رسم خرائط الشبكات الوظيفية البكتيرية والممرات في<em> كولاي</em> استخدام المصفوفات الوراثية الاصطناعية
Summary
ويمكن استخدام منهجية واسعة النطاق الاصطناعية الوراثية شاشات التفاعل (الجينات الجين أو قشوة) لاستكشاف التكرار الجيني وعبر مسار الحديث. ووصف eSGA هنا، نحن تصف عالية الإنتاجية الكمية الاصطناعية الفحص الجيني مجموعة التكنولوجيا، التي قمنا بتطويرها لتوضيح العلاقات واستكشاف روكبي شبكات التفاعل الوراثية في<em> كولاي</em>.
Abstract
Phenotypes are determined by a complex series of physical (e.g. protein-protein) and functional (e.g. gene-gene or genetic) interactions (GI)1. While physical interactions can indicate which bacterial proteins are associated as complexes, they do not necessarily reveal pathway-level functional relationships1. GI screens, in which the growth of double mutants bearing two deleted or inactivated genes is measured and compared to the corresponding single mutants, can illuminate epistatic dependencies between loci and hence provide a means to query and discover novel functional relationships2. Large-scale GI maps have been reported for eukaryotic organisms like yeast3-7, but GI information remains sparse for prokaryotes8, which hinders the functional annotation of bacterial genomes. To this end, we and others have developed high-throughput quantitative bacterial GI screening methods9, 10.
Here, we present the key steps required to perform quantitative E. coli Synthetic Genetic Array (eSGA) screening procedure on a genome-scale9, using natural bacterial conjugation and homologous recombination to systemically generate and measure the fitness of large numbers of double mutants in a colony array format. Briefly, a robot is used to transfer, through conjugation, chloramphenicol (Cm) – marked mutant alleles from engineered Hfr (High frequency of recombination) ‘donor strains’ into an ordered array of kanamycin (Kan) – marked F- recipient strains. Typically, we use loss-of-function single mutants bearing non-essential gene deletions (e.g. the ‘Keio’ collection11) and essential gene hypomorphic mutations (i.e. alleles conferring reduced protein expression, stability, or activity9, 12, 13) to query the functional associations of non-essential and essential genes, respectively. After conjugation and ensuing genetic exchange mediated by homologous recombination, the resulting double mutants are selected on solid medium containing both antibiotics. After outgrowth, the plates are digitally imaged and colony sizes are quantitatively scored using an in-house automated image processing system14. GIs are revealed when the growth rate of a double mutant is either significantly better or worse than expected9. Aggravating (or negative) GIs often result between loss-of-function mutations in pairs of genes from compensatory pathways that impinge on the same essential process2. Here, the loss of a single gene is buffered, such that either single mutant is viable. However, the loss of both pathways is deleterious and results in synthetic lethality or sickness (i.e. slow growth). Conversely, alleviating (or positive) interactions can occur between genes in the same pathway or protein complex2 as the deletion of either gene alone is often sufficient to perturb the normal function of the pathway or complex such that additional perturbations do not reduce activity, and hence growth, further. Overall, systematically identifying and analyzing GI networks can provide unbiased, global maps of the functional relationships between large numbers of genes, from which pathway-level information missed by other approaches can be inferred9.
Protocol
Representative Results
Discussion
وقد أوجزنا بروتوكول تدريجي لاستخدام الروبوتية eSGA الفحص الجيني للتحقيق في وظائف البكتيرية على مستوى المسار من خلال استجواب GI. ويمكن استخدام هذا النهج لدراسة الجينات الفردية وكذلك في النظم البيولوجية بأكمله E. القولونية. تنفيذ الخطوات بعناية التجريبية المذكورة ?…
Disclosures
The authors have nothing to disclose.
Acknowledgements
وأيد هذا العمل من جانب صناديق من كندا الجينوم، ومعهد أونتاريو علم الجينوم، والمعاهد الكندية لأبحاث الصحة لمنح JG وAG AE هي المستفيدة من منحة الدراسات العليا فانييه كندا.
Materials
| I. Antibiotics | 2 | 36471 Remove |
||||
| Chloramphenicol | Bioshop | #CLR201 | 3 | 36472 Remove |
||
| Kanamycin | #KAN201 | 4 | 36480 Remove |
|||
| Ampicillin | # AMP201 | 5 | 36473 Remove |
|||
| 2. Luria-Bertani medium | 6 | 36474 Remove |
||||
| LB powder | Bioshop | #LBL405 | 7 | 36478 Remove |
||
| Agar | Bioshop | #AGR003 | 8 | 36481 Remove |
||
| 3. Bacterial Strains and Plasmids | 9 | 36475 Remove |
||||
| Hfr Cavalli strain λred system (JL238) | Babu et al.14. | 10 | 36476 Remove |
|||
| pKD3 | E. coli Genetic Stock Centre, Yale | 11 | 36477 Remove |
|||
| Keio E. coli F- recipient collection | National BioResource Project (NBRP) of Japan11 | 12 | 36479 Remove |
|||
| Hypomorphic E. coli F- SPA-tag strains | Open biosystems; Babu et al.14 | 13 | 36491 Remove |
|||
| 4. Primers | 14 | 36486 Remove |
||||
| pKD3-based desalted constant primers | F1: 5′-GGCTGACATGGGAATTAGC-3′ R1: 5′-AGATTGCAGCATTACACGTCTT-3′ |
15 | 36482 Remove |
|||
| Desalted custom primers | Cm-R: 5′-TTATACGCAAGGCGACAAGG-3′ Cm-F: 5′- GATCTTCCGTCACAGGTAGG-3′ |
16 | 36483 Remove |
|||
| Desalted custom primers | F2 and R2: 20 nt constant regions based on pKD3 sequence and 45 nt custom homology regions F2 constant region: 5′-CATATGAATATCCTCCTTA-3′ R2 constant region: 5′-TGTGTAGGCTGGAGCTGCTTC-3’S1 and S2: 27 nt constant regions for priming the amplification of the SPA-Cm cassette and 45 nt custom homology regions S1 constant region: 5’AGCTGGAGGATCCATGGAAAAGAGAAG -3′ S2 constant region: 5′- GGCCCCATATGAATATCCTCCTTAGTT -3′ KOCO-F and KOCO-C: 20 nt primers 200 bp away from the non-essential gene deletion site or the essential gene SPA-tag insertion site |
17 | 36484 Remove |
|||
| 5. PCR and Electrophoresis Reagents | 18 | 36485 Remove |
||||
| Taq DNA polymerase | Fermentas | # EP0281 | 19 | 36487 Remove |
||
| 10X PCR buffer | Fermentas | # EP0281 | 20 | 36488 Remove |
||
| 10 mM dNTPs | Fermentas | # EP0281 | 21 | 36489 Remove |
||
| 25 mM MgCl2 | Fermentas | # EP0281 | 22 | 36490 Remove |
||
| Agarose | Bioshop | # AGA002 | 23 | 36492 Remove |
||
| Loading dye | NEB | #B7021S | 24 | 36493 Remove |
||
| Ethidium bromide | Bioshop | # ETB444 | 25 | 36497 Remove |
||
| 10X TBE buffer | Bioshop | # ETB444.10 | 26 | 36494 Remove |
||
| Tris Base | Bioshop | # TRS001 | 27 | 36495 Remove |
||
| Boric acid | Sigma | # T1503-1KG | 28 | 36496 Remove |
||
| 0.5 M EDTA (pH 8.0) | Sigma | # B6768-500G | 29 | 36498 Remove |
||
| DNA ladder | NEB | #N3232L | 30 | 36499 Remove |
||
| 6. DNA isolation and Clean-up Kits | 31 | 36500 Remove |
||||
| Genomic DNA isolation and purification kit | Promega | #A1120 | 32 | 36501 Remove |
||
| Plasmid Midi kit | Qiagen | # 12143 | 33 | 36502 Remove |
||
| QIAquick PCR purification kit | Qiagen | #28104 | 34 | 36512 Remove |
||
| 7. Equipment for PCR, Transformation and Replica-pinning | 35 | 36503 Remove |
||||
| Thermal cycler | BioRad, iCycler | 36 | 36504 Remove |
|||
| Agarose gel electrophoresis | BioRad | 37 | 36505 Remove |
|||
| Electroporator | Bio-Rad GenePulser II | 38 | 36506 Remove |
|||
| 0.2 cm electroporation cuvette | Bio-Rad | 39 | 36507 Remove |
|||
| 42 °C water bath shaker | Innova 3100 | 40 | 36508 Remove |
|||
| Beckman Coulter TJ-25 centrifuge | Beckman Coulter | 41 | 36519 Remove |
|||
| 32 °C shaker | New Brunswick Scientific, USA | 42 | 36509 Remove |
|||
| 32 °C plate incubator | Fisher Scientific | 43 | 36510 Remove |
|||
| RoToR-HDA benchtop robot | Singer Instruments | 44 | 36511 Remove |
|||
| 96, 384 and 1,536 pin density pads | Singer Instruments | 45 | 36513 Remove |
|||
| 96 or 384 long pins | Singer Instruments | 46 | 36514 Remove |
|||
| 8. Imaging Equipments | 47 | 36515 Remove |
||||
| Camera stand | Kaiser | 48 | 36516 Remove |
|||
| Digital camera, 10 megapixel | Any Vendor | 49 | 36517 Remove |
|||
| Light boxes, Testrite 16″ x 24″ units | Testrite | 50 | 36527 Remove |
|||
| 9. Pads or Plates Recycling | 51 | 36518 Remove |
||||
| 10% bleach | Any Vendor | 52 | 36520 Remove |
|||
| 70% ethanol | Any Vendor | 53 | 36521 Remove |
|||
| Sterile distilled water | Any Vendor | 54 | 36522 Remove |
|||
| Flow hood | Any Vendor | 55 | 36523 Remove |
|||
| Ultraviolet lamp | Any Vendor | 56 | 36524 Remove |
|||
| 10. Labware | 57 | 36525 Remove |
||||
| 50 ml polypropylene tubes | Any Vendor | 58 | 36526 Remove |
|||
| 1.5 ml micro-centrifuge tubes | Any Vendor | 59 | 36528 Remove |
|||
| 250 ml conical flaks | VWR | # 29140-045 | 60 | 36529 Remove |
||
| 15 ml sterile culture tubes | Thermo Scientific | # 366052 | 61 | 36530 Remove |
||
| Cryogenic vials | VWR | # 479-3221 | 62 | 36531 Remove |
||
| Rectangular Plates | Singer Instruments | 63 | 36532 Remove |
|||
| 96-well and 384-well microtitre plates | Singer Instruments | Nunc | 64 | 36533 Remove |
||
| Plate roller for sealing multi-well | Sigma | #R1275 | 65 | 36535 Remove |
||
| plates | ABgene | # AB-0580 | 66 | 36534 Remove |
||
| Adhesive plate seals | Fisher Scientific | # 13-990-14 | 67 | 36537 Remove |
||
| -80 °C freezer | Any Vendor | 68 | 36536 Remove |
References
- Bandyopadhyay, S., Kelley, R., Krogan, N. J., Ideker, T. Functional maps of protein complexes from quantitative genetic interaction data. PLoS Comput. Biol. 4, e1000065 (2008).
- Costanzo, M., Baryshnikova, A., Myers, C. L., Andrews, B., Boone, C. Charting the genetic interaction map of a cell. Curr. Opin. Biotechnol. 22, 66-74 (2011).
- Costanzo, M., et al. The genetic landscape of a cell. Science. 327, 425-4231 (2010).
- Fiedler, D., et al. Functional organization of the S. cerevisiae phosphorylation network. Cell. 136, 952-963 (2009).
- Roguev, A., et al. Conservation and rewiring of functional modules revealed by an epistasis map in fission yeast. Science. 322, 405-4010 (2008).
- Schuldiner, M., et al. Exploration of the function and organization of the yeast early secretory pathway through an epistatic miniarray profile. Cell. 123, 507-519 (2005).
- Wilmes, G. M., et al. A genetic interaction map of RNA-processing factors reveals links between Sem1/Dss1-containing complexes and mRNA export and splicing. Mol. Cell. 32, 735-746 (2008).
- Babu, M., et al. Systems-level approaches for identifying and analyzing genetic interaction networks in Escherichia coli and extensions to other prokaryotes. Mol. Biosyst. 12, 1439-1455 (2009).
- Butland, G., et al. coli synthetic genetic array analysis. Nat. Methods. 5, 789-7895 (2008).
- Typas, A., et al. Regulation of peptidoglycan synthesis by outer-membrane proteins. Cell. 143, 1097-10109 (2010).
- Baba, T., et al. Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2, 2006-200008 (2006).
- Babu, M., et al. Genetic interaction maps in Escherichia coli reveal functional crosstalk among cell envelope biogenesis pathways. PLoS Genet. 7, e1002377 (2011).
- Nichols, R. J., et al. Phenotypic landscape of a bacterial cell. Cell. 144, 143-156 (2011).
- Babu, M., Gagarinova, A., Greenblatt, J., Emili, A. Array-based synthetic genetic screens to map bacterial pathways and functional networks in Escherichia coli. Methods Mol Biol. 765, 125-153 (2011).
- Datsenko, K. A., Wanner, B. L. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. U.S.A. 97, 6640-665 (2000).
- Yu, D., et al. An efficient recombination system for chromosome engineering in Escherichia coli. Proc. Natl. Acad. Sci. U.S.A. 97, 5978-5983 (2000).
- Typas, A., et al. quantitative analyses of genetic interactions in. E. coli. Nat. Methods. 5, 781-787 (2008).
- Zeghouf, M., et al. Sequential Peptide Affinity (SPA) system for the identification of mammalian and bacterial protein complexes. J. Proteome Res. 3, 463-468 (2004).
- Davierwala, A. P., et al. . , 1147-1152 (2005).
- Breslow, D. K., et al. A comprehensive strategy enabling high-resolution functional analysis of the yeast genome. Nat. Methods. 5, 711-718 (2008).
- Babu, M., et al. Sequential peptide affinity purification system for the systematic isolation and identification of protein complexes from Escherichia coli. Methods Mol. Biol. 564, 373-400 (2009).
- Butland, G., et al. Interaction network containing conserved and essential protein complexes in Escherichia coli. Nature. 433, 531-537 (2005).
- Hu, P., Janga, S. C., Babu, M., Diaz-Mejia, J. J., Butland, G., et al. Global functional atlas of Escherichia coli encompassing previously uncharacterized proteins. PLoS Biol. 7, (2009).
- Anderson, R. P., Roth, J. R. Tandem genetic duplications in phage and bacteria. Annu. Rev. Microbiol. 31, 473-505 (1977).
- Boone, C., Bussey, H., Andrews, B. J. Exploring genetic interactions and networks with yeast. Nat. Rev. Genet. 8, 437-449 (2007).
- Collins, S. R., et al. Functional dissection of protein complexes involved in yeast chromosome biology using a genetic interaction map. Nature. 446, 806-8010 (2007).
- Le Meur, N., Gentleman, R. Modeling synthetic lethality. Genome Biol. 9, R135 (2008).
- Tong, A. H., et al. Systematic genetic analysis with ordered arrays of yeast deletion mutants. Science. 294, 2364-2368 (2001).
- Tong, A. H., et al. Global mapping of the yeast genetic interaction network. Science. 303, 808-813 (2004).
- Wong, S. L., et al. Combining biological networks to predict genetic interactions. Proc. Natl. Acad. Sci. U.S.A. 101, 15682-15687 (2004).
- van Opijnen, T., Bodi, K. L., Camilli, A. Tn-seq: high-throughput parallel sequencing for fitness and genetic interaction studies in microorganisms. Nat. Methods. 6, 767-772 (2009).
- Gagarinova, A., Emili, A. Genome-scale genetic manipulation methods for exploring bacterial molecular biology. Mol. Biosyst. 8, 1626-1638 (2012).
- Dewey, C. N., et al. Positional orthology: putting genomic evolutionary relationships into context. Brief Bioinform. 12, 401-412 (2011).
- St Onge, R. P., et al. Systematic pathway analysis using high-resolution fitness profiling of combinatorial gene deletions. Nat. Genet. 39, 199-206 (2007).
