Isolate Cell-Type-Specific RNAs from Snap-Frozen Heterogeneous Tissue Samples without Cell Sorting
Summary
This protocol aims to isolate cell-type-specific translating ribosomal mRNAs using the NuTRAP mouse model.
Abstract
Cellular heterogeneity poses challenges to understanding the function of complex tissues at a transcriptome level. Using cell-type-specific RNAs avoids potential pitfalls caused by the heterogeneity of tissues and unleashes the powerful transcriptome analysis. The protocol described here demonstrates how to use the Translating Ribosome Affinity Purification (TRAP) method to isolate ribosome-bound RNAs from a small amount of EGFP-expressing cells in a complex tissue without cell sorting. This protocol is suitable for isolating cell-type-specific RNAs using the recently available NuTRAP mouse model and could also be used to isolate RNAs from any EGFP-expressing cells.
Introduction
High-throughput approaches, including RNA sequencing (RNA-seq) and microarray, have made it possible to interrogate gene expression profiles at the genome-wide level. For complex tissues such as the heart, brain, and testis, the cell-type-specific data will provide more details comparing the use of RNAs from the whole tissue1,2,3. To overcome the impact of cellular heterogeneity, the Translating Ribosome Affinity Purification (TRAP) method has been developed since early 2010s4. TRAP is able to isolate ribosome-bound RNAs from specific cell types without tissue dissociation. This method has been used for translatome (mRNAs that are being recruited to the ribosome for translation) analysis in different organisms, including targeting an extremely rare population of muscle cells in Drosophila embryos5, studying different root cells in the model plant Arabidopsis thaliana6, and performing transcriptome analysis of endothelial cells in mammals7.
TRAP requires a genetic modification to tag the ribosome of a model organism. Evan Rosen and colleagues recently developed a mouse model called Nuclear tagging and Translating Ribosome Affinity Purification (NuTRAP) mouse8, which has been available through the Jackson Laboratory since 2017. By crossing with a Cre mouse line, researchers can use this NuTRAP mouse model to isolate ribosome-bound RNAs and cell nuclei from Cre-expressing cells without cell sorting. In Cre-expressing cells that also carry the NuTRAP allele, the EGFP/L10a tagged ribosome allows the isolation of translating mRNAs using affinity pulldown assays. At the same cell, the biotin ligase recognition peptide (BLRP)-tagged nuclear membrane, which is also mCherry positive, allows the nuclear isolation by using affinity- or fluorescence-based purification. The same research team also generated a similar mouse line in which the nuclear membrane is labeled only with mCherry without biotin8. These two genetically modified mouse lines give access to characterize paired epigenomic and transcriptomic profiles of specific types of cells in interest.
The hedgehog (Hh) signaling pathway plays a critical role in tissue development9. GLI1, a member of the GLI family, acts as a transcriptional activator and mediates the Hh signaling. Gli1+ cells can be found in many hormone-secreting organs, including the adrenal gland and the testis. To isolate cell-type-specific DNAs and RNAs from Gli1+ cells using the NuTRAP mouse model, Gli1-CreERT2 mice were crossed with the NuTRAP mice. Shh-CreERT2 mice were also crossed with the NuTRAP mice aim to isolate sonic hedgehog (Shh) expressing cells. The following protocol shows how to use Gli1-CreERT2;NuTRAP mice to isolate ribosome-bound RNAs from Gli1+ cells in adult mouse testes.
Protocol
Representative Results
Discussion
The usefulness of the whole-tissue transcriptome analysis could be dampened, especially when studying complex heterogeneous tissues. How to obtain cell-type-specific RNAs becomes an urgent need to unleash the powerful RNA-seq technique. The isolation of cell-type-specific RNAs usually relies on the collection of a specific type of cells using micromanipulation, fluorescent-activated cell sorting (FACS), or laser capture microdissection (LCM)18. Other modern high-throughput single-cell collection m…
Disclosures
The authors have nothing to disclose.
Acknowledgements
This work was partially supported by NIH R00HD082686. We thank the Endocrine Society Summer Research Fellowship to H.S.Z. We also thank Dr. Yuan Kang for breeding and maintaining the mouse colony.
Materials
| Actb | eurofins | qPCR primers | ATGGAGGGGAATACAGCCC / TTCTTTGCAGCTCCTTCGTT (forward primer/reverse primer) |
| Bioanalyzer | Agilent | 2100 Bioanalyzer Instrument | |
| cOmplete Mini EDTA-free Protease Inhibitor Cocktail | Millipore | 11836170001 | |
| cycloheximide | Millipore | 239764-100MG | |
| Cyp11a1 | eurofins | qPCR primers | CTGCCTCCAGACTTCTTTCG / TTCTTGAAGGGCAGCTTGTT (forward primer/reverse primer) |
| dNTP | Thermo Fisher Scientific | R0191 | |
| DTT, Dithiothreitol | Thermo Fisher Scientific | P2325 | |
| DynaMag-2 magnet | Thermo Fisher Scientific | 12321D | |
| Falcon tubes 15 mL | VWR | 89039-666 | |
| GFP antibody | Abcam | ab290 | |
| Glass grinder set | DWK Life Sciences | 357542 | |
| heparin | BEANTOWN CHEMICAL | 139975-250MG | |
| Hsd3b | eurofins | qPCR primers | GACAGGAGCAGGAGGGTTTGTG / CACTGGGCATCCAGAATGTCTC (forward primer/reverse primer) |
| KCl | Biosciences | R005 | |
| MgCl2 | Biosciences | R004 | |
| Microcentrifuge tubes 2 mL | Thermo Fisher Scientific | 02-707-354 | |
| Mouse Clariom S Assay microarrays | Thermo Fisher Scientific | Microarray service | |
| NP-40 | Millipore | 492018-50 Ml | |
| oligo (dT)20 | Invitrogen | 18418020 | |
| PicoPure RNA Isolation Kit | Thermo Fisher Scientific | KIT0204 | |
| Protein G Dynabead | Thermo Fisher Scientific | 10003D | |
| RNase-free water | growcells | NUPW-0500 | |
| RNaseOUT Recombinant Ribonuclease Inhibitor | Thermo Fisher Scientific | 10777019 | |
| Sox9 | eurofins | qPCR primers | TGAAGAACGGACAAGCGGAG / CTGAGATTGCCCAGAGTGCT (forward primer/reverse primer |
| Superscript IV reverse transcriptase | Invitrogen | 18090050 | |
| SYBR Green PCR Master Mix | Thermo Fisher Scientific | 4309155 | |
| Sycp3 | eurofins | qPCR primers | GAATGTGTTGCAGCAGTGGGA /GAACTGCTCGTGTATCTGTTTGA (forward primer/reverse primer) |
| Tris | Alfa Aesar | J62848 |
References
- Yang, K. C., et al. Deep RNA sequencing reveals dynamic regulation of myocardial noncoding RNAs in failing human heart and remodeling with mechanical circulatory support. Circulation. 129 (9), 1009-1021 (2014).
- Soumillon, M., et al. Cellular source and mechanisms of high transcriptome complexity in the mammalian testis. Cell Reports. 3 (6), 2179-2190 (2013).
- Lake, B. B., et al. Neuronal subtypes and diversity revealed by single-nucleus RNA sequencing of the human brain. Science. 352 (6293), 1586-1590 (2016).
- Heiman, M., Kulicke, R., Fenster, R. J., Greengard, P., Heintz, N. Cell type-specific mRNA purification by translating ribosome affinity purification (TRAP). Nature Protocols. 9 (6), 1282-1291 (2014).
- Bertin, B., Renaud, Y., Aradhya, R., Jagla, K., Junion, G. J. J. TRAP-rc, translating ribosome affinity purification from rare cell populations of Drosophila embryos. Journal of Visualized Experiments: JoVE. (103), e52985 (2015).
- Thellmann, M., Andersen, T. G., Vermeer, J. E. Translating ribosome affinity purification (trap) to investigate Arabidopsis thaliana root development at a cell type-specific scale. Journal of Visualized Experiments: JoVE. (159), e60919 (2020).
- Moran, P., et al. Translating ribosome affinity purification (TRAP) for RNA isolation from endothelial cells in vivo. Journal of Visualized Experiments: JoVE. (147), e59624 (2019).
- Roh, H. C., et al. Simultaneous transcriptional and epigenomic profiling from specific cell types within heterogeneous tissues in vivo. Cell Reports. 18 (4), 1048-1061 (2017).
- Varjosalo, M., Taipale, J. Hedgehog: functions and mechanisms. Genes & Development. 22 (18), 2454-2472 (2008).
- Mueller, O., Lightfoot, S., Schroeder, A. RNA integrity number (RIN)-standardization of RNA quality control. Agilent Technologies. , 1-8 (2004).
- Lyu, Q., et al. RNA-seq reveals sub-zones in mouse adrenal zona fasciculata and the sexually dimorphic responses to thyroid hormone. Endocrinology. 161 (9), (2020).
- King, P., Paul, A., Laufer, E. Shh signaling regulates adrenocortical development and identifies progenitors of steroidogenic lineages. Proceedings of the National Academy of Sciences of the United States of America. 106 (50), 21185-21190 (2009).
- Huang, C. C., Miyagawa, S., Matsumaru, D., Parker, K. L., Yao, H. H. Progenitor cell expansion and organ size of mouse adrenal is regulated by sonic hedgehog. Endocrinology. 151 (3), 1119-1128 (2010).
- Benton, L., Shan, L. -. X., Hardy, M. P. Differentiation of adult Leydig cells. The Journal of Steroid Biochemistry and Molecular Biology. 53 (1-6), 61-68 (1995).
- Monder, C., Hardy, M., Blanchard, R., Blanchard, D. Comparative aspects of 11β-hydroxysteroid dehydrogenase. Testicular 11β-hydroxysteroid dehydrogenase: development of a model for the mediation of Leydig cell function by corticosteroids. Steroids. 59 (2), 69-73 (1994).
- Bitgood, M. J., Shen, L., McMahon, A. P. Sertoli cell signaling by Desert hedgehog regulates the male germline. Current Biology. 6 (3), 298-304 (1996).
- Beverdam, A., et al. Sox9-dependent expression of Gstm6 in Sertoli cells during testis development in mice. Reproduction. 137 (3), 481 (2009).
- Gross, A., et al. Technologies for single-cell isolation. International Journal of Molecular Sciences. 16 (8), 16897-16919 (2015).
- Ziegenhain, C., et al. Comparative analysis of single-cell RNA sequencing methods. Molecular Cell. 65 (4), 631-643 (2017).
- Nguyen, Q. H., Pervolarakis, N., Nee, K., Kessenbrock, K. Experimental considerations for single-cell rna sequencing approaches. Frontiers in Cell and Development Biology. 6, 108 (2018).
- Chucair-Elliott, A. J., et al. Inducible cell-specific mouse models for paired epigenetic and transcriptomic studies of microglia and astroglia. Communications Biology. 3 (1), 693 (2020).
- Barsoum, I., Yao, H. H. Redundant and differential roles of transcription factors Gli1 and Gli2 in the development of mouse fetal Leydig cells. Biology of Reproduction. 84 (5), 894-899 (2011).
- Mori, H., Shimizu, D., Fukunishi, R., Christensen, A. K. Morphometric analysis of testicular Leydig cells in normal adult mice. The Anatomical Record. 204 (4), 333-339 (1982).
