JoVE Journal > Biochemistry
Summary
Abstract
Introduction
Protocol
Results
Discussion
Disclosures
Acknowledgements
Materials
References
Automatic Translation
Please note that all translations are automatically generated. Click here for the English version.
Biochemistry

식물 원형질에서 mRNA Interactome 캡처

Published: July 28, 2017
doi:
10.3791/56011
, , ,
1Department of Biology,KU Leuven

Summary

여기, 우리는 Arabidopsis thaliana 엽초 엽 원형체에 적용된 상호 작용 캡처 프로토콜을 제시한다. 이 방법은 생체 내 UV 가교 결합에 비판적으로 의존하며 생리 환경으로부터 식물 mRNA 결합 단백질의 분리 및 동정을 허용합니다.

Abstract

RNA 결합 단백질 (RBP)은 RNA의 운명을 결정합니다. 그들은 모든 RNA 생합성 경로에 참여하며 특히 mRNA (messenger RNAs)의 전사 후 유전자 조절 (post-transcriptional gene regulation, PTGR)에 기여합니다. 지난 몇 년 동안, 효모 및 포유류 세포주의 많은 mRNA 결합 단백질은 mRNA 결합 단백질 (mRBPs)의 동정을 가능케하는 "mRNA 상호 작용 체 포획 (interaction)"이라는 새로운 방법의 사용을 통해 성공적으로 분리되었다. 생리적 인 환경에서 직접적으로. 이 방법은 올리고 (dT) 비드에 의한 메신저 리보 뉴클레오타이드 복합체 (mRNP)의 생체 내 자외선 (UV) 가교 결합, 풀다운 및 정제, 및 질량 분석기 (MS)에 의한 가교 결합 단백질의 후속 확인으로 구성된다. 아주 최근에 같은 방법을 적용하여 여러 가지 식물 mRNA 결합 프로테옴이 다른 Arabidopsis 조직 공급원에서 동시에보고되었다 : 뿌리 뽑힌 묘목, 잎 조직,엽초 엽 모세포 및 배양 된 뿌리 세포를 포함한다. 여기, 우리는 Arabidopsis thaliana 엽초 엽 원형질에 대한 최적화 된 mRNA 인터랙티브 캡쳐 방법을 제시하는데, 이는 다양한 세포 분석을 포함하는 실험을위한 다용도 도구의 역할을하는 세포 유형이다. 최적의 단백질 수율을위한 조건에는 조직의 시작과 UV 조사 시간이 포함됩니다. 중간 규모 실험 (10 7 세포)에서 얻은 mRNA 결합 프로테옴에서 RNA 결합 능력을 가진 RBP가 과다하게 나타 났으며 많은 새로운 RBP가 확인되었다. 실험을 확대 (10 9 세포) 할 수 있으며 최적화 된 방법을 다른 식물 세포 유형 및 종에 적용하여 식물에서 mRNA 결합 단백질을 광범위하게 분리, 분류 및 비교할 수 있습니다.

Introduction

진핵 생물은 세포 생물학적 과정을 유지하기 위해 다중 RNA 생합성 조절 경로를 사용합니다. 알려진 종류의 RNA 중에서 mRNA는 매우 다양하며 단백질과 그 이소 형의 코딩 용량을 가지고 있습니다 1. PTGR 경로는 pre-mRNA 2 , 3 의 운명을 지시합니다. 서로 다른 유전자 군의 RBP가 RNA의 조절을 조절하고, PTGR에서는 특정 mRBP가 기능적 mRNP를 형성하는 직접적인 물리적 상호 작용을 통해 mRNA를 유도합니다. 따라서, 식별 및 mRBPs의 특성과 mRNPs 것은 지난 30 년 .Over 세포의 mRNA 대사 2의 규정을 이해하는 데 중요하다, 다양한 시험 관내 방법 – RNA 전기 영동 이동성의 변화 (REMSA) 분석, 지수 농축 분석에 의한 리간드의 체계적 발전을 포함하여 (RBNS), 방사성 표지 또는 정량 분석 ​​(RNA Bind-n-Seq, RBNS)형광 RNA 결합 분석, X 선 결정학 및 NMR 분광법은 4, 5, 6, 7, 8, 9 – 널리 주로 포유 동물 세포에서 RBPs 연구에 적용되어왔다. 포유류 RBP에 대한 이러한 연구의 결과는 RNA-binding Protein DataBase (RBPDB)를 통해 검색 할 수 있으며, 이는 공개 된 관측치 10 을 수집합니다.

이러한 in vitro 접근법은 강력한 도구이지만 주어진 RNA 풀 시퀀스로부터 결합 된 RNA 모티프를 결정하므로 새로운 표적 RNA를 발견 할 수있는 능력이 제한적입니다. 계산 전략은 단백질 서열의 보존을 기반으로 게놈 전체의 RBPs을 예측하고 (15)를 구성하는 마찬가지입니다. 이를 극복하기 위해 새로운 실험 방법 인 ha이는 관심의 RBP가 상호 작용하는 RNA 모티프의 식별 및 결합의 정확한 위치 결정을 가능하게합니다. "crosslinking and immunoprecipitation"(CLIP)이라고 불리는이 방법 은 생체 내 UV 가교 결합 후 면역 침전 11로 구성 됩니다. 초기 연구에 따르면 245 nm보다 큰 자외선 파장에서 DNA 및 RNA 뉴클레오티드의 광 활성화가 발생할 수 있습니다. 티미 딘을 통한 반응이 선호되는 것으로 보인다 (광 반응성 감소 순서 : dT ≥ dC> rU> rC, dA, dG) 12 . 파장이 254 nm (UV-C) 인 UV 광을 사용하여 단 몇 옹스트롬 (Å) 범위에서 RNA 뉴클레오타이드와 단백질 잔기 사이의 공유 결합이 생성되는 것으로 관찰되었습니다. 따라서이 현상을 RNA와 RBP의 "zero-length"가교라고합니다. 이것은 엄격한 정화 과정 배경이 거의없는 채약 13 , 14 .

CLIP에 보완적인 전략은 RBP의 풍경을 기술하기 위해 단백질 확인과 생체 내 UV 교차 결합을 결합하는 것입니다. 이러한 게놈 전체 mRNA에 결합 된 프로테옴의 수는, "mRNA의 상호 작용 체 캡처"(18)라고, 효모 세포, 배아 줄기 세포 (는 ESC),이 새로운 실험 방법을 사용하여 인간의 세포 라인 (즉, HEK293와 헬라)에서 분리 된 19 , 20 , 21 . 이 방법은 생체 내 UV 가교 결합과 mRNP 정제 및 MS 기반 프로테오믹스로 구성됩니다. 이 전략을 적용함으로써, 비표준 RBD를 포함하는 많은 새로운 "달빛"RBP가 발견되었고, 더 많은 단백질이 이전에 상상했던 것보다 RNA 결합 능력을 가지고 있음이 분명 해졌다"> 15, 16, 17.이 방법의 사용은 새로운 애플리케이션과 RBPs을 조사 할 때 새로운 생물학적 질문에 대답 할 수있는 기능을 허용합니다. 예를 들어, 최근의 연구는 mRNA에 결합 된 프로테옴 (핵심 RBP의 보존을 조사하고있다 proteome) 22 .

식물 RBP는 이미 성장과 발달에 관여하고있다 ( 예 : 개화시기의 후 전사 조절, 24 시간주기, 미토콘드리아와 엽록체의 유전자 발현) 24 , 25 , 26 , 27 , 28 , 29 . 또한, 그들은 비 생물 적 스트레스에 반응하는 세포 과정에서 기능을 수행하는 것으로 생각된다 ( 예, 감기, 가뭄, salinity 및 abscisic acid (ABA)) 31 , 32 , 33 , 34 . RNA 인식 모티프 (RRM) 및 K 상 동성 (KH) 도메인 서열 모티프에 기초하여 애기 장대 게놈에 200 개 이상의 예측 된 RBP 유전자가 존재하며; 쌀에는 대략 250 개가 35 , 36 으로 기록되어있다. 예상되는 많은 RBP가 식물에만 고유 한 것으로 여겨지는 것은 주목할 만하다. ( 예를 들어, RRM 도메인을 포함하는 예측 된 Arabidopsis RBP의 약 50 %에 걸친 metazoan ortholog는 없다) 35) , 이는 많은 사람들이 새로운 기능을 수행 할 수 있음을 시사한다. 대부분의 예측 RBPs의 기능은 23지지 않은 남아있다.

Arabidopsis 에서 발현 된 mRNA- 결합 된 프로테옴의 분리는 모종, 잎 조직, 배양 된 뿌리 세포 및 잎의 엽초 원형질체를mRNA의 상호 작용 체 캡처은 최근 39 (38)보고되었다. 이 연구는 가까운 장래에 식물에서 기능적 RBP를 체계적으로 목록화할 강력한 가능성을 보여줍니다. 여기, 우리는 식물 protoplasts ( 즉, 세포 벽이없는 세포)에서 mRNA interactome 캡처에 대한 프로토콜을 제시한다. Arabidopsis thaliana 엽초 엽 원형 엽 세포는 잎 세포의 주요 유형이다. 분리 된 원형질체는 세포에 자외선을 최적으로 닿게합니다. 이 세포 유형은 기능적 특성을 위해 단백질을 일시적으로 발현하는 분석법에서 사용할 수 있습니다 40 , 41 . 또한 protoplasting 다른 여러 식물 세포 종류 및 종을 42, 43, 44에 적용되어왔다 (., Bargmann 바움 및 2010; 예를 들어, 피터슨 등, 2009 년 홍콩 등, 2012)..

<p class = "jove_content">이 방법은 총 11 단계 ( 그림 1A )를 포함합니다. Arabidopsis 엽초 엽 원형체를 먼저 단리하고 (단계 1) UV 조사를하여 가교 결합 된 mRNP를 형성한다 (단계 2). 원형질체가 변성 조건 (단계 3) 하에서 용해 될 때, 가교 결합 된 mRNP는 용해 / 결합 완충액에서 방출되고 oligo-d (T) 25 비드에 의해 당겨진다 (단계 4). 몇 차례의 엄격한 세척 후에, mRNP를 정제하고 추가로 분석한다. mRBPs의 변성 펩티드는 가교 결합 mRNA가 정제되기 전에 프로 테이나 제 K에 의해 분해되고 RNA 품질은 qRT-PCR (단계 5 및 6)에 의해 검증된다. RNase 처리 및 단백질 농도 (단계 7) 후에, 단백질 품질은 SDS 폴리 아크릴 아미드 겔 전기 영동 (SDS-PAGE) 및은 염색 (단계 8)에 의해 조절된다. 단백질 밴드 패턴의 차이점은 가교 샘플 (CL)과 비가 교 샘플 (non-crosslinked sample) 사이에서 쉽게 시각화 될 수 있습니다.UV 조사를받지 않은 원형질체로부터의 음성 대조군 샘플). 단백질의 확인은 MS 기반 프로테오믹스를 통해 이루어집니다. CL 샘플의 단백질은 1 차원 폴리 아크릴 아미드 겔 전기 영동 (1D-PAGE)으로 분리되어 가능한 배경 오염을 제거하고, 트립신을 사용하여 짧은 펩타이드로 "in-gel digestion"되고 정제됩니다 (9 단계). 질량 분광기 (nano-LC-MS)에 결합 된 나노 역상 액체 크로마토 그래피는 mRNA- 결합 프로테옴에서 결정적인 단백질의 양을 결정할 수있게합니다 (단계 10). 마지막으로, 확인 된 mRBPs는 생물 정보학 분석을 사용하여 특성화되고 목록 화됩니다 (11 단계).

Protocol

1. Arabidopsis Leaf Mesophyll 원형질체 단리 참고 : 유 등의 알에 의해 설명 된 애기 장대 잎의 엽육의 원형질체는 기본적으로 격리되어, 2007, 몇 가지 수정 (40).. 식물의 성장 성층화를 위해 어둠 속에서 4 ℃에서 2 일 동안 약 200 개의 애기 장대 Col-0 에코 타입 종자를 멸균 수에 담근다. 참고 :이 시드 수는 …

Representative Results

우리는 세척 버퍼 2 ( 그림 1B )와 함께 세척 단계 4.3에서 CL 샘플의 비드 펠렛을 둘러싼 특징적인 후광을 관찰했습니다. 그것이 조사되지 않았지만,이 현상은 자성 포획 동안 가교 결합 된 mRNP 복합체가 비드 응집체와 간섭하여보다 확산 된 응집체가 형성되는 것으로 설명 될 수있다. 그것은 (T) (25)의 비드 포착 올리고 D 14 효?…

Discussion

우리는 성공적으로 효모 및 인간 세포를 위해 개발 된 mRNA 상호 작용 포획을 엽초 엽 원형 엽록체에 적용했다. 잎 초 필 세포는 식물 잎의 지상 조직의 주요 유형입니다. 이 방법의 가장 큰 장점은 생체 환경에서 단백질을 발견하기 위해 생체 내 가교 결합을 사용한다는 것입니다.

이 프로토콜에서, 우리는 주로 최적의 실험 조건 (50) (예를 들…

Disclosures

The authors have nothing to disclose.

Acknowledgements

우리는 기존 UV 램프가 장착 된 UV 가교 장치를 제공 한 Joris Winderickx 교수의 실험실을 인정합니다. KG는 KU Leuven 연구 기금이 지원하며 FWO 교부금 G065713N의 지원을 인정합니다.

Materials

REAGENTS
0.8 M Mannitol Sigma M1902-500G Primary isotonic Enzyme solution &
MMg solution
2M KCl MERCK Art. 4935 Primary isotonic Enzyme solution &
W5 buffer
0.2 M MES (pH 5.7)
(4-morpholineethanesulfonic acid)		 Sigma-aldrich M2933 Primary isotonic Enzyme solution,
W5 buffer &
MMg solution,
Filtration sterilization
Cellulase R10 Yakult Pharmaceutical Industry Co., Ltd. CELLULASE
“ONOZUKA”
R-10, 10 g		 Final isotonic enzyme solution
Macerozyme R10 Yakult Pharmaceutical Industry Co., Ltd. MACEROZYME R-10, 10g Final isotonic enzyme solution
10% (w/v) BSA
(Bovine Serum Albumin)		 Sigma-aldrich A7906-100G Final isotonic enzyme solution &
Filtration sterilization
1M CaCl2 Chem-Lab NV CL00.0317.1000 Final isotonic enzyme solution,
W5 buffer &
Digestion buffer
1M NaCl Fisher Chemical S/3160/60 W5 buffer
2M MgCl2 Sigma M8266-100G MMg solution
1M LiCl
(Lithium Chloride)		 Acros 199885000 Lysis/binding buffer,
Wash buffer 1,
Wash buffer 2 &
Low salt buffer
5% (w/v) LiDS
(Lithium Dodecyl Sulphate)		 Sigma-aldrich L4632-25G Lysis/binding buffer,
Wash buffer 1 &
Filtration sterilization
1M DTT
(Dithiothreitol)		 Thermo Fisher Scientific
Wash buffer 1 &
Wash buffer 2		 307866 Lysis/binding buffer,
1M Tris-HCl (pH 7.5) (Tris(hydroxymethyl)aminomethane, Hydrochloric acid S.G. (HCl)) Acros &
Fisher Chemical		 167620010 &
H/1200/PB15		 Lysis/binding buffer,
Wash buffer 1,
Wash buffer 2,
Low salt buffer &
Elution buffer
0.5 M EDTA (pH 8.0) (Ethylenediaminetetraacetic acid) Sigma-aldrich ED-500G Lysis/binding buffer,
Wash buffer 1,
Wash buffer 2,
Low salt buffer &
Elution buffer
Tween 20 MERCK 8.22184.0500 Regeneration of oligo-d(T)25 beads
0.1 M NaOH VWR PROLABO CHEMICALS 28244.295 Regeneration of oligo-d(T)25 beads
1X PBS (pH 7.4)
(Phosphate Buffered Saline)
containing
(NaCl; KCl; Na2HPO4; KH2PO4)		 Fisher Chemical, MERCK,
Sigma-aldrich & SAFC		 S/3160/60,
Art. 4935,
71640-250G &
60230		 Regeneration of oligo-d(T)25 beads
Proteinase K solution (2 μg/μL) Thermo Fisher Scientific 11789020 Protein digestion
Loading dye Invitrogen LC5925 SDS-PAGE
qPCR master mix Promega A6001 qRT-PCR assay
RNase Cocktail Thermo Fisher Scientific AM2286 RNA digestion
Methanol Sigma-aldrich 322415 Gel fixation and gel destaining
Acetic acid Sigma-aldrich 537020 Gel fixation and gel destaining
Coomassie Brilliant Blue R-250 Thermo Fisher Scientific 20278 Gel staining
1M NH4HCO3
(Ammonium bicarbonate)
 		 Sigma-aldrich 09830-500G Gel hydration &
Digestion buffer
CH3CN
(Acetonitrile)		 Sigma-aldrich 34851-100ML Gel dehydration &
Peptide dissolving solution
IAA
(Iodoacetic acid)		 Sigma-aldrich I4386-10G Alkylating agent
TFA
(Trifluoroacetic acid)		 Sigma-aldrich 302031-10X1ML Peptide dissolving solution
FA
(Formic acid)		 Sigma-aldrich 06554-5G Peptide extraction
Trypsin solution (6 ng/μL) Promega V5280 Digestion buffer
Name Company Catalog Number Comments
EQUIPMENT
Soil Peltracom LP2D Plant growth
Vermiculite 3 Sibli AS 05VERMICULIET Plant growth
Petri dish (150 x 20 mm) Sarstedt 82.1184.500 Carrier for protoplast suspension
0.22 μm filter Millipore SE2M229104 Homogenization of final isotonic enzyme solution
Razorblade Agar Scientific T585 Rosette leaf strips
35-75 μm nylon mesh SEFAR NITEX 74010 Protoplast suspension filtration
50 mL round bottom tubes Sigma-aldrich T1918-10EA Carrier for protoplast suspension
Hemocytometer
(Bürker hemocytometer)		 MARIENFELD 650030 Protoplast cell counting
UV crosslinking apparatus
(HL-2000 HybriLinker)		 UVP, LLC UVP95003101 in vivo UV crosslinking
UV lamp
(Sankyo-Denki G8T5)		 SANKYO
DENKI		 SD G8T5 in vivo UV crosslinking
50 mL glass syringe FORTUNA Optima Z314560 Homogenization of protoplast lysate
Narrow needle (0.9 x 25 mm) Becton Dickinson microlance 3 2021-04 Homogenization of protoplast lysate
Rotator Model L26 Labinco BV 26110912 Sample incubation by rotating
Oligo-d(T)25 magnetic beads
(5 mg/mL)		 New England BioLabs S1419S mRNPs and mRNAs binding and pull-down
Magnetic rack Invitrogen CS15000 mRNPs and mRNAs binding and pull-down
Centrifugal filter units
(Amicon Ultra-4 centrifugal filter units)		 EMD Millipore UFC800308 mRBP concentration
Pierce Silver Stain Kit Thermo Fisher Scientific 24612 Silver-staining assay
RNA purification kit
(InviTrap Spin Plant RNA Mini Kit)		 STRATEC Molecular 1064100300 RNA purification
Spectrophotometer device (NanoDrop 1000 Spectrophotometer) Thermo Fisher Scientific ND-1000 RNA quality and quantity
Real-Time PCR cycler
(StepOne Real-Time PCR cycler)		 Thermo Fisher Scientific 4376600 cDNA quantification
µ-C18 columns
(Millipore Zip Tip µ-C18 columns)		 Sigma-aldrich 720046-960EA Peptide purification
Mass spectrometer
(Q Exactive Hybrid Quadrupole-Orbitrap Mass Spectrometer)		 Thermo Fisher Scientific IQLAAEGAAPFALGMAZR Mass spectrometry-based proteomics
Liquid chromatography instrument (Ultimate 3000 ultra-high performance liquid chromatography (UHPLC) instrument) Thermo Fisher Scientific ULTIM3000RSLCNANO Mass spectrometry-based proteomics
C18 column
(Easy Spray Pepmap RSLC C18 column)		 Thermo Fisher Scientific ES800 Mass spectrometry-based proteomics
C18 precolumn
(Acclaim Pepmap 100 C18 precolumn)		 Thermo Fisher Scientific 160321 Mass spectrometry-based proteomics
Name Company Catalog Number Comments
Primers for qRT-PCR assay Sequences
UBQ10 mRNA
(Li et al., 2014)		 Fw: AACTTTGGTGGTTTGTGTTTTGG
Rv: TCGACTTGTCATTAGAAAGAAAGAGATAA
18S rRNA
(Durut et al., 2014)		 Fw: CGTAGTTGAACCTTGGGATG
Rv: CACGACCCGGCCAATTA
DOWNLOAD MATERIALS LIST

References

  1. Jankowsky, E., Harris, M. E. Specificity and nonspecificity in RNA-protein interactions. Nat Rev Mol Cell Biol. 16 (9), 533-544 (2015).
  2. Glisovic, T., Bachorik, J. L., Yong, J., Dreyfuss, G. RNA-binding proteins and post-transcriptional gene regulation. FEBS Lett. 582 (14), 1977-1986 (2008).
  3. Gerstberger, S., Hafner, M., Tuschl, T. A census of human RNA-binding proteins. Nat Rev Genet. 15 (12), 829-845 (2014).
  4. Lin, Q., Taylor, S. J., Shalloway, D. Specificity and determinants of Sam68 RNA binding. Implications for the biological function of K homology domains. J Biol Chem. 272 (43), 27274-27280 (1997).
  5. Deo, R. C., Bonanno, J. B., Sonenberg, N., Burley, S. K. Recognition of polyadenylate RNA by the poly(A)-binding protein. Cell. 98 (6), 835-845 (1999).
  6. Kattapuram, T., Yang, S., Maki, J. L., Stone, J. R. Protein kinase CK1 alpha regulates mRNA binding by heterogeneous nuclear ribonucleoprotein c in response to physiologic levels of hydrogen peroxide. J Biol Chem. 280 (15), 15340-15347 (2005).
  7. Patel, G. P., Ma, S., Bag, J. The autoregulatory translational control element of poly(A)-binding protein mRNA forms a heteromeric ribonucleoprotein complex. Nucleic Acids Res. 33 (22), 7074-7089 (2005).
  8. Song, J. K., McGivern, J. V., Nichols, K. W., Markley, J. L., Sheets, M. D. Structural basis for RNA recognition by a type II poly(A)-binding protein. Proc Natl Acad Sci USA. 105 (40), 15317-15322 (2008).
  9. Lambert, N., Robertson, A., Jangi, M., McGeary, S., Sharp, P. A., Burge, C. B. RNA Bind-n-Seq: quantitative assessment of the sequence and structural binding specificity of RNA binding proteins. Mol Cell. 54 (5), 887-900 (2014).
  10. Cook, K. B., Kazan, H., Zuberi, K., Morris, Q., Hughes, T. R. RBPDB: a database of RNA-binding specificities. Nucleic Acids Res. 39, D301-D308 (2011).
  11. Konig, J., Zarnack, K., Luscombe, N. M., Ule, J. Protein-RNA interactions: new genomic technologies and perspectives. Nat Rev Genet. 13 (2), 77-83 (2012).
  12. Hockensmith, J. W., Kubasek, W. L., Vorachek, W. R., von Hippel, P. H. Laser cross-linking of nucleic acids to proteins. Methodology and first applications to the phage T4 DNA replication system. J Biol Chem. 261 (8), 3512-3518 (1986).
  13. Pashev, I. G., Dimitrov, S. I., Angelov, D. Crosslinking proteins to nucleic acids by ultraviolet laser irradiation. Trends Biochem Sci. 16 (9), 323-326 (1991).
  14. Castello, A., et al. System-wide identification of RNA-binding proteins by interactome capture. Nat Protoc. 8 (3), 491-500 (2013).
  15. Nagy, E., Rigby, W. F. Glyceraldehyde-3-phosphate dehydrogenase selectively binds AU-rich RNA in the NAD(+)-binding region (Rossmann fold). J Biol Chem. 270 (6), 2755-2763 (1995).
  16. Hentze, M. W., Preiss, T. The REM phase of gene regulation. Trends Biochem Sci. 35 (8), 423-426 (2010).
  17. Nicholls, C., Li, H., Liu, J. P. GAPDH: a common enzyme with uncommon functions. Clin Exp Pharmacol Physiol. 39 (8), 674-679 (2012).
  18. Baltz, A. G., et al. The mRNA-bound proteome and its global occupancy profile on protein-coding transcripts. Mol Cell. 46 (5), 674-690 (2012).
  19. Castello, A., et al. Insights into RNA Biology from an Atlas of Mammalian mRNA-Binding Proteins. Cell. 149 (6), 1393-1406 (2012).
  20. Kwon, S. C., et al. The RNA-binding protein repertoire of embryonic stem cells. Nat Struct Mol Biol. 20 (9), 1122-1130 (2013).
  21. Mitchell, S. F., Jain, S., She, M., Parker, R. Global analysis of yeast mRNPs. Nat Struct Mol Biol. 20 (1), 127-133 (2013).
  22. Beckmann, B. M., et al. The RNA-binding proteomes from yeast to man harbour conserved enigmRBPs. Nat Commun. 6 (10127), 1-9 (2015).
  23. Bailey-Serres, J., Sorenson, R., Juntawong, P. Getting the message across: cytoplasmic ribonucleoprotein complexes. Trends Plant Sci. 14 (8), 443-453 (2009).
  24. Quesada, V., Macknight, R., Dean, C., Simpson, G. G. Autoregulation of FCA pre-mRNA processing controls Arabidopsis flowering time. EMBO J. 22 (12), 3142-3152 (2003).
  25. Lim, M. H., et al. A new Arabidopsis gene, FLK, encodes an RNA binding protein with K homology motifs and regulates flowering time via FLOWERING LOCUS C. Plant Cell. 16 (3), 731-740 (2004).
  26. Hornyik, C., Terzi, L. C., Simpson, G. G. The spen family protein FPA controls alternative cleavage and polyadenylation of RNA. Dev Cell. 18 (2), 203-213 (2010).
  27. Stern, D. B., Goldschmidt-Clermont, M., Hanson, M. R. Chloroplast RNA metabolism. Annu Rev Plant Biol. 61, 125-155 (2010).
  28. Schmal, C., Reimann, P., Staiger, D. A circadian clock-regulated toggle switch explains AtGRP7 and AtGRP8 oscillations in Arabidopsis thaliana. PLoS Comput Biol. 9 (3), e1002986 (2013).
  29. Staiger, D. RNA-binding proteins and circadian rhythms in Arabidopsis thaliana. Philos Trans R Soc Lond B Biol Sci. 356 (1415), 1755-1759 (2001).
  30. Fischer, B., et al. NovoHMM: a hidden Markov model for de novo peptide sequencing. Anal Chem. 77 (22), 7265-7273 (2005).
  31. Kwak, K. J., Kim, Y. O., Kang, H. Characterization of transgenic Arabidopsis plants overexpressing GR-RBP4 under high salinity, dehydration, or cold stress. J Exp Bot. 56 (421), 3007-3016 (2005).
  32. Raab, S., Toth, Z., de Groot, C., Stamminger, T., Hoth, S. ABA-responsive RNA-binding proteins are involved in chloroplast and stromule function in Arabidopsis seedlings. Planta. 224 (4), 900-914 (2006).
  33. Liu, H. H., et al. Molecular cloning and characterization of a salinity stress-induced gene encoding DEAD-box helicase from the halophyte Apocynum venetum. J Exp Bot. 59 (3), 633-644 (2008).
  34. Wang, S. C., Liang, D., Shi, S. G., Ma, F. W., Shu, H. R., Wang, R. C. Isolation and Characterization of a Novel Drought Responsive Gene Encoding a Glycine-rich RNA-binding Protein in Malus prunifolia (Willd.) Borkh. Plant Mol Biol Report. 29 (1), 125-134 (2011).
  35. Lorkovic, Z. J., Barta, A. Genome analysis: RNA recognition motif (RRM) and K homology (KH) domain RNA-binding proteins from the flowering plant Arabidopsis thaliana. Nucleic Acids Res. 30 (3), 623-635 (2002).
  36. Ambrosone, A., Costa, A., Leone, A., Grillo, S. Beyond transcription: RNA-binding proteins as emerging regulators of plant response to environmental constraints. Plant Science. 182, 12-18 (2012).
  37. Frank, A., Pevzner, P. PepNovo: de novo peptide sequencing via probabilistic network modeling. Anal Chem. 77 (4), 964-973 (2005).
  38. Marondedze, C., Thomas, L., Serrano, N. L., Lilley, K. S., Gehring, C. The RNA-binding protein repertoire of Arabidopsis thaliana. Sci Rep. 6 (29766), 1-13 (2016).
  39. Reichel, M., et al. In Planta Determination of the mRNA-Binding Proteome of Arabidopsis Etiolated Seedlings. Plant Cell. 28 (10), 2435-2452 (2016).
  40. Yoo, S. D., Cho, Y. H., Sheen, J. Arabidopsis mesophyll protoplasts: a versatile cell system for transient gene expression analysis. Nat Protoc. 2 (7), 1565-1572 (2007).
  41. Niu, Y., Sheen, J. Transient expression assays for quantifying signaling output. Methods Mol Biol. 876, 195-206 (2012).
  42. Petersson, S. V., et al. An auxin gradient and maximum in the Arabidopsis root apex shown by high-resolution cell-specific analysis of IAA distribution and synthesis. Plant Cell. 21 (6), 1659-1668 (2009).
  43. Bargmann, B. O., Birnbaum, K. D. Fluorescence activated cell sorting of plant protoplasts. J Vis Exp. (36), (2010).
  44. Hong, S. Y., Seo, P. J., Cho, S. H., Park, C. M. Preparation of Leaf Mesophyll Protoplasts for Transient Gene Expression in Brachypodium distachyon. J Plant Biol. 55 (5), 390-397 (2012).
  45. Li, Y., Van den Ende, W., Rolland, F. Sucrose Induction of Anthocyanin Biosynthesis Is Mediated by DELLA. Mol Plant. 7 (3), 570-572 (2014).
  46. Durut, N., et al. A duplicated NUCLEOLIN gene with antagonistic activity is required for chromatin organization of silent 45S rDNA in Arabidopsis. Plant Cell. 26 (3), 1330-1344 (2014).
  47. Han, Y. H., Ma, B., Zhang, K. Z. SPIDER: Software for protein identification from sequence tags with De Novo sequencing error. J Bioinform Comput Biol. 3 (3), 697-716 (2005).
  48. Han, X., He, L., Xin, L., Shan, B., Ma, B. PeaksPTM: Mass spectrometry-based identification of peptides with unspecified modifications. J Proteome Res. 10 (7), 2930-2936 (2011).
  49. Zhang, J., et al. PEAKS DB: de novo sequencing assisted database search for sensitive and accurate peptide identification. Mol Cell Proteomics. 11 (4), 010587 (2012).
  50. Zhang, Z., et al. UV crosslinked mRNA-binding proteins captured from leaf mesophyll protoplasts. Plant Methods. 12 (42), 1-12 (2016).
  51. Zhang, Y., et al. Integrative genome-wide analysis reveals HLP1, a novel RNA-binding protein, regulates plant flowering by targeting alternative polyadenylation. CellRes. 25 (7), 864-876 (2015).
  52. Steen, H., Jensen, O. N. Analysis of protein-nucleic acid interactions by photochemical cross-linking and mass spectrometry. Mass Spec Rev. 21 (3), 163-182 (2002).
  53. Miller, C., et al. Dynamic transcriptome analysis measures rates of mRNA synthesis and decay in yeast. Mol Syst Biol. 7 (458), 1-13 (2011).
  54. Eng, J., McCormack, A. L., Yates, J. R. An approach to correlate tandem mass spectral data of peptides with amino acid sequences in a protein database. J Am Soc Mass Spectrom. 5 (11), 976-989 (1994).
  55. Perkins, D. N., Pappin, D. J. C., Creasy, D. M., Cottrell, J. S. Probability-based protein identification by searching sequence databases using mass spectrometry data. Electrophoresis. 20 (18), 3551-3567 (1999).

Tags

Keywords: MRNA InteractomeMRNA-bound ProteomePlant ProtoplastsPost-transcriptional Gene RegulationUV CrosslinkingArabidopsis ThalianaLeaf Mesophyll ProtoplastsMMG SolutionCentrifugation
check_url/56011?article_type=t

Play Video
PDF
DOI
DOWNLOAD MATERIALS LIST
Cite This Article
Zhang, Z., Boonen, K., Li, M., Geuten, K. mRNA Interactome Capture from Plant Protoplasts. J. Vis. Exp. (125), e56011, doi:10.3791/56011 (2017).
Download Citation
Reprints and Permissions

View Video

✖

To prove you're not a robot, please enter the text in the image below

CAPTCHA Image
Play CAPTCHA Audio
Refresh Image