JoVE Journal > Genetics
Summary
Abstract
Introduction
Protocol
Results
Discussion
Disclosures
Acknowledgements
Materials
References
Automatic Translation
Please note that all translations are automatically generated. Click here for the English version.
Genetics

לימוד מחזור גנים ביטוי מוסדר על ידי שני פרוטוקולי סינכרון התא

Published: June 06, 2017
doi:
10.3791/55745
, ,
1Department of Cell Biology and Histology,University of the Basque Country, UPV/EHU, 2Department of Genetics, Physical Anthropology and Animal Physiology,University of the Basque Country, UPV/EHU, 3Department of Molecular Mechanisms of Disease,University of Zurich

Summary

אנו מדווחים על שני פרוטוקולים של סינכרון תאים המספקים הקשר ללימוד אירועים הקשורים לשלבים ספציפיים של מחזור התא. אנו מראים כי גישה זו שימושית לניתוח הרגולציה של גנים ספציפיים במחזור תאים לא מופרע או בחשיפה לסוכנים המשפיעים על מחזור התא.

Abstract

התוכנית ביטוי גנים של מחזור התא מייצג צעד קריטי להבנת התהליכים תלוי מחזור התא ואת תפקידם במחלות כגון סרטן. התא מחזור מוסדר ניתוח ביטוי גנים תלוי בסנכרון התא לשלבים ספציפיים. כאן אנו מתארים שיטה ניצול שני פרוטוקולים סינכרון משלימים כי הוא נפוץ בחקר וריאציה תקופתית של ביטוי גנים במהלך מחזור התא. שני ההליכים מבוססים על חסימה זמנית של מחזור התא בנקודה אחת מוגדרת. פרוטוקול הסינכרון על ידי הידרוקסיאורה (HU) מוביל לתא סלולרי בסוף שלב G1 / מוקדם S, ושחרור ממעצר HU מתווך מספק אוכלוסייה סלולרית מתקדם באופן אחיד באמצעות S ו- G2 / M. פרוטוקול הסינכרון על-ידי טיפול ב- thymidine ו- nocodazole (Thy-Noc) חוסם תאים במיטוזה מוקדמת, ושחרור ממעצר Thy-Noc בתיווך מספק אוכלוסיה סלולרית מסונכרנת המתאימה לשלב G1 ו- S שלבEvacpid יישום של שני הליכים דורש ניטור של פרופילי הפצה מחזור התא, אשר מבוצעת בדרך כלל לאחר propidium יודיד (PI) מכתים של התאים זרימת cytometry בתיווך ניתוח של תוכן ה- DNA. אנו מראים שהשימוש המשולב בשני פרוטוקולי סינכרון הוא גישה חזקה לבירור ברור של הפרוטוקולים התעתיקיים של גנים המווסתים באופן דיפרנציאלי במחזור התא ( כלומר E2F1 ו- E2F7), וכתוצאה מכך יש הבנה טובה יותר של תפקידם במחזור התא תהליכים. יתר על כן, אנו מראים כי גישה זו שימושית עבור מחקר של מנגנונים המבוססים על תרופות מבוססות תרופה ( כלומר, mitomycin C, סוכן antiancer), משום שהוא מאפשר להפלות גנים כי מגיבים סוכן genotoxic מאלה שהושפעו רק על ידי הפרעות מחזור התא שהוטל על ידי הסוכן.

Introduction

המעבר דרך כל השלבים של מחזור התא הוא מצורף לתוכנית ביטוי הגן מוסדר היטב. זה מתואמת "לסירוגין" של שעתוק גנים ברחבי מחזור התא הוא האמין להיות תחת שליטה של ​​מערכות תמלול מורכבות תעתיק, המסדיר לא רק את העיתוי, אלא גם את רמות ביטוי גנים. הדה-רגולציה של מרכיבי מחזורי התא העיקריים ידועה כתורמת להתפתחותן של מספר מחלות והיא סימן ההיכר המובהק של tumorigenesis 1 , 2 . ניתוחי גנום רחבי תמליל שבוצעו בתאי שמרים ותאי יונקים גילו שמספר רב של גנים מציגים דפוסי ביטוי גנטיים מחזוריים במחזור התא, דבר המצביע על כך שתנודות תעתיק במהלך מחזור התא משקפות את הדרישה הטמפורלית של מוצר גנטי נתון בשלב 3 , 4 , </suP> 5 .

משימה מרכזית בחקר מחזור גנים מוסדר במחזור גנים היא סינכרון של תאים לשלבים ספציפיים של מחזור התא. סינכרון תאים מסייע לפרש את ההתאמה של דפוס ביטוי גנטי לתא מסוים של מעבר מחזורי התא, והוא הוביל להבנה טובה יותר של הרגולציה והתפקוד של גנים רבים. סינכרון סלולרי חשוב גם לחקר מנגנון הפעולה של תרופות נגד סרטן, כמו סוכני כימותרפיה ידועים להשפיע הן ביטוי גנים כמו גם מחזור תאים קינטיקה 6 , 7 . עם זאת, לעתים קרובות קשה לקבוע אם הפרשי ביטוי גנים הנובעים מטיפול בסוכנים אלה הם תגובה ישירה לטיפול או שהם רק תוצאה של שינויים בפרופילי מחזור התא. כדי להבחין בין האפשרויות הללו, ביטוי גנים צריך להיות מנותח בתאים שהיו sYnchronized לפני תוספת של תרופה כימותרפית.

למעט כמה תאים ראשוניים כגון תאים לימפואידים מבודדים טרי, אשר מהווים אוכלוסיית תאים הומוגנית מסונכרן G0 8 -, במבחנה הוקמה שורות תאים לגדול באופן אסינכרוני בתרבות. תחת תנאי צמיחה רגילים, אלה אופניים אסינכרוני אופניים נמצאים בכל השלבים של מחזור התא אבל, מעדיפים G1 9 . לכן, הקשר זה אינו מספק תרחיש אופטימלי עבור ניתוח פונקציונלי או ביטוי גנים בשלב מחזור תא מסוים ( לדוגמה , G1, S וכו '). שורות תאים נצחיות שלא הוסבו ( כגון fibroblasts) ניתן לסנכרן עם מה שמכונה שיטות פיזיולוגיות 10 . שיטות אלה מבוססות על תכונות התא העיקרי שנשמר של תאים שאינם משנים, כגון עיכוב קשר עם תא ותלות גורם גדילה כדי להמשיך את רכיבה על אופניים. הֲסָרָהשל סרום בשילוב עם עיכוב מגע הופך תאים שאינם הופכים נעצרו ב G0 / G1. עם זאת, מסומן מחזור מחזור התא התקדמות לעתים קרובות דורש תת, אשר כרוך גם ניתוק מלאכותי של תאים מחדש ציפוי 10 . והכי חשוב, שיטה זו אינה מתאימה לסינכרון של שורות תאים שהשתנו, הרוב המכריע של שורות תאים מבוססות הנמצאות בשימוש, המאופיינות בחסרונם של עיכובים בצמיחת מגע בתא או בתגובה לנסיגת גורמי גדילה. לכן, ברור כי שיטות חלופיות נדרשים סינכרון תא יעיל בשלבים ספציפיים של מחזור התא. באופן כללי, שיטות הסינכרון הנפוצות ביותר מבוססות על עיכוב כימי זמני או פרמקולוגי של נקודה מוגדרת אחת של מחזור התא, בדרך כלל סינתזה של DNA או יצירת ציר מיטוטי. עיכוב של סינתזת דנ"א מסנכרן תאים על ידי מעצר אותם בסוף G1 או בשלב S מוקדם. זה יכול להיות achiEved על ידי הוספת תרכובות כגון mimosine, מעכב של ביוטוסיזה של נוקליאוטיד 11 , 12 , aphidicolin, מעכב של פולימרים 13 , 14 , hydroxyurea, מעכב של ribonucleotide רדוקטאז 15 , 16 או על ידי כמויות עודפות של תימידין 17 , 18 . מצד שני, מעכבי פילמור microtubule, כגון קולצ'יצין או nocodazole, מסוגלים לחסום היווצרות ציר מיטוטי המוביל סינכרון התא בשלב M מוקדם 19 , 20 , 21 .

בעבודה זו אנו מתארים שיטה המערבת שני פרוטוקולים סינכרון משלימים המבוססים על עיכוב כימי חולף ללימוד הביטוי של גנים מחזורי מוסדר מחזור התא ב mRNAרָמָה. שיטה זו היא בסיסית להגדרת תפקידם של גנים במחזור תאים בתהליכי מחזור תאים ספציפיים. יתר על כן, הוא מספק מסגרת כללית לחקר ההשפעה של טיפולים נגד סרטן כדי לזהות במדויק את הגנים המגיבים לתרופות ולמזער הפרעות שגויות הנגזרות מהפרעות בתהליכי מחזור התא שנוצרו על ידי תרופות אלו.

Protocol

1. סינכרון נייד, שחרור ומעקב של התקדמות מחזור התא תימידין ו- nocodazole מבוססי (Thy-Noc) סינכרון ושחרור של תאים U2OS מ מיטוזה הכינו המדיום הנדרש לתרבות תאים. תאים U2OS גדלים ?…

Representative Results

ייצוג סכמטי של פרוטוקולים Thy-Noc ו- HU עבור סינכרון תאים. איור 1 מסכם את הצעדים הנדרשים עבור סינכרון תא U2OS ואת אוסף המדגם הבאים על מנת לאמת את ההתקדמות דרך מחזור התא ולבצע ניתוח ביטוי גנים. </p…

Discussion

ניתוח גנים מווסתים עדינים המעורבים בתפקידים זמניים וספציפיים במחזור התא דורשים אוכלוסיית תאים אחידה. חוקרים רבים משתמשים באופן שגרתי בקווי תאים סרטניים ארוכי טווח למטרות אלו, ומספר שיטות פותחו כדי להשיג אוכלוסיות תאים סינכרוני (או סינכרוני), במטרה לצבור תאים רבים כ…

Disclosures

The authors have nothing to disclose.

Acknowledgements

אנו מודים לחברי Zubiaga ומעבדות Altmeyer לדיונים מועילים ולתמיכה טכנית. עבודה זו נתמכה על ידי מענקים מהמשרד הספרדי (SAF2015-67562-R, MINECO / FEDER, UE), ממשלת הבאסקים (IT634-13 ו KK-2015/89), ואת אוניברסיטת המדינה הבסקית UPV / EHU ( UFI11 / 20).

Materials

DMEM, high glucose, GutaMAX supplement Thermo Fisher Scientific 61965-059
FBS, qualified, E.U.-approved, South America origin Thermo Fisher Scientific 10270-106
Penicillin-Streptomycin (10,000 U/mL) Thermo Fisher Scientific 15140-122
0.25% Trypsin-EDTA (1X), phenol red Thermo Fisher Scientific 25200-072
Thymidine SIGMA T1895-5G Freshly prepared. Slight warming might help dissolve thymidine.
Nocodazole SIGMA M-1404 Stock solution in DMSO stored at -20 ºC in small aliquots
Hydroxyurea SIGMA H8627 Freshly prepared
Mitomycin C from Streptomyces caespitosus SIGMA M4287 1.5mM stock solution in sterile H2O protected from light and stored at 4ºC
Dimethyl sulfoxide SIGMA D2650
Propidium iodide SIGMA P4170 Stock solution in sterile PBS at 5 mg/ml, stored at 4º C protected from light.
PBS pH 7.6 Home made
Ethanol PANREAC A3678,2500
Chloroform SIGMA C2432
Sodium Citrate PANREAC 131655
Triton X-100 SIGMA T8787
RNAse A Thermo Fisher Scientific EN0531
TRIzol Reagent LifeTechnologies 15596018
RNeasy Mini kit QIAGEN 74106
High-Capacity cDNA Reverse Transcription Kit Thermo Fisher Scientific 4368814
Anti-Cyclin E1 antibody Cell Signaling 4129 1:1000 dilution in 5% milk, o/n, 4 ºC
Anti-Cyclin B1 antibody Cell Signaling 4135 1:1000 dilution in 5% milk, o/n, 4 ºC
Anti-β-actin SIGMA A-5441 1:3000 dilution in 5 % milk, 1 hr, RT
Anti-pH3 (Ser 10) antiboty Millipore 06-570 Specified in the protocol
Secondary anti-rabbit AlexaFluor 488 antibody Invitrogen R37116 Specified in the protocol
Secondary anti-mouse-HRP antibody Santa Cruz Biotechnology sc-3697 1:3000 dilution in 5 % milk, 1 hr, RT
Forward E2F1 antibody (human)                    TGACATCACCAACGTCCTTGA Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse E2F1 antibody (human)                    CTGTGCGAGGTCCTGGGTC Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Forward E2F7 antibody (human)                    GGAAAGGCAACAGCAAACTCT Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse E2F7 antibody (human)                    TGGGAGAGCACCAAGAGTAGAAGA Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Forward p21Cip1 antibody (human)                    AGCAGAGGAAGACCATGTGGAC Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse p21Cip1 antibody (human)                    TTTCGACCCTGAGAGTCTCCAG Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Forward TBP antibody (human) reference gene                     Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse TBP antibody (human)                     Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Forward Oxa1L antibody (human) reference gene   CACTTGCCAGAGATCCAGAAG                  Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse Oxa1L  antibody (human)    CACAGGGAGAATGAGAGGTTTATAG                 Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Power SYBRGreen PCR Master Mix Thermo Fisher Scientific 4368702
FACS Tubes  Sarstedt 551578
MicroAmp Optical 96-Well Reaction Plate Thermo Fisher Scientific N8010560
Corning 100mm TC-Treated Culture Dish Corning
Corning Costar cell culture plates 6 well Corning 3506
Refrigerated Bench-Top Microcentrifuge Eppendorf 5415 R
Refrigerated Bench-Top Centrifuge Jouan CR3.12 Jouan 743205604
NanoDrop Lite Spectrophotometer Thermo Scientific ND-LITE-PR
BD FACSCalibur Flow Cytometer BD Bioscience
QuantStudio 3 Real-Time PCR System Thermo Fisher Scientific A28567
DOWNLOAD MATERIALS LIST

References

  1. Beato, M., Sánchez-Aguilera, A., Piris, M. A. Cell cycle deregulation in B-cell lymphomas. Blood. 101 (4), 1220-1235 (2003).
  2. Chen, H. Z., Tsai, S. Y., Leone, G. Emerging roles of E2Fs in cancer: an exit from cell cycle control. Nat Rev Cancer. 9 (11), 785-797 (2009).
  3. Cho, R. J., et al. Transcriptional regulation and function during the human cell cycle. Nat Genet. 27 (1), 48-54 (2001).
  4. Peña-Diaz, J., et al. Transcription profiling during the cell cycle shows that a subset of Polycomb-targeted genes is upregulated during DNA replication. Nucleic Acids Res. 41 (5), 2846-2856 (2013).
  5. Grant, G. D., et al. Identification of cell cycle-regulated genes periodically expressed in U2OS cells and their regulation by FOXM1 and E2F transcription factors. Mol Biol Cell. 24 (23), 3634-3650 (2013).
  6. Minderman, H., et al. In vitro and in vivo irinotecan-induced changes in expression profiles of cell cycle and apoptosis-associated genes in acute myeloid leukemia cells. Mol Cancer Ther. 4 (6), 885-900 (2005).
  7. McKenna, E., Traganos, F., Zhao, H., Darzynkiewicz, Z. Persistent DNA damage caused by low levels of mitomycin C induces irreversible cell senescence. Cell Cycle. 11 (16), 3132-3140 (2012).
  8. Infante, A., et al. E2F2 represses cell cycle regulators to maintain quiescence. Cell Cycle. 7 (24), 3915-3927 (2008).
  9. Cecchini, M. J., Amiri, M., Dick, F. A. Analysis of cell cycle position in mammalian cells. J Vis Exp. (59), (2012).
  10. Schorl, C., Sedivy, J. M. Analysis of cell cycle phases and progression in cultured mammalian cells. Methods. 41 (2), 143-150 (2007).
  11. Lalande, M. A reversible arrest point in the late G1 phase of the mammalian cell cycle. Exp Cell Res. 186 (2), 332-339 (1990).
  12. Park, S. Y., et al. Mimosine arrests the cell cycle prior to the onset of DNA replication by preventing the binding of human Ctf4/And-1 to chromatin via Hif-1α activation in HeLa cells. Cell Cycle. 11 (4), 761-766 (2012).
  13. Ikegami, S., et al. Aphidicolin prevents mitotic cell division by interfering with the activity of DNA polymerase-alpha. Nature. 275 (5679), 458-460 (1978).
  14. Baranovskiy, A. G., et al. Structural basis for inhibition of DNA replication by aphidicolin. Nucleic Acids Res. 42 (22), 14013-14021 (2014).
  15. Adams, R. L., Lindsay, J. G. Hydroxyurea reversal of inhibition and use as a cell-synchronizing agent. J Biol Chem. 242 (6), 1314-1317 (1967).
  16. Mitxelena, J., Apraiz, A., Vallejo-Rodríguez, J., Malumbres, M., Zubiaga, A. M. E2F7 regulates transcription and maturation of multiple microRNAs to restrain cell proliferation. Nucleic Acids Res. , (2016).
  17. Bootsma, D., Budke, L., Vos, O. Studies on synchronous division of tissue culture cells initiated by excess thymidinE. Exp Cell Res. 33, 301-309 (1964).
  18. Galgano, P. J., Schildkraut, C. L. G1/S Phase Synchronization using Double Thymidine Synchronization. CSH Protoc. (2), (2006).
  19. Edwin Taylor, W. Kinetics of inhibition and the binding of h3-colchicine. J Cell Biol. 25, 145-160 (1965).
  20. Zieve, G. W., Turnbull, D., Mullins, J. M., McIntosh, J. R. Production of large numbers of mitotic mammalian cells by use of the reversible microtubule inhibitor nocodazole. Nocodazole accumulated mitotic cells. Exp Cell Res. 126 (2), 397-405 (1980).
  21. Matsui, Y., Nakayama, Y., Okamoto, M., Fukumoto, Y., Yamaguchi, N. Enrichment of cell populations in metaphase, anaphase, and telophase by synchronization using nocodazole and blebbistatin: a novel method suitable for examining dynamic changes in proteins during mitotic progression. Eur J Cell Biol. 91 (5), 413-419 (2012).
  22. Nolan, T., Hands, R. E., Bustin, S. A. Quantification of mRNA using real-time RT-PCR. Nat Protoc. 1 (3), 1559-1582 (2006).
  23. Thornton, B., Basu, C. Real-time PCR (qPCR) primer design using free online software. Biochem Mol Biol Educ. 39 (2), 145-154 (2011).
  24. Abbas, T., Dutta, A. p21 in cancer: intricate networks and multiple activities. Nat Rev Cancer. 9 (6), 400-414 (2009).
  25. Kung, A. L., Sherwood, S. W., Schimke, R. T. Cell line-specific differences in the control of cell cycle progression in the absence of mitosis. Proc Natl Acad Sci U S A. 87 (24), 9553-9557 (1990).
  26. Borel, F., Lacroix, F. B., Margolis, R. L. Prolonged arrest of mammalian cells at the G1/S boundary results in permanent S phase stasis. J Cell Sci. 115 (Pt. 14, 2829-2838 (2002).
  27. Knehr, M., et al. A critical appraisal of synchronization methods applied to achieve maximal enrichment of HeLa cells in specific cell cycle phases). Exp Cell Res. 217 (2), 546-553 (1995).
  28. Zhu, W., Giangrande, P. H., Nevins, J. R. E2Fs link the control of G1/S and G2/M transcription. EMBO J. 23 (23), 4615-4626 (2004).
  29. Whitcomb, E. A., Dudek, E. J., Liu, Q., Taylor, A. Novel control of S phase of the cell cycle by ubiquitin-conjugating enzyme H7. Mol Biol Cell. 20 (1), 1-9 (2009).
  30. Bruinsma, W., Macurek, L., Freire, R., Lindqvist, A., Medema, R. H. Bora and Aurora-A continue to activate Plk1 in mitosis. J Cell Sci. 127, 801-811 (2014).
  31. Thomas, D. B., Lingwood, C. A. A model of cell cycle control: effects of thymidine on synchronous cell cultures. Cell. 5 (1), 37-42 (1975).
  32. Whitfield, M. L., et al. Identification of genes periodically expressed in the human cell cycle and their expression in tumors. Mol Biol Cell. 13 (6), 1977-2000 (2002).
  33. Lim, S., Cdks Kaldis, P. cyclins and CKIs: roles beyond cell cycle regulation. Development. 140 (15), 3079-3093 (2013).
  34. Tapia, C., et al. Two mitosis-specific antibodies, MPM-2 and phospho-histone H3 (Ser28), allow rapid and precise determination of mitotic activity. Am J Surg Pathol. 30 (1), 83-89 (2006).
  35. Andreassen, P. R., Martineau, S. N., Margolis, R. L. Chemical induction of mitotic checkpoint override in mammalian cells results in aneuploidy following a transient tetraploid state. Mutat Res. 372 (2), 181-194 (1996).
  36. Wei, F., Xie, Y., He, L., Tao, L., Tang, D. ERK1 and ERK2 kinases activate hydroxyurea-induced S-phase checkpoint in MCF7 cells by mediating ATR activation. Cell Signal. 23 (1), 259-268 (2011).
  37. Kubota, S., et al. Activation of the prereplication complex is blocked by mimosine through reactive oxygen species-activated ataxia telangiectasia mutated (ATM) protein without DNA damage. J Biol Chem. 289 (9), 5730-5746 (2014).
  38. Hartwell, L. H., Weinert, T. A. Checkpoints: controls that ensure the order of cell cycle events. Science. 246 (4930), 629-634 (1989).
  39. St-Denis, N. A., Derksen, D. R., Litchfield, D. W. Evidence for regulation of mitotic progression through temporal phosphorylation and dephosphorylation of CK2alpha. Mol Cell Biol. 29 (8), 2068-2081 (2009).
  40. Min, A., et al. RAD51C-deficient cancer cells are highly sensitive to the PARP inhibitor olaparib. Mol Cancer Ther. 12 (6), 865-877 (2013).

Tags

Cell CycleGene ExpressionCell SynchronizationU2OS CellsThymidine BlockNocodazoleMitotic Cell ArrestG2-MRNA ExtractionFACS Analysis
check_url/55745?article_type=t

Play Video
PDF
DOI
DOWNLOAD MATERIALS LIST
Cite This Article
Apraiz, A., Mitxelena, J., Zubiaga, A. Studying Cell Cycle-regulated Gene Expression by Two Complementary Cell Synchronization Protocols. J. Vis. Exp. (124), e55745, doi:10.3791/55745 (2017).
Download Citation
Reprints and Permissions

View Video

✖

To prove you're not a robot, please enter the text in the image below

CAPTCHA Image
Play CAPTCHA Audio
Refresh Image