High-throughput CRISPR vettore Costruzione e caratterizzazione di modifiche del DNA da Generazione di Roots pomodoro Peloso
Summary
Utilizzando assemblaggio DNA, vettori multipli CRISPR possono essere costruiti in parallelo in una singola reazione clonazione, rendendo la costruzione di un gran numero di CRISPR vettori un compito semplice. Pomodoro radici pelose sono un sistema eccellente modello per convalidare vettori CRISPR e generare materiali mutanti.
Abstract
Targeted DNA mutations generated by vectors with clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 technology have proven useful for functional genomics studies. While most cloning strategies are simple to perform, they generally use multiple steps and can require several days to generate the ultimate constructs. The method presented here is based on DNA assembly and can produce fully functional CRISPR vectors in a single cloning reaction. Vector construction can also be pooled, further increasing the efficiency and utility of the process. A modification of the method is used to create CRISPR vectors with multiple gene targets. CRISPR vectors are then transformed into tomato hairy roots to generate transgenic materials with targeted DNA modifications. Hairy roots are a useful system for testing vector functionality as they are technically simple to generate and amenable to large-scale production. The methods presented here will have wide application as they can be used to generate a variety of CRISPR vectors and be used in a wide range of plant species.
Introduction
La capacità di generare le modifiche del DNA mirati con CRISPR / Cas9 ha un grande potenziale per gli studi di genomica funzionale. Ci sono due componenti del sistema CRISPR / Cas9; la nucleasi Cas9, derivata da pyogenes Staphylococcus e una molecola di circa 100 nt guida RNA (gRNA) che dirige Cas9 al sito DNA bersaglio (s) 1. Obiettivo riconoscimento è conferito dal primo ~ 20-nt del gRNA, che consente la produzione di high-throughput di targeting vettori 2,3. La maggior parte degli organismi che possono essere progettati, già sono stati con CRISPR tecnologia / Cas9 4,5.
Nelle piante, promotori costitutivi, come il promotore CaMV 35S, sono comunemente utilizzati per guidare l'espressione della nucleasi Cas9 6. I gRNAs sono espressi utilizzando le RNA polimerasi III U6 o U3 promotori che limita la prima base del gRNA, o un G, per la U6, o A per U3, per la trascrizione efficiente. Tuttavia prom RNA polimerasi IIoters, che sono liberi di queste restrizioni, sono stati utilizzati 7,8.
Diversi gRNAs inducono mutazioni del DNA con diverse efficienze, e quindi può essere importante per convalidare prima vettori CRISPR prima di investire nelle trasformazioni intero impianto o la creazione di ampi schermi fenotipici. Espressione transiente di CRISPR costruisce nelle piante, utilizzando agroinfiltration per esempio, comporta generalmente una minore frequenza di modifica DNA rispetto agli impianti stabili 6, rendendo il rilevamento di mutazioni difficili e saggi fenotipici impraticabili con tali approcci. Le cosiddette radici pelose sono una comoda, sistema alternativo poiché un gran numero di materiali stabilmente trasformate indipendenti può essere generato all'interno settimane, anziché mesi per impianti stabili. Vettori CRISPR sono molto efficaci a indurre mutazioni del DNA nelle radici pelose 9,10.
metodi di assemblaggio DNA legare in modo efficiente frammenti di DNA contenenti overlANALITICI finisce 11. Un vantaggio importante di alcuni metodi di assemblaggio DNA è la capacità di incorporare ssDNA (cioè oligonucleotidi) nei prodotti assemblati. Dal momento che gRNAs sono solo ~ 20-nt lunga e nuovi obiettivi possono essere realizzati con oligonucleotidi sintetizzati, questi metodi di assemblaggio del DNA sono adatti per CRISPR clonazione. I protocolli descritti qui sono basate sulla serie P201 di vettori CRISPR che è stato usato con successo nella soia 10, pioppo 12 e ora pomodoro. La procedura di clonazione presentato offre diversi vantaggi rispetto al metodo di clonazione corrente 10. Vale a dire, vettori completamente funzionali possono essere generati in una singola reazione clonazione in un solo giorno. costruzione del vettore può anche essere raggruppati per generare più vettori CRISPR in parallelo, riducendo ulteriormente hands-on costi di tempo e materiali. Presentiamo anche un protocollo per la generazione di pomodoro radici pelose come un metodo efficiente per la produzione di materiali transgenici con delezioni geniche mirate. radici pelose sono utilizzati per validemangiato i vettori CRISPR e fornire materiale per esperimenti successivi.
Protocol
Representative Results
Discussion
Since DNA assembly is used to recombine any overlapping DNA sequences, this cloning method can be applied to any CRISPR vector construction. Most CRISPR cloning schemes use either gene synthesis of the gRNA, type IIS restriction enzymes17,18, or overlap-extension PCR19. Each of these techniques has inherent advantages and disadvantages, but they typically require multiple hands-on cloning steps. The primary advantage of the cloning method presented here is that the entire process occurs in a single,…
Disclosures
The authors have nothing to disclose.
Acknowledgements
Questa ricerca è stata sostenuta dalla National Science Foundation concessione IOS-1.025.642 (GBM). Ringraziamo Maria Harrison per fornire il ceppo ARqua1.
Materials
| NEBuilder® (HiFi DNA assembly mix) | New England Biolabs | E5520 | |
| p201N:Cas9 | Addgene | 59175 | The p201H:Cas9 plasmid (59176) is also compatible with the reported overlaps and enzymes. |
| pUC gRNA Shuttle | Addgene | 47024 | |
| SwaI | New England Biolabs | R0604S | |
| SpeI | New England Biolabs | R0133S | |
| Zymo clean and concentrator-5 column purification | Zymo Research | D4003 | |
| NEB Buffer 2.1 | New England Biolabs | B7202S | |
| NEB CutSmart (Buffer 4) | New England Biolabs | B7204S | |
| NEB Buffer 3.1 | New England Biolabs | B7203S | |
| EconoSpin Mini Spin Column (plasmid prep) | Epoch Life Sciences | 1910-050/250 | |
| EcoRV-HF® | New England Biolabs | R3195S | |
| StyI-HF® | New England Biolabs | R3500S | |
| MS Salts + Gamborg Vitamins | Phytotechnology Laboratories | M404 | |
| Phytagel™ (gellan gum) | Sigma Aldrich | P8169 | |
| GA-7 Boxes | Sigma Aldrich | V8505 | |
| Micropore™ surgical tape | 3M | 1535-0 | |
| Timentin® (Ticarcillin/Clavulanic acid) | Various | 0029-6571-26 | |
| Primers 5' -> 3' | |||
| SwaI_MtU6F | GATATTAATCTCTTCGATGAAATTTATGCCTATCTTATATGATCAATGAGG | ||
| MtU6R | AAGCCTACTGGTTCGCTTGAAG | ||
| ScaffoldF | GTTTTAGAGCTAGAAATAGCAAGTT | ||
| SpeI_Scaffold R | GTCATGAATTGTAATACGACTCAAAAAAAAGCACCGACTCGGTG | ||
| StUbi3P218R | ACATGCACCTAATTTCACTAGATGT | ||
| ISceIR | GTGATCGATTACCCTGTTATCCCTAG | Cannot be used for Sanger sequencing since there is a second binding site on the plasmid | |
| UNS1_Scaffold R | GAGAATGGATGCGAGTAATGAAAAAAAGCACCGACTCGGTG | ||
| UNS1_MtU6 F | CATTACTCGCATCCATTCTCATGCCTATCTTATATGATCAATGAGG | ||
| p201R | CGCGCCGAATTCTAGTGATCG | ||
| Bolded sequences denote 20-nt overlaps with linearized p201N:Cas9. | |||
References
- Jinek, M., et al. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science. 337 (6096), 816-821 (2012).
- Shalem, O., et al. Genome-scale CRISPR-Cas9 knockout screening in human cells. Science. 343 (6166), 84-87 (2014).
- Zhou, Y. X., et al. High-throughput screening of a CRISPR/Cas9 library for functional genomics in human cells. Nature. 509 (509), 487-491 (2014).
- Doudna, J. A., Charpentier, E. The new frontier of genome engineering with CRISPR-Cas9. Science. 346 (6213), (2014).
- Belhaj, K., Chaparro-Garcia, A., Kamoun, S., Patron, N. J., Nekrasov, V. Editing plant genomes with CRISPR/Cas9. Current Opinion in Biotechnology. 32, 76-84 (2015).
- Bortesi, L., Fischer, R. The CRISPR/Cas9 system for plant genome editing and beyond. Biotechnology Advances. 33 (1), 41-52 (2015).
- Jia, H. G., Wang, N. Targeted genome editing of sweet orange using Cas9/sgRNA. Plos One. 9, (2014).
- Upadhyay, S. K., Kumar, J., Alok, A., Tuli, R. RNA-Guided Genome Editing for Target Gene Mutations in Wheat. G3-Genes Genomes Genetics. 3 (12), 2233-2238 (2013).
- Ron, M., et al. Hairy root transformation using Agrobacterium rhizogenes. as a tool for exploring cell type-specific gene expression and function using tomato as a model. Plant Physiology. 166 (2), 455-U4442 (2014).
- Jacobs, T. B., LaFayette, P. R., Schmitz, R. J., Parrott, W. A. Targeted genome modifications in soybean with CRISPR/Cas9. BMC Biotechnology. 15, (2015).
- Gibson, D. G., Smith, H. O., Hutchison, C. A., Venter, J. C., Merryman, C. Chemical synthesis of the mouse mitochondrial genome. Nature Methods. 7 (11), 901-903 (2010).
- Zhou, X., Jacobs, T. B., Xue, L. J., Harding, S. A., Tsai, C. J. Exploiting SNPs for biallelic CRISPR mutations in the outcrossing woody perennial Populus reveals 4-coumarate:CoA ligase specificity and redundancy. New Phytologist. , (2015).
- Stemmer, M., Thumberger, T., Keyer, M. D., Wittbrodt, J., Mateo, J. L. CCTop: An Intuitive, Flexible and Reliable CRISPR/Cas9 Target Prediction Tool. Plos One. 10, (2015).
- Lei, Y., et al. CRISPR-P: A Web Tool for Synthetic Single-Guide RNA Design of CRISPR-System in Plants. Molecular Plant. 7 (9), 1494-1496 (2014).
- Quandt, H. J., Puhler, A., Broer, I. TRANSGENIC ROOT-NODULES OF VICIA-HIRSUTA – A FAST AND EFFICIENT SYSTEM FOR THE STUDY OF GENE-EXPRESSION IN INDETERMINATE-TYPE NODULES. Molecular Plant-Microbe Interactions. 6, 699-706 (1993).
- Zhu, X. X., et al. An efficient genotyping method for genome-modified animals and human cells generated with CRISPR/Cas9 system. Scientific Reports. 4 (8), (2014).
- Belhaj, K., Chaparro-Garcia, A., Kamoun, S., Nekrasov, V. Plant genome editing made easy: targeted mutagenesis in model and crop plants using the CRISPR/Cas system. Plant Methods. 9 (1), 39 (2013).
- Cong, L., et al. Multiplex genome engineering using CRISPR/Cas systems. Science. 339 (6121), 819-823 (2013).
- Li, J. F., et al. Multiplex and homologous recombination-mediated genome editing in Arabidopsis and Nicotiana benthamiana using guide RNA and Cas9. Nat Biotech. 31 (8), 688-691 (2013).
- Fu, Y. F., Sander, J. D., Reyon, D., Cascio, V. M., Joung, J. K. Improving CRISPR-Cas nuclease specificity using truncated guide RNAs. Nature Biotechnology. 32 (3), 279-284 (2014).
- Torella, J. P., et al. Unique nucleotide sequence-guided assembly of repetitive DNA parts for synthetic biology applications. Nat Protoc. 9 (9), 2075-2089 (2014).
- Ono, N. N., Tian, L. The multiplicity of hairy root cultures: Prolific possibilities. Plant Science. 180 (3), 439-446 (2011).
- Tepfer, D. Transformation of several species of higher plants by Agrobacterium rhizogenes.: sexual transmission of the transformed genotype and phenotype. Cell. 37 (3), 959-967 (1984).
- Li, H., Deng, Y., Wu, T. L., Subramanian, S., Yu, O. Misexpression of miR482, miR1512, and miR1515 Increases Soybean Nodulation. Plant Physiology. 153 (4), 1759-1770 (2010).
- Boisson-Dernier, A., et al. Agrobacterium rhizogenes-transformed roots of Medicago truncatula for the study of nitrogen-fixing and endomycorrhizal symbiotic associations. Molecular Plant-Microbe Interactions. 14 (6), 695-700 (2001).
- Collier, R., Fuchs, B., Walter, N., Kevin Lutke, W., Taylor, C. G. Ex vitro. composite plants: an inexpensive, rapid method for root biology. Plant Journal. 43 (3), 449-457 (2005).
