לבודד רנ"א ספציפיים לסוג תא מדגימות רקמות הטרוגניות קפואות ללא מיון תאים
Summary
פרוטוקול זה נועד לבודד mRNA ריבוזומלי ספציפי לסוג התא באמצעות מודל העכבר NuTRAP.
Abstract
הטרוגניות תאית מציבה אתגרים להבנת תפקודן של רקמות מורכבות ברמת שעתוק. שימוש ב-RNA ספציפי לסוג התא מונע מלכודות פוטנציאליות הנגרמות על ידי ההטרוגניות של רקמות ומשחרר את ניתוח השעתוק העוצמתי. הפרוטוקול המתואר כאן מדגים כיצד להשתמש בשיטת טיהור זיקת ריבוזום (TRAP) לבודד רנ”א הקשורים לריבוזום מכמות קטנה של תאים המבטאים EGFP ברקמה מורכבת ללא מיון תאים. פרוטוקול זה מתאים לבידוד רנ”א ספציפיים לסוג התא באמצעות מודל עכבר NuTRAP הזמין לאחרונה, וניתן להשתמש בו גם לבידוד רנ”א מכל תא המבטא EGFP.
Introduction
גישות בעלות תפוקה גבוהה, כולל ריצוף RNA (RNA-seq) ומיקרו-מערך, אפשרו לחקור פרופילי ביטוי גנים ברמה הגנומית כולה. עבור רקמות מורכבות כמו הלב, המוח והאשכים, הנתונים הספציפיים לסוג התא יספקו פרטים נוספים המשווים את השימוש ב-RNA מכל הרקמה 1,2,3. כדי להתגבר על ההשפעה של הטרוגניות תאית, שיטת טיהור זיקת הריבוזום המתורגמת (TRAP) פותחה מאז תחילת שנות ה-20104. TRAP מסוגל לבודד רנ”א הקשורים לריבוזום מסוגי תאים ספציפיים ללא דיסוציאציה של רקמות. שיטה זו שימשה לניתוח טרנסלטום (mRNA המגויס לריבוזום לתרגום) באורגניזמים שונים, כולל התמקדות באוכלוסייה נדירה ביותר של תאי שריר בעוברי Drosophila5, חקר תאי שורש שונים בצמח המודל Arabidopsis thaliana6, וביצוע ניתוח תעתיק של תאי אנדותל ביונקים7.
TRAP דורש שינוי גנטי כדי לתייג את הריבוזום של אורגניזם מודל. אוון רוזן ועמיתיו פיתחו לאחרונה מודל עכבר בשם תיוג גרעיני ותרגום של עכברטיהור זיקה ריבוזום (NuTRAP) 8, הזמין דרך מעבדת ג’קסון מאז 2017. על ידי חצייה עם קו עכבר Cre, חוקרים יכולים להשתמש במודל עכבר NuTRAP זה כדי לבודד רנ”א הקשורים לריבוזום וגרעיני תאים מתאים המבטאים Cre ללא מיון תאים. בתאים המבטאים Cre הנושאים גם את אלל NuTRAP, הריבוזום המתויג EGFP/L10a מאפשר בידוד של תרגום mRNA באמצעות מבחני משיכה של זיקה. באותו תא, הממברנה הגרעינית המתויגת כפפטיד זיהוי ביוטין ליגאז (BLRP), שגם היא חיובית ל-mCherry, מאפשרת בידוד גרעיני באמצעות טיהור מבוסס זיקה או פלואורסצנציה. אותו צוות מחקר גם יצר קו עכברים דומה שבו קרום הגרעין מסומן רק עם mCherry ללא ביוטין8. שני קווי עכבר מהונדסים גנטית אלה נותנים גישה לאפיין פרופילים אפיגנומיים ותעתיקיים זוגיים של סוגים ספציפיים של תאים בעלי עניין.
מסלול האיתות של הקיפוד (Hh) ממלא תפקיד קריטי בהתפתחות רקמות9. GLI1, בן למשפחת GLI, פועל כמפעיל תעתוק ומתווך את איתות ה-HH. תאי Gli1+ יכולים להימצא באיברים רבים המפרישים הורמונים, כולל בלוטת יותרת הכליה והאשכים. כדי לבודד דנ”א ו-RNA ספציפיים לסוג התא מתאי Gli1+ באמצעות מודל העכבר NuTRAP, עכברי Gli1-CreERT2 הוצלבו עם עכברי NuTRAP. עכברי Shh-CreERT2 נחצו גם הם כאשר עכברי NuTRAP נועדו לבודד תאים המבטאים קיפוד קולי (Shh). הפרוטוקול הבא מראה כיצד להשתמש ב– Gli1-CreERT2; עכברי NuTRAP לבידוד רנ”א הקשורים לריבוזום מתאי Gli1+ באשכים של עכברים בוגרים.
Protocol
Representative Results
Discussion
התועלת של ניתוח תעתיק רקמה שלמה יכולה להיות מעומעמת, במיוחד כאשר חוקרים רקמות הטרוגניות מורכבות. כיצד להשיג רנ”א ספציפי לסוג התא הופך לצורך דחוף לשחרר את טכניקת ה-RNA-seq רבת העוצמה. הבידוד של רנ”א ספציפיים לסוג התא מסתמך בדרך כלל על איסוף של סוג מסוים של תאים באמצעות מיקרומניפולציה, מיון תאים …
Disclosures
The authors have nothing to disclose.
Acknowledgements
עבודה זו נתמכה חלקית על ידי NIH R00HD082686. אנו מודים למלגת מחקר הקיץ של החברה האנדוקרינית ל- H.S.Z. אנו מודים גם לד”ר יואן קאנג על הרבייה והשמירה על מושבת העכברים.
Materials
| Actb | eurofins | qPCR primers | ATGGAGGGGAATACAGCCC / TTCTTTGCAGCTCCTTCGTT (forward primer/reverse primer) |
| Bioanalyzer | Agilent | 2100 Bioanalyzer Instrument | |
| cOmplete Mini EDTA-free Protease Inhibitor Cocktail | Millipore | 11836170001 | |
| cycloheximide | Millipore | 239764-100MG | |
| Cyp11a1 | eurofins | qPCR primers | CTGCCTCCAGACTTCTTTCG / TTCTTGAAGGGCAGCTTGTT (forward primer/reverse primer) |
| dNTP | Thermo Fisher Scientific | R0191 | |
| DTT, Dithiothreitol | Thermo Fisher Scientific | P2325 | |
| DynaMag-2 magnet | Thermo Fisher Scientific | 12321D | |
| Falcon tubes 15 mL | VWR | 89039-666 | |
| GFP antibody | Abcam | ab290 | |
| Glass grinder set | DWK Life Sciences | 357542 | |
| heparin | BEANTOWN CHEMICAL | 139975-250MG | |
| Hsd3b | eurofins | qPCR primers | GACAGGAGCAGGAGGGTTTGTG / CACTGGGCATCCAGAATGTCTC (forward primer/reverse primer) |
| KCl | Biosciences | R005 | |
| MgCl2 | Biosciences | R004 | |
| Microcentrifuge tubes 2 mL | Thermo Fisher Scientific | 02-707-354 | |
| Mouse Clariom S Assay microarrays | Thermo Fisher Scientific | Microarray service | |
| NP-40 | Millipore | 492018-50 Ml | |
| oligo (dT)20 | Invitrogen | 18418020 | |
| PicoPure RNA Isolation Kit | Thermo Fisher Scientific | KIT0204 | |
| Protein G Dynabead | Thermo Fisher Scientific | 10003D | |
| RNase-free water | growcells | NUPW-0500 | |
| RNaseOUT Recombinant Ribonuclease Inhibitor | Thermo Fisher Scientific | 10777019 | |
| Sox9 | eurofins | qPCR primers | TGAAGAACGGACAAGCGGAG / CTGAGATTGCCCAGAGTGCT (forward primer/reverse primer |
| Superscript IV reverse transcriptase | Invitrogen | 18090050 | |
| SYBR Green PCR Master Mix | Thermo Fisher Scientific | 4309155 | |
| Sycp3 | eurofins | qPCR primers | GAATGTGTTGCAGCAGTGGGA /GAACTGCTCGTGTATCTGTTTGA (forward primer/reverse primer) |
| Tris | Alfa Aesar | J62848 |
References
- Yang, K. C., et al. Deep RNA sequencing reveals dynamic regulation of myocardial noncoding RNAs in failing human heart and remodeling with mechanical circulatory support. Circulation. 129 (9), 1009-1021 (2014).
- Soumillon, M., et al. Cellular source and mechanisms of high transcriptome complexity in the mammalian testis. Cell Reports. 3 (6), 2179-2190 (2013).
- Lake, B. B., et al. Neuronal subtypes and diversity revealed by single-nucleus RNA sequencing of the human brain. Science. 352 (6293), 1586-1590 (2016).
- Heiman, M., Kulicke, R., Fenster, R. J., Greengard, P., Heintz, N. Cell type-specific mRNA purification by translating ribosome affinity purification (TRAP). Nature Protocols. 9 (6), 1282-1291 (2014).
- Bertin, B., Renaud, Y., Aradhya, R., Jagla, K., Junion, G. J. J. TRAP-rc, translating ribosome affinity purification from rare cell populations of Drosophila embryos. Journal of Visualized Experiments: JoVE. (103), e52985 (2015).
- Thellmann, M., Andersen, T. G., Vermeer, J. E. Translating ribosome affinity purification (trap) to investigate Arabidopsis thaliana root development at a cell type-specific scale. Journal of Visualized Experiments: JoVE. (159), e60919 (2020).
- Moran, P., et al. Translating ribosome affinity purification (TRAP) for RNA isolation from endothelial cells in vivo. Journal of Visualized Experiments: JoVE. (147), e59624 (2019).
- Roh, H. C., et al. Simultaneous transcriptional and epigenomic profiling from specific cell types within heterogeneous tissues in vivo. Cell Reports. 18 (4), 1048-1061 (2017).
- Varjosalo, M., Taipale, J. Hedgehog: functions and mechanisms. Genes & Development. 22 (18), 2454-2472 (2008).
- Mueller, O., Lightfoot, S., Schroeder, A. RNA integrity number (RIN)-standardization of RNA quality control. Agilent Technologies. , 1-8 (2004).
- Lyu, Q., et al. RNA-seq reveals sub-zones in mouse adrenal zona fasciculata and the sexually dimorphic responses to thyroid hormone. Endocrinology. 161 (9), (2020).
- King, P., Paul, A., Laufer, E. Shh signaling regulates adrenocortical development and identifies progenitors of steroidogenic lineages. Proceedings of the National Academy of Sciences of the United States of America. 106 (50), 21185-21190 (2009).
- Huang, C. C., Miyagawa, S., Matsumaru, D., Parker, K. L., Yao, H. H. Progenitor cell expansion and organ size of mouse adrenal is regulated by sonic hedgehog. Endocrinology. 151 (3), 1119-1128 (2010).
- Benton, L., Shan, L. -. X., Hardy, M. P. Differentiation of adult Leydig cells. The Journal of Steroid Biochemistry and Molecular Biology. 53 (1-6), 61-68 (1995).
- Monder, C., Hardy, M., Blanchard, R., Blanchard, D. Comparative aspects of 11β-hydroxysteroid dehydrogenase. Testicular 11β-hydroxysteroid dehydrogenase: development of a model for the mediation of Leydig cell function by corticosteroids. Steroids. 59 (2), 69-73 (1994).
- Bitgood, M. J., Shen, L., McMahon, A. P. Sertoli cell signaling by Desert hedgehog regulates the male germline. Current Biology. 6 (3), 298-304 (1996).
- Beverdam, A., et al. Sox9-dependent expression of Gstm6 in Sertoli cells during testis development in mice. Reproduction. 137 (3), 481 (2009).
- Gross, A., et al. Technologies for single-cell isolation. International Journal of Molecular Sciences. 16 (8), 16897-16919 (2015).
- Ziegenhain, C., et al. Comparative analysis of single-cell RNA sequencing methods. Molecular Cell. 65 (4), 631-643 (2017).
- Nguyen, Q. H., Pervolarakis, N., Nee, K., Kessenbrock, K. Experimental considerations for single-cell rna sequencing approaches. Frontiers in Cell and Development Biology. 6, 108 (2018).
- Chucair-Elliott, A. J., et al. Inducible cell-specific mouse models for paired epigenetic and transcriptomic studies of microglia and astroglia. Communications Biology. 3 (1), 693 (2020).
- Barsoum, I., Yao, H. H. Redundant and differential roles of transcription factors Gli1 and Gli2 in the development of mouse fetal Leydig cells. Biology of Reproduction. 84 (5), 894-899 (2011).
- Mori, H., Shimizu, D., Fukunishi, R., Christensen, A. K. Morphometric analysis of testicular Leydig cells in normal adult mice. The Anatomical Record. 204 (4), 333-339 (1982).
