 °C |
| Di-Sodium Hydrogen phosphate dodecahydrate | Merck | 1.06579.1000 | Section 2 and 7.1 Storage: Store at room temperature |
| Dithiothreitol (DTT) | ThermoFisher | 15508013 | Section 4 Storage: Store at 4 °C |
| Ethanol | Merck | 100983 | Section 7.1 Storage: Store at room temperature |
| Ethylenediaminetetraacetic acid (EDTA) | Sigma Aldrich | ED | Section 7.1 Storage: Store at room temperature |
| Galactose (20% (w/v) stock) | Sigma Aldrich | G0625-1KG / 5KG | Section 3 Storage: Store at room temperature |
| Gel loading dye (6x) | BioLabs | B7024A | Section 7.1 Storage: Store at -20 °C |
| Glusose | Sigma-Aldrich | G8270 | Section Storage: Store at room temperature |
| Glycine | Carl Roth | .0079.4 | Section 2 Storage: Store at room temperature |
| Glycogen (5 mg/mL) | Invitrogen | AM9510 | Section 7.1 Storage: Store at -20 °C |
| Hydrochloric acid (HCl) | PanReac AppliChem | 182109.1211 | Section 2, 4 and 7.1 Storage: Store at room temperature |
| Magnesium Acetate (MgAc) | Bernd Kraft | 15274.2600/C035 | Section 4 Storage: Store at room temperature |
| Magnesium chloride (MgCl2) | Sigma Aldrich | M8266 | Section 6 Storage: Store at room temperature |
| Nu PAGE LDS sample buffer (4x) | Invitrogen | 2399549 | Section 7.2 Storage: Store at room temperature |
| Phenol/Chloroform/Isoamyl alcohol (25:24:1 v/v) | Invitrogen | 15593-031 | Section 7.1 Storage: Store at 4 °C |
| Potassium chloride (KCl) | Sigma | P9541 | Section 4 Storage: Store at room temperature |
| Radioactively labeled α-32P dATP (3,000 Ci/mmol, 10 mCi/mL) | Hartmann Analytic | SRP-203 | Section 7.1 Storage: Store at 4 °C |
| RadPrime labeling system | ThermoFisher | 18428-011 | Section 7.1 Storage: Store at -20 °C |
| Raffinose (20% (w/v) stock) | SERVA | 34140.03 | Section 3 Storage: Store at room temperature |
| Sodium chloride (NaCl) | Merck | K53710504142 | Section 7.1 Storage: Store at room temperature |
| Sodium citrate (Na3C6H5O7) | Sigma-Aldrich | 71402 | Section 7.1 Storage: Store at room temperature |
| Sodium hydroxide (NaOH) | Sigma Aldrich | S5881 | Section 7.1 Storage: Store at room temperature |
| Sodium n-dodecyl sulfate (SDS) (5% stock (w/v) ) | Alfa Aesar | A11183 | Section 7.1 Storage: Store at room temperature |
| Sodium phosphate monobasic | Sigma-Aldrich | 71496 | Section 2 and 7.1 Storage: Store at room temperature |
| Sodium azide | Santa Cruz Biotechnology | sc-208393 | Section 2 Storage: Store at -20 °C |
| Triethylamine | Sigma Aldrich | 90340 | Section 2 Storage: Store at room temperature |
| Tris base | Chem Cruz | SC-3715B | Section 2 and 4 Storage: Store at room temperature |
| Triton X-100 | Sigma Aldrich | X100 | Section 2 and 4 Storage: Store at room temperature |
| Tween-20 | Bernd Kraft | 18014332 | Section 4 Storage: Store at room temperature |
| Yeast extract | BD (VWR) | 212720 | Section 3 Storage: Store at room temperature |
| Yeast mating factor alpha (1 µg/mL stock ) | Biomol | Y2016.5 | Section 3 Storage: Store at -20 °C |
| Yeast Synthetic Drop-out medium Supplements without LEUCINE | Sigma Aldrich | Y1376 | Section 1, see reference 14 |
| Enzymes | |||
| HpaI restriction enzyme (5,000 U/mL) | NEB | R0105S | Section 7.1 Storage: Store at -20 °C |
| Protease and Phosphatase Inhibitor Cocktail (100x) | ThermoFisher Scientific | 78446 | Section 4 Storage: Store at4 °C |
| Proteinase K (10 mg/mL) | SERVA | 33756 | Section 7.1 Storage: Store at -20 °C |
| RNase A (10 mg/mL) | ThermoFisher | EN0531 | Section 7.1 Storage: Store at -20 °C |
| TEV protease (10000 U/µL) | NEB | P8112S | Section 5 Storage: Store at -20 °C |
| Materials | |||
| BcMag Epoxy-Activated Magnetic Beads | Bioclone Inc. | FC-102 | Section 2 Storage: Store at 4 °C |
| Dry ice | Section 4 | ||
| Low-binding centrifuge tubes 2.0 mL | Eppendorf | 22431102 | Section 4 |
| Microspin G-25 Columns | Cytiva | 27-5325-01 | Section 7.1 Storage: Store at room temperature |
| Parafilm | Merck | P7793 | Section 4 |
| Positive nylon membrane | Biozol | 11MEMP0001 | Section 7.1 Storage: Store at room temperature |
| PVDF transfer membrane | Immobilon-Merck Millipore | IPVH00010 | Section 7.2 Storage: Store at room temperature |
| SDS-PAGE gel 4-12% bis-tris (15 well, 1.5 mm) | Invitrogen | NP0336BOX | Section 7.2 Storage: Store at 4 °C |
| Syringe (25 mL) with luer fitting | Henke Sass Wolf | 4200-000V0 | Section 3 |
| Whatman paper (Grade 3MM CHR Cellulose Western Blotting Paper Sheet) | Cytiva | 3030-917 | Section 7.1 Storage: Store at room temperature |
| Antibodies | |||
| Anti-LexA, rabbit polyclonal IgG, DNA binding region antibody | Merck Millipore | 06-719 | Section 7.2 Storage: Store at -20 °C |
| Goat Anti-Rabbit IgG (H+L), Horseradish peroxidase conjugate | Invitrogen | G21234 | Section 7.2 Storage: Store at -20 °C |
| Peroxidase Anti-Peroxidase (PAP) antibody produced in rabbit for the detection of TAP-tagged proteins | Sigma Aldrich | P1291-500UL | Section 7.2 Storage: Store at -20 °C |
| Rabbit IgG antibodies | Sigma | I5006-100MG | Section 2 Storage: Store at 4 °C |
| Primers (10 µM) | |||
| ARS316: fwd 5'- CGGCATTATCGTACACAACCT, rev 5'- GTTCTTCGTTGCCTACATTTTCT | Section 7.1 | ||
| K071 Spike-in plasmid DNA: fwd: 5'-TTTTCGCTGCTTGTCCTTTT, rev 5'- CATTTTCGTCCTCCCAACAT | Section 7.1 | ||
| PCR fragment from yeast genomic DNA as a template for ARS316 amplification (for southern blot): fwd 5’- AAATTCTGCCCTTGATTCGT rev 5’- TTTGTTTATCTCATCACTAAT | Section 7.1 | ||
| PDC1: fwd 5'- CATGATCAGATGGGGCTTCA, rev 5'-ACCGGTGGTAGCGACTCTGT | Section 7.1 | ||
| Equipment | |||
| Coffee grinder | Gastroback | 42601 | Section 4 |
| Dewar flask | NAL GENE | 4150-2000 | Section 3 |
| DynaMag TM-2 magnetic rack | Invitrogen | 12321D | Section 4, 5 and 6 |
| Hybridization oven | Hybaid Mini10 | Ri418 | Section 2 |
| Microcentrifuge | Eppendorf | 5424R | Section 4 and 7.1 |
| UV-crosslinker | Analytikjena | 95-0174-02 | Section 7.1 |
Referências
- Kornberg, R. D., Lorch, Y. Twenty-five years of the nucleosome, fundamental particle of the eukaryote chromosome. Cell. 98 (3), 285-294 (1999).
- Gauchier, M., van Mierlo, G., Vermeulen, M., Déjardin, J. Purification and enrichment of specific chromatin loci. Nature Methods. 17 (4), 380-389 (2020).
- Korthout, T., et al. Decoding the chromatin proteome of a single genomic locus by DNA sequencing. PLoS Biology. 16 (7), e2005542 (2018).
- Antão, J. M., Mason, J. M., Déjardin, J., Kingston, R. E. Protein landscape at Drosophila melanogaster telomere-associated sequence repeats. Molecular and Cellular Biology. 32 (12), 2170-2182 (2012).
- Déjardin, J., Kingston, R. E. Purification of proteins associated with specific genomic loci. Cell. 136 (1), 175-186 (2009).
- Ide, S., Dejardin, J. End-targeting proteomics of isolated chromatin segments of a mammalian ribosomal RNA gene promoter. Nature Communications. 6, 6674 (2015).
- Unnikrishnan, A., Gafken, P. R., Tsukiyama, T. Dynamic changes in histone acetylation regulate origins of DNA replication. Nature Structural & Molecular Biology. 17 (4), 430 (2010).
- Buxton, K. E., et al. Elucidating protein-DNA interactions in human alphoid chromatin via hybridization capture and mass spectrometry. Journal of Proteome Research. 16 (9), 3433-3442 (2017).
- Kennedy-Darling, J., et al. Discovery of chromatin-associated proteins via sequence-specific capture and mass spectrometric protein identification in Saccharomyces cerevisiae. Journal of Proteome Research. 13 (8), 3810-3825 (2014).
- Liu, S. J., et al. CRISPRi-based genome-scale identification of functional long noncoding RNA loci in human cells. Science. 355, 7111 (2017).
- Hamperl, S., et al. Purification of specific chromatin domains from single-copy gene loci in Saccharomyces cerevisiae. Functional Analysis of DNA and Chromatin. 1094, 329-341 (2014).
- Hamperl, S., et al. Compositional and structural analysis of selected chromosomal domains from Saccharomyces cerevisiae. Nucleic Acids Research. 42 (1), 2 (2014).
- Weiβ, M. Single-copy locus proteomics of early- and late-firing DNA replication origins identifies a role of Ask1/DASH complex in replication timing control. Cell Reports. 42 (2), 112045 (2023).
- Gietz, R. D., Schiestl, R. H. High-efficiency yeast transformation using the LiAc/SS carrier DNA/PEG method. Nature Protocols. 2 (1), 31-34 (2007).
- Laemmli, U. K. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature. 227 (5259), 680-685 (1970).
- Towbin, H., Staehelin, T., Gordon, J. Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proceedings of the National Academy of Sciences of the United States of America. 76 (9), 4350-4354 (1979).
- Western blot membrane stripping for restaining protocol. Abcam Available from: https://www.abcam.com/protocols/western-blot-membrane-stripping-for-restaining-protocol (2023)
- Vermeulen, M., Déjardin, J. Locus-specific chromatin isolation. Nature Reviews. Molecular Cell Biology. 21 (5), 249-250 (2020).
