De alto rendimiento CRISPR vector de la construcción y caracterización de las modificaciones del ADN mediante la generación de raíces peludas tomate
Summary
Usando el montaje de ADN, múltiples vectores de CRISPR pueden ser construidos en paralelo en una única reacción de clonación, por lo que la construcción de un gran número de vectores de CRISPR una tarea simple. Tomate raíces peludas son un excelente sistema modelo para validar vectores de CRISPR y generar materiales mutantes.
Abstract
Targeted DNA mutations generated by vectors with clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 technology have proven useful for functional genomics studies. While most cloning strategies are simple to perform, they generally use multiple steps and can require several days to generate the ultimate constructs. The method presented here is based on DNA assembly and can produce fully functional CRISPR vectors in a single cloning reaction. Vector construction can also be pooled, further increasing the efficiency and utility of the process. A modification of the method is used to create CRISPR vectors with multiple gene targets. CRISPR vectors are then transformed into tomato hairy roots to generate transgenic materials with targeted DNA modifications. Hairy roots are a useful system for testing vector functionality as they are technically simple to generate and amenable to large-scale production. The methods presented here will have wide application as they can be used to generate a variety of CRISPR vectors and be used in a wide range of plant species.
Introduction
La capacidad de generar modificaciones del ADN dirigidos con CRISPR / Cas9 tiene un gran potencial para los estudios de genómica funcional. Hay dos componentes del sistema de CRISPR / Cas9; la nucleasa Cas9, derivado de Staphylococcus pyogenes y una molécula de aproximadamente 100 nt ARN guía (gRNA) que dirige Cas9 al sitio de ADN específica (s) 1. Reconocimiento de la diana es conferida por la primera ~ 20 nt de la gRNA, lo que permite la producción de alto rendimiento de vectores de abordaje 2,3. La mayoría de los organismos que pueden modificarse por ingeniería genética, ya han estado con la tecnología / Cas9 CRISPR 4,5.
En las plantas, los promotores constitutivos, tales como el promotor CaMV 35S, se utilizan comúnmente para impulsar la expresión de la nucleasa Cas9 6. Los gRNAs se expresan utilizando la polimerasa III U6 o U3 promotores de ARN que limita la primera base de la gRNA ya sea a una G, para U6, o A para U3, para la transcripción eficiente. Sin embargo baile de la ARN polimerasa IIoters, que están libres de estas restricciones, también se han utilizado 7,8.
Diferentes gRNAs inducen mutaciones de ADN con diferentes eficiencias, y por lo que puede ser importante para validar primera vectores CRISPR antes de invertir en las transformaciones de la planta entera o la creación de amplias pantallas fenotípicas. La expresión transitoria de CRISPR construye en plantas, mediante el uso de agroinfiltration por ejemplo, generalmente resulta en una menor frecuencia de modificación del ADN en comparación con las plantas estables 6, haciendo que la detección de mutaciones difíciles y ensayos fenotípicos poco prácticos con tales enfoques. Los llamados raíces peludas son un sistema conveniente, alternativa ya que un gran número de materiales independientes, transformadas de forma estable se puede generar dentro de semanas, en lugar de meses para las plantas estables. Vectores de CRISPR son muy eficaces en la inducción de mutaciones en el ADN en las raíces peludas 9,10.
métodos de ensamblaje de ADN ligate eficiente fragmentos de ADN que contienen overlapping termina 11. Una gran ventaja de algunos métodos de montaje de ADN es la capacidad de incorporar ssDNA (es decir, oligos) en los productos ensamblados. Desde gRNAs sólo ~ 20-nt de largo y nuevos objetivos se pueden hacer con oligos sintetizados, estos métodos de montaje de ADN son muy adecuados para la clonación CRISPR. Los protocolos descritos aquí se basan en la serie P201 de los vectores de CRISPR que ha sido utilizado con éxito en la soja 10, 12 y ahora álamo tomate. El procedimiento de clonación presentado ofrece varias ventajas sobre el método de clonación actual 10. Es decir, los vectores totalmente funcionales pueden ser generados en una única reacción de la clonación en un solo día. La construcción del vector también puede ponerse en común para generar múltiples vectores de CRISPR en paralelo, reduciendo aún más práctica en tiempo y costos de materiales. También se presenta un protocolo para la generación de tomate raíces peludas como un método eficiente para producir materiales transgénicos con deleciones de genes específicos. raíces peludas se utilizan para válidocomieron los vectores de CRISPR y proporcionar material para experimentos posteriores.
Protocol
Representative Results
Discussion
Since DNA assembly is used to recombine any overlapping DNA sequences, this cloning method can be applied to any CRISPR vector construction. Most CRISPR cloning schemes use either gene synthesis of the gRNA, type IIS restriction enzymes17,18, or overlap-extension PCR19. Each of these techniques has inherent advantages and disadvantages, but they typically require multiple hands-on cloning steps. The primary advantage of the cloning method presented here is that the entire process occurs in a single,…
Disclosures
The authors have nothing to disclose.
Acknowledgements
Esta investigación fue apoyada por la National Science Foundation IOS-1025642 (GBM). Agradecemos a María Harrison para proporcionar la cepa ARqua1.
Materials
| NEBuilder® (HiFi DNA assembly mix) | New England Biolabs | E5520 | |
| p201N:Cas9 | Addgene | 59175 | The p201H:Cas9 plasmid (59176) is also compatible with the reported overlaps and enzymes. |
| pUC gRNA Shuttle | Addgene | 47024 | |
| SwaI | New England Biolabs | R0604S | |
| SpeI | New England Biolabs | R0133S | |
| Zymo clean and concentrator-5 column purification | Zymo Research | D4003 | |
| NEB Buffer 2.1 | New England Biolabs | B7202S | |
| NEB CutSmart (Buffer 4) | New England Biolabs | B7204S | |
| NEB Buffer 3.1 | New England Biolabs | B7203S | |
| EconoSpin Mini Spin Column (plasmid prep) | Epoch Life Sciences | 1910-050/250 | |
| EcoRV-HF® | New England Biolabs | R3195S | |
| StyI-HF® | New England Biolabs | R3500S | |
| MS Salts + Gamborg Vitamins | Phytotechnology Laboratories | M404 | |
| Phytagel™ (gellan gum) | Sigma Aldrich | P8169 | |
| GA-7 Boxes | Sigma Aldrich | V8505 | |
| Micropore™ surgical tape | 3M | 1535-0 | |
| Timentin® (Ticarcillin/Clavulanic acid) | Various | 0029-6571-26 | |
| Primers 5' -> 3' | |||
| SwaI_MtU6F | GATATTAATCTCTTCGATGAAATTTATGCCTATCTTATATGATCAATGAGG | ||
| MtU6R | AAGCCTACTGGTTCGCTTGAAG | ||
| ScaffoldF | GTTTTAGAGCTAGAAATAGCAAGTT | ||
| SpeI_Scaffold R | GTCATGAATTGTAATACGACTCAAAAAAAAGCACCGACTCGGTG | ||
| StUbi3P218R | ACATGCACCTAATTTCACTAGATGT | ||
| ISceIR | GTGATCGATTACCCTGTTATCCCTAG | Cannot be used for Sanger sequencing since there is a second binding site on the plasmid | |
| UNS1_Scaffold R | GAGAATGGATGCGAGTAATGAAAAAAAGCACCGACTCGGTG | ||
| UNS1_MtU6 F | CATTACTCGCATCCATTCTCATGCCTATCTTATATGATCAATGAGG | ||
| p201R | CGCGCCGAATTCTAGTGATCG | ||
| Bolded sequences denote 20-nt overlaps with linearized p201N:Cas9. | |||
References
- Jinek, M., et al. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science. 337 (6096), 816-821 (2012).
- Shalem, O., et al. Genome-scale CRISPR-Cas9 knockout screening in human cells. Science. 343 (6166), 84-87 (2014).
- Zhou, Y. X., et al. High-throughput screening of a CRISPR/Cas9 library for functional genomics in human cells. Nature. 509 (509), 487-491 (2014).
- Doudna, J. A., Charpentier, E. The new frontier of genome engineering with CRISPR-Cas9. Science. 346 (6213), (2014).
- Belhaj, K., Chaparro-Garcia, A., Kamoun, S., Patron, N. J., Nekrasov, V. Editing plant genomes with CRISPR/Cas9. Current Opinion in Biotechnology. 32, 76-84 (2015).
- Bortesi, L., Fischer, R. The CRISPR/Cas9 system for plant genome editing and beyond. Biotechnology Advances. 33 (1), 41-52 (2015).
- Jia, H. G., Wang, N. Targeted genome editing of sweet orange using Cas9/sgRNA. Plos One. 9, (2014).
- Upadhyay, S. K., Kumar, J., Alok, A., Tuli, R. RNA-Guided Genome Editing for Target Gene Mutations in Wheat. G3-Genes Genomes Genetics. 3 (12), 2233-2238 (2013).
- Ron, M., et al. Hairy root transformation using Agrobacterium rhizogenes. as a tool for exploring cell type-specific gene expression and function using tomato as a model. Plant Physiology. 166 (2), 455-U4442 (2014).
- Jacobs, T. B., LaFayette, P. R., Schmitz, R. J., Parrott, W. A. Targeted genome modifications in soybean with CRISPR/Cas9. BMC Biotechnology. 15, (2015).
- Gibson, D. G., Smith, H. O., Hutchison, C. A., Venter, J. C., Merryman, C. Chemical synthesis of the mouse mitochondrial genome. Nature Methods. 7 (11), 901-903 (2010).
- Zhou, X., Jacobs, T. B., Xue, L. J., Harding, S. A., Tsai, C. J. Exploiting SNPs for biallelic CRISPR mutations in the outcrossing woody perennial Populus reveals 4-coumarate:CoA ligase specificity and redundancy. New Phytologist. , (2015).
- Stemmer, M., Thumberger, T., Keyer, M. D., Wittbrodt, J., Mateo, J. L. CCTop: An Intuitive, Flexible and Reliable CRISPR/Cas9 Target Prediction Tool. Plos One. 10, (2015).
- Lei, Y., et al. CRISPR-P: A Web Tool for Synthetic Single-Guide RNA Design of CRISPR-System in Plants. Molecular Plant. 7 (9), 1494-1496 (2014).
- Quandt, H. J., Puhler, A., Broer, I. TRANSGENIC ROOT-NODULES OF VICIA-HIRSUTA – A FAST AND EFFICIENT SYSTEM FOR THE STUDY OF GENE-EXPRESSION IN INDETERMINATE-TYPE NODULES. Molecular Plant-Microbe Interactions. 6, 699-706 (1993).
- Zhu, X. X., et al. An efficient genotyping method for genome-modified animals and human cells generated with CRISPR/Cas9 system. Scientific Reports. 4 (8), (2014).
- Belhaj, K., Chaparro-Garcia, A., Kamoun, S., Nekrasov, V. Plant genome editing made easy: targeted mutagenesis in model and crop plants using the CRISPR/Cas system. Plant Methods. 9 (1), 39 (2013).
- Cong, L., et al. Multiplex genome engineering using CRISPR/Cas systems. Science. 339 (6121), 819-823 (2013).
- Li, J. F., et al. Multiplex and homologous recombination-mediated genome editing in Arabidopsis and Nicotiana benthamiana using guide RNA and Cas9. Nat Biotech. 31 (8), 688-691 (2013).
- Fu, Y. F., Sander, J. D., Reyon, D., Cascio, V. M., Joung, J. K. Improving CRISPR-Cas nuclease specificity using truncated guide RNAs. Nature Biotechnology. 32 (3), 279-284 (2014).
- Torella, J. P., et al. Unique nucleotide sequence-guided assembly of repetitive DNA parts for synthetic biology applications. Nat Protoc. 9 (9), 2075-2089 (2014).
- Ono, N. N., Tian, L. The multiplicity of hairy root cultures: Prolific possibilities. Plant Science. 180 (3), 439-446 (2011).
- Tepfer, D. Transformation of several species of higher plants by Agrobacterium rhizogenes.: sexual transmission of the transformed genotype and phenotype. Cell. 37 (3), 959-967 (1984).
- Li, H., Deng, Y., Wu, T. L., Subramanian, S., Yu, O. Misexpression of miR482, miR1512, and miR1515 Increases Soybean Nodulation. Plant Physiology. 153 (4), 1759-1770 (2010).
- Boisson-Dernier, A., et al. Agrobacterium rhizogenes-transformed roots of Medicago truncatula for the study of nitrogen-fixing and endomycorrhizal symbiotic associations. Molecular Plant-Microbe Interactions. 14 (6), 695-700 (2001).
- Collier, R., Fuchs, B., Walter, N., Kevin Lutke, W., Taylor, C. G. Ex vitro. composite plants: an inexpensive, rapid method for root biology. Plant Journal. 43 (3), 449-457 (2005).
