Mapeamento bacterianas redes funcionais e vias<em> Escherichia Coli</em> Usando sintéticos matrizes genéticas
Summary
Sistemáticas e em grande escala genético sintético telas (gene-gene ou epistasia) interação pode ser usado para explorar a redundância genética e via de cross-talk. Aqui, descrevemos um alto rendimento quantitativo tecnologia de rastreamento genético sintético matriz, denominada eSGA que desenvolvemos para a elucidação de relações epistáticos e explorar redes de interação genéticos em<em> Escherichia coli</em>.
Abstract
Fenótipos são determinados por uma série complexa de física (por exemplo, proteína-proteína) e funcionais (por exemplo, gene-gene ou genética) interacções (GI) 1. Enquanto interações físicas podem indicar que as proteínas bacterianas estão associadas como complexos, eles não revelam necessariamente via de nível relationships1 funcionais. Telas de GI, em que o crescimento de mutantes duplos tendo dois genes eliminados ou inactivados é medida e comparada com os mutantes correspondentes individuais, pode iluminar dependências epistáticos entre loci e, portanto, proporcionam um meio para consultar e descobrir novas relações funcionais 2. Mapas de grande escala GI foram relatados por organismos eucarióticos como o fermento 3-7, mas a informação GI permanece escassa para procariontes 8, o que dificulta a anotação funcional de genomas bacterianos. Para este fim, e outros desenvolveram alto rendimento quantitativo bacterianas métodos de rastreio de IG 9, 10 </sup>.
Aqui, apresentamos os principais passos necessários para realizar E. quantitativa coli Genetic Matriz Sintética procedimento de triagem (eSGA) em um genoma de escala-9, utilizando-se a conjugação bacteriana natural e recombinação homóloga para gerar sistematicamente e medir a aptidão de um grande número de mutantes duplos em um formato de matriz de colónia. Resumidamente, um robô é usado para transferir , através de conjugação, cloranfenicol (Cm) – marcado alelos mutantes de Hfr engenharia (alta freqüência de recombinação) 'linhagens doadoras em um conjunto ordenado de canamicina (Kan) – marcadas F-receptor cepas. Normalmente, usamos a perda de função de mutantes simples tendo deleções de genes não essenciais (por exemplo, a recolha de 'Keio' 11) e as mutações de genes essenciais hypomorphic (isto é, os alelos que conferem a expressão da proteína reduzida, a estabilidade, ou a actividade de 9, 12, 13) para consultar as associações funcionais de genes essenciais e não essenciais, resvamente. Após a conjugação e subsequente troca genética mediada por recombinação homóloga, os duplos mutantes resultantes são seleccionadas em meio sólido contendo ambos os antibióticos. Depois de conseqüência, as placas são digitalmente fotografada e tamanhos colônia são quantitativamente registados com um sistema interno de tratamento automatizado de imagem 14. IG são reveladas quando a taxa de crescimento de um mutante duplo ou é significativamente melhor ou pior do que 9 esperada. SIG (ou negativo) agravante muitas vezes resultam entre a perda de função de mutações em pares de genes de vias compensatórias que incidem sobre o mesmo processo essencial 2. Aqui, a perda de um único gene é tamponada, tal que um ou outro mutante único é viável. No entanto, a perda de ambas as vias é prejudicial e resulta em letalidade sintética ou de doença (isto é, crescimento lento). Inversamente, aliviando (ou positivos) podem ocorrer interacções entre os genes na mesma via ou a proteína do complexo 2, como odeleção de um ou outro gene sozinho é frequentemente suficiente para perturbar o funcionamento normal da via ou complexo de tal forma que as perturbações adicionais não reduzem a actividade, e, consequentemente, o crescimento adicional. No geral, a identificação sistemática e análise de redes de GI pode fornecer imparciais, mapas globais de relações funcionais entre um grande número de genes, dos quais via de informações em nível de perdida por outras abordagens podem ser inferidas 9.
Protocol
Representative Results
Discussion
Temos delineado um protocolo passo a passo para a utilização de triagem eSGA robótico para investigar funções de genes bacterianos em um nível caminho interrogando GI. Esta abordagem pode ser usada para estudar os genes individuais, bem como os sistemas biológicos inteiras em E. coli. Cuidadosamente executar as etapas experimentais descritas acima, incluindo todos os controles apropriados, e rigorosamente análise e validação dos dados de forma independente GI são aspectos fundamentais para o sucesso …
Disclosures
The authors have nothing to disclose.
Acknowledgements
Este trabalho foi financiado por fundos do Genome Canada, o Instituto Ontário Genomics, e os Institutos Canadenses de Pesquisa em Saúde de bolsas para JG e AG AE é um receptor de Vanier de Bolsas de Pós-Graduação no Canadá.
Materials
| I. Antibiotics | 2 | 36471 Remove |
||||
| Chloramphenicol | Bioshop | #CLR201 | 3 | 36472 Remove |
||
| Kanamycin | #KAN201 | 4 | 36480 Remove |
|||
| Ampicillin | # AMP201 | 5 | 36473 Remove |
|||
| 2. Luria-Bertani medium | 6 | 36474 Remove |
||||
| LB powder | Bioshop | #LBL405 | 7 | 36478 Remove |
||
| Agar | Bioshop | #AGR003 | 8 | 36481 Remove |
||
| 3. Bacterial Strains and Plasmids | 9 | 36475 Remove |
||||
| Hfr Cavalli strain λred system (JL238) | Babu et al.14. | 10 | 36476 Remove |
|||
| pKD3 | E. coli Genetic Stock Centre, Yale | 11 | 36477 Remove |
|||
| Keio E. coli F- recipient collection | National BioResource Project (NBRP) of Japan11 | 12 | 36479 Remove |
|||
| Hypomorphic E. coli F- SPA-tag strains | Open biosystems; Babu et al.14 | 13 | 36491 Remove |
|||
| 4. Primers | 14 | 36486 Remove |
||||
| pKD3-based desalted constant primers | F1: 5′-GGCTGACATGGGAATTAGC-3′ R1: 5′-AGATTGCAGCATTACACGTCTT-3′ |
15 | 36482 Remove |
|||
| Desalted custom primers | Cm-R: 5′-TTATACGCAAGGCGACAAGG-3′ Cm-F: 5′- GATCTTCCGTCACAGGTAGG-3′ |
16 | 36483 Remove |
|||
| Desalted custom primers | F2 and R2: 20 nt constant regions based on pKD3 sequence and 45 nt custom homology regions F2 constant region: 5′-CATATGAATATCCTCCTTA-3′ R2 constant region: 5′-TGTGTAGGCTGGAGCTGCTTC-3’S1 and S2: 27 nt constant regions for priming the amplification of the SPA-Cm cassette and 45 nt custom homology regions S1 constant region: 5’AGCTGGAGGATCCATGGAAAAGAGAAG -3′ S2 constant region: 5′- GGCCCCATATGAATATCCTCCTTAGTT -3′ KOCO-F and KOCO-C: 20 nt primers 200 bp away from the non-essential gene deletion site or the essential gene SPA-tag insertion site |
17 | 36484 Remove |
|||
| 5. PCR and Electrophoresis Reagents | 18 | 36485 Remove |
||||
| Taq DNA polymerase | Fermentas | # EP0281 | 19 | 36487 Remove |
||
| 10X PCR buffer | Fermentas | # EP0281 | 20 | 36488 Remove |
||
| 10 mM dNTPs | Fermentas | # EP0281 | 21 | 36489 Remove |
||
| 25 mM MgCl2 | Fermentas | # EP0281 | 22 | 36490 Remove |
||
| Agarose | Bioshop | # AGA002 | 23 | 36492 Remove |
||
| Loading dye | NEB | #B7021S | 24 | 36493 Remove |
||
| Ethidium bromide | Bioshop | # ETB444 | 25 | 36497 Remove |
||
| 10X TBE buffer | Bioshop | # ETB444.10 | 26 | 36494 Remove |
||
| Tris Base | Bioshop | # TRS001 | 27 | 36495 Remove |
||
| Boric acid | Sigma | # T1503-1KG | 28 | 36496 Remove |
||
| 0.5 M EDTA (pH 8.0) | Sigma | # B6768-500G | 29 | 36498 Remove |
||
| DNA ladder | NEB | #N3232L | 30 | 36499 Remove |
||
| 6. DNA isolation and Clean-up Kits | 31 | 36500 Remove |
||||
| Genomic DNA isolation and purification kit | Promega | #A1120 | 32 | 36501 Remove |
||
| Plasmid Midi kit | Qiagen | # 12143 | 33 | 36502 Remove |
||
| QIAquick PCR purification kit | Qiagen | #28104 | 34 | 36512 Remove |
||
| 7. Equipment for PCR, Transformation and Replica-pinning | 35 | 36503 Remove |
||||
| Thermal cycler | BioRad, iCycler | 36 | 36504 Remove |
|||
| Agarose gel electrophoresis | BioRad | 37 | 36505 Remove |
|||
| Electroporator | Bio-Rad GenePulser II | 38 | 36506 Remove |
|||
| 0.2 cm electroporation cuvette | Bio-Rad | 39 | 36507 Remove |
|||
| 42 °C water bath shaker | Innova 3100 | 40 | 36508 Remove |
|||
| Beckman Coulter TJ-25 centrifuge | Beckman Coulter | 41 | 36519 Remove |
|||
| 32 °C shaker | New Brunswick Scientific, USA | 42 | 36509 Remove |
|||
| 32 °C plate incubator | Fisher Scientific | 43 | 36510 Remove |
|||
| RoToR-HDA benchtop robot | Singer Instruments | 44 | 36511 Remove |
|||
| 96, 384 and 1,536 pin density pads | Singer Instruments | 45 | 36513 Remove |
|||
| 96 or 384 long pins | Singer Instruments | 46 | 36514 Remove |
|||
| 8. Imaging Equipments | 47 | 36515 Remove |
||||
| Camera stand | Kaiser | 48 | 36516 Remove |
|||
| Digital camera, 10 megapixel | Any Vendor | 49 | 36517 Remove |
|||
| Light boxes, Testrite 16″ x 24″ units | Testrite | 50 | 36527 Remove |
|||
| 9. Pads or Plates Recycling | 51 | 36518 Remove |
||||
| 10% bleach | Any Vendor | 52 | 36520 Remove |
|||
| 70% ethanol | Any Vendor | 53 | 36521 Remove |
|||
| Sterile distilled water | Any Vendor | 54 | 36522 Remove |
|||
| Flow hood | Any Vendor | 55 | 36523 Remove |
|||
| Ultraviolet lamp | Any Vendor | 56 | 36524 Remove |
|||
| 10. Labware | 57 | 36525 Remove |
||||
| 50 ml polypropylene tubes | Any Vendor | 58 | 36526 Remove |
|||
| 1.5 ml micro-centrifuge tubes | Any Vendor | 59 | 36528 Remove |
|||
| 250 ml conical flaks | VWR | # 29140-045 | 60 | 36529 Remove |
||
| 15 ml sterile culture tubes | Thermo Scientific | # 366052 | 61 | 36530 Remove |
||
| Cryogenic vials | VWR | # 479-3221 | 62 | 36531 Remove |
||
| Rectangular Plates | Singer Instruments | 63 | 36532 Remove |
|||
| 96-well and 384-well microtitre plates | Singer Instruments | Nunc | 64 | 36533 Remove |
||
| Plate roller for sealing multi-well | Sigma | #R1275 | 65 | 36535 Remove |
||
| plates | ABgene | # AB-0580 | 66 | 36534 Remove |
||
| Adhesive plate seals | Fisher Scientific | # 13-990-14 | 67 | 36537 Remove |
||
| -80 °C freezer | Any Vendor | 68 | 36536 Remove |
References
- Bandyopadhyay, S., Kelley, R., Krogan, N. J., Ideker, T. Functional maps of protein complexes from quantitative genetic interaction data. PLoS Comput. Biol. 4, e1000065 (2008).
- Costanzo, M., Baryshnikova, A., Myers, C. L., Andrews, B., Boone, C. Charting the genetic interaction map of a cell. Curr. Opin. Biotechnol. 22, 66-74 (2011).
- Costanzo, M., et al. The genetic landscape of a cell. Science. 327, 425-4231 (2010).
- Fiedler, D., et al. Functional organization of the S. cerevisiae phosphorylation network. Cell. 136, 952-963 (2009).
- Roguev, A., et al. Conservation and rewiring of functional modules revealed by an epistasis map in fission yeast. Science. 322, 405-4010 (2008).
- Schuldiner, M., et al. Exploration of the function and organization of the yeast early secretory pathway through an epistatic miniarray profile. Cell. 123, 507-519 (2005).
- Wilmes, G. M., et al. A genetic interaction map of RNA-processing factors reveals links between Sem1/Dss1-containing complexes and mRNA export and splicing. Mol. Cell. 32, 735-746 (2008).
- Babu, M., et al. Systems-level approaches for identifying and analyzing genetic interaction networks in Escherichia coli and extensions to other prokaryotes. Mol. Biosyst. 12, 1439-1455 (2009).
- Butland, G., et al. coli synthetic genetic array analysis. Nat. Methods. 5, 789-7895 (2008).
- Typas, A., et al. Regulation of peptidoglycan synthesis by outer-membrane proteins. Cell. 143, 1097-10109 (2010).
- Baba, T., et al. Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2, 2006-200008 (2006).
- Babu, M., et al. Genetic interaction maps in Escherichia coli reveal functional crosstalk among cell envelope biogenesis pathways. PLoS Genet. 7, e1002377 (2011).
- Nichols, R. J., et al. Phenotypic landscape of a bacterial cell. Cell. 144, 143-156 (2011).
- Babu, M., Gagarinova, A., Greenblatt, J., Emili, A. Array-based synthetic genetic screens to map bacterial pathways and functional networks in Escherichia coli. Methods Mol Biol. 765, 125-153 (2011).
- Datsenko, K. A., Wanner, B. L. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. U.S.A. 97, 6640-665 (2000).
- Yu, D., et al. An efficient recombination system for chromosome engineering in Escherichia coli. Proc. Natl. Acad. Sci. U.S.A. 97, 5978-5983 (2000).
- Typas, A., et al. quantitative analyses of genetic interactions in. E. coli. Nat. Methods. 5, 781-787 (2008).
- Zeghouf, M., et al. Sequential Peptide Affinity (SPA) system for the identification of mammalian and bacterial protein complexes. J. Proteome Res. 3, 463-468 (2004).
- Davierwala, A. P., et al. . , 1147-1152 (2005).
- Breslow, D. K., et al. A comprehensive strategy enabling high-resolution functional analysis of the yeast genome. Nat. Methods. 5, 711-718 (2008).
- Babu, M., et al. Sequential peptide affinity purification system for the systematic isolation and identification of protein complexes from Escherichia coli. Methods Mol. Biol. 564, 373-400 (2009).
- Butland, G., et al. Interaction network containing conserved and essential protein complexes in Escherichia coli. Nature. 433, 531-537 (2005).
- Hu, P., Janga, S. C., Babu, M., Diaz-Mejia, J. J., Butland, G., et al. Global functional atlas of Escherichia coli encompassing previously uncharacterized proteins. PLoS Biol. 7, (2009).
- Anderson, R. P., Roth, J. R. Tandem genetic duplications in phage and bacteria. Annu. Rev. Microbiol. 31, 473-505 (1977).
- Boone, C., Bussey, H., Andrews, B. J. Exploring genetic interactions and networks with yeast. Nat. Rev. Genet. 8, 437-449 (2007).
- Collins, S. R., et al. Functional dissection of protein complexes involved in yeast chromosome biology using a genetic interaction map. Nature. 446, 806-8010 (2007).
- Le Meur, N., Gentleman, R. Modeling synthetic lethality. Genome Biol. 9, R135 (2008).
- Tong, A. H., et al. Systematic genetic analysis with ordered arrays of yeast deletion mutants. Science. 294, 2364-2368 (2001).
- Tong, A. H., et al. Global mapping of the yeast genetic interaction network. Science. 303, 808-813 (2004).
- Wong, S. L., et al. Combining biological networks to predict genetic interactions. Proc. Natl. Acad. Sci. U.S.A. 101, 15682-15687 (2004).
- van Opijnen, T., Bodi, K. L., Camilli, A. Tn-seq: high-throughput parallel sequencing for fitness and genetic interaction studies in microorganisms. Nat. Methods. 6, 767-772 (2009).
- Gagarinova, A., Emili, A. Genome-scale genetic manipulation methods for exploring bacterial molecular biology. Mol. Biosyst. 8, 1626-1638 (2012).
- Dewey, C. N., et al. Positional orthology: putting genomic evolutionary relationships into context. Brief Bioinform. 12, 401-412 (2011).
- St Onge, R. P., et al. Systematic pathway analysis using high-resolution fitness profiling of combinatorial gene deletions. Nat. Genet. 39, 199-206 (2007).
