Summary

إنشاء عضويات بطانة الرحم 3D من رحم الفأر

Published: January 06, 2023
doi:

Summary

يصف هذا البروتوكول منهجيات إنشاء عضويات ظهارية بطانة الرحم للفأر للتعبير الجيني والتحليلات النسيجية.

Abstract

تبطن أنسجة بطانة الرحم التجويف الداخلي للرحم وتخضع للسيطرة الدورية للإستروجين والبروجستيرون. وهو نسيج يتكون من ظهارة لمعية وغدية ، ومقصورة انسجة ، وشبكة أوعية دموية ، ومجموعة معقدة من الخلايا المناعية. كانت نماذج الفئران أداة قوية لدراسة بطانة الرحم ، وكشفت عن الآليات الحاسمة التي تتحكم في الزرع والمشيمة والسرطان. يقدم التطور الأخير للثقافات العضوية البطانية 3D نموذجا حديثا لتشريح مسارات الإشارات التي تكمن وراء بيولوجيا بطانة الرحم. يعد إنشاء عضويات بطانة الرحم من نماذج الفئران المعدلة وراثيا ، وتحليل نسخها ، وتصور مورفولوجيتها بدقة خلية واحدة أدوات حاسمة لدراسة أمراض بطانة الرحم. تحدد هذه الورقة طرق إنشاء ثقافات 3D لظهارة بطانة الرحم من الفئران وتصف تقنيات لتحديد التعبير الجيني وتحليل أنسجة الكائنات العضوية. الهدف هو توفير مورد يمكن استخدامه لإنشاء وزراعة ودراسة التعبير الجيني والخصائص المورفولوجية للعضويات الظهارية البطانية.

Introduction

بطانة الرحم – النسيج المخاطي المبطن الداخلي لتجويف الرحم – هي نسيج فريد وديناميكي للغاية يلعب أدوارا حاسمة في الصحة الإنجابية للمرأة. خلال العمر الإنجابي ، يحمل بطانة الرحم القدرة على الخضوع لمئات الدورات من الانتشار والتمايز والانهيار ، بتنسيق من العمل المتضافر لهرمونات المبيض – الاستروجين والبروجستيرون. كشفت الدراسات التي أجريت على الفئران المعدلة وراثيا عن آليات بيولوجية أساسية تدعم استجابة بطانة الرحم للهرمونات والتحكم في زرع الجنين ، ونزع الخلايا اللحمية ، والحمل1. ومع ذلك ، كانت الدراسات في المختبر محدودة بسبب الصعوبات في الحفاظ على أنسجة بطانة الرحم الأولية غير المحولة للفأر في مزارع الخلايا ثنائية الأبعاد التقليدية2،3. تقدم التطورات الحديثة في ثقافة أنسجة بطانة الرحم كأنظمة أعضاء 3D ، أو عضويات ، فرصة جديدة للتحقيق في المسارات البيولوجية التي تتحكم في تجديد خلايا بطانة الرحم والتمايز. تم تطوير أنظمة عضوية بطانة الرحم للفأر والإنسان من ظهارة بطانة الرحم النقية المغلفة في مصفوفات مختلفة4،5 ، في حين تم استزراع بطانة الرحم البشرية كمزارع ظهارية / انسجة خالية من السقالات6،7 ، ومؤخرا كمجموعات ظهارية / انسجة مغلفة بالكولاجين8 . يتم دعم النمو والإمكانات التجديدية للثقافات العضوية الظهارية من خلال مزيج محدد من عوامل النمو ومثبطات الجزيئات الصغيرة التي تم تحديدها تجريبيا لزيادة نمو وتجديد المواد العضوية4،5،9. علاوة على ذلك ، فإن القدرة على تجميد وإذابة عضويات بطانة الرحم تسمح بتخزين عضويات بطانة الرحم على المدى الطويل من الفئران والبشر للدراسات المستقبلية.

كشفت الفئران المعدلة وراثيا عن مسارات الإشارات المعقدة التي تتحكم في الحمل المبكر وإزالة الترسبات ، وقد تم استخدامها كنماذج لفقدان الحمل وسرطان بطانة الرحم وبطانة الرحم. تم تحقيق هذه الدراسات الجينية إلى حد كبير مع حذف خاص بالخلية للأليلات الجانبية loxP (“floxed”) باستخدام cre recombinases التي تنشط بشكل خاص في الأنسجة التناسلية الأنثوية. تتضمن نماذج الفئران هذه مستقبلات البروجسترون10 المستخدمة على نطاق واسع ، والتي لها نشاط إعادة اتحاد قوي في الأنسجة الظهارية واللحمية البطانية ، اللاكتوفيرين i-cre ، الذي يحفز إعادة التركيب الظهاري البطاني الرحمي في الفئران البالغة11 ، أو Wnt7a-cre ، مما يؤدي إلى حذف خاص بالظهارة في الأنسجة المشتقة من مولريان12 . وفرت زراعة أنسجة بطانة الرحم من نماذج الفئران المعدلة وراثيا مثل الكائنات العضوية ثلاثية الأبعاد فرصة ممتازة للتحقيق في بيولوجيا بطانة الرحم وتسهيل تحديد عوامل النمو ومسارات الإشارات التي تتحكم في تجديد خلايا بطانة الرحم والتمايز13,14. يتم وصف طرق عزل وثقافة أنسجة بطانة الرحم للفأر في الأدبيات والإبلاغ عن استخدام استراتيجيات إنزيمية مختلفة لعزل ظهارة الرحم للزراعة اللاحقة للعضويات الظهارية البطانية4. بينما توفر الأدبيات السابقة إطارا نقديا لبروتوكولات الثقافة العضوية الظهارية البطانية4،5،6 ، توفر هذه الورقة طريقة واضحة وشاملة لتوليد هذه الكائنات العضوية وصيانتها ومعالجتها وتحليلها. توحيد هذه التقنيات مهم لتسريع التقدم في مجال البيولوجيا الإنجابية للمرأة. هنا ، نبلغ عن منهجية مفصلة للتنقية الأنزيمية والميكانيكية للأنسجة الظهارية البطانية للفأر للثقافة اللاحقة من عضويات بطانة الرحم في سقالة مصفوفة هلام. كما نصف منهجيات التحليلات النسيجية والجزيئية النهائية للعضويات الظهارية بطانة الرحم المغلفة بمصفوفة الهلام.

Protocol

تم إجراء التعامل مع الفئران والدراسات التجريبية بموجب البروتوكولات المعتمدة من قبل اللجنة المؤسسية لرعاية واستخدام الحيوانات (IACUC) التابعة لكلية بايلور للطب والمبادئ التوجيهية التي وضعها دليل المعاهد الوطنية للصحة لرعاية واستخدام المختبر. 1. عزل ظهارة الرحم من الفئران…

Representative Results

صور تباين المرحلة من عضويات بطانة الرحم الماوسأنشأنا عضويات من ظهارة بطانة الرحم للفأر WT ، كما هو موضح في البروتوكول المرفق (انظر الرسم البياني في الشكل 1). بعد التفكك الأنزيمي لظهارة بطانة الرحم للفأر ، تم فصل الصفائح الظهارية ميكانيكيا عن الخلايا اللحمية الرح?…

Discussion

هنا ، نصف طرق توليد عضويات ظهارية بطانة الرحم من بطانة الرحم للفأر والبروتوكولات المستخدمة بشكل روتيني لتحليلها في المراحل النهائية. تعتبر عضويات بطانة الرحم أداة قوية لدراسة الآليات التي تتحكم في الأمراض المرتبطة ببطانة الرحم ، مثل التهاب بطانة الرحم وسرطان بطانة الرحم وفشل الزرع. ذكرت…

Disclosures

The authors have nothing to disclose.

Acknowledgements

نشكر الدكتورة ستيفاني بانجاس والدكتور مارتن إم ماتزوك (M.M.M.) على القراءة النقدية وتحرير مخطوطتنا. تم دعم الدراسات من قبل منح معهد يونيس كينيدي شرايفر الوطني لصحة الطفل والتنمية البشرية R00-HD096057 (DM) و R01-HD105800 (DM) و R01-HD032067 (M.M.M.) و R01-HD110038 (M.M.M.) ، ومنحة دعم مركز السرطان NCI- P30 (NCI-CA125123). ديانا مونسيفيس ، دكتوراه حاصلة على جائزة الحمل من الجيل التالي من صندوق بوروز ويلكوم.

Materials

Organoid Media Formulation
Name Company Catalog Number Final concentration
Corning Matrigel Growth Factor Reduced (GFR) Basement Membrane Matrix, *LDEV-free Corning 354230 100%
Trypsin from Bovine Pancreas Sigma Aldrich T1426-1G 1%
Advanced DMEM/F12 Life Technologies 12634010 1X
N2 supplement Life Technologies 17502048 1X
B-27™ Supplement (50X), minus vitamin A Life Technologies 12587010 1X
Primocin Invivogen ant-pm-1 100 µg/mL
N-Acetyl-L-cysteine Sigma Aldrich A9165-5G 1.25 mM
L-glutamine Life Technologies 25030024 2 mM
Nicotinamide Sigma Aldrich N0636-100G 10 nM
ALK-4, -5, -7 inhibitor, A83-01 Tocris 2939 500 nM
Recombinant human EGF Peprotech AF-100-15 50 ng/mL
Recombinant human Noggin Peprotech 120-10C 100 ng/mL
Recombinant human Rspondin-1 Peprotech 120-38 500 ng/mL
Recombinant human FGF-10 Peprotech 100-26 100 ng/mL
Recombinant human HGF Peprotech 100-39 50 ng/mL
WNT3a R&D systems 5036-WN 200 ng/mL
Other supplies and reagents
Name Company Catalog Number Final concentration
Collagenase from Clostridium histolyticum Sigma Aldrich C0130-1G 5 mg/mL
Deoxyribonuclease I from bovine pancreas Sigma Aldrich DN25-100MG 2 mg/mL
DPBS, no calcium, no magnesium ThermoFisher 14190-250 1X
HBSS, no calcium, no magnesium ThermoFisher 14170112 1X
Falcon Polystyrene Microplates (24-Well) Fisher Scientific #08-772-51
Falcon Polystyrene Microplates (12-Well) Fisher Scientific #0877229
Falcon Cell Strainers, 40 µm Fisher Scientific #08-771-1
Direct-zol RNA MiniPrep (50 µg) Genesee Scientific 11-331
Trizol reagent Invitrogen 15596026
DMEM/F-12, HEPES, no phenol red ThermoFisher 11039021
Fetal Bovine Serum, Charcoal stripped Sigma Aldrich F6765-500ML 2%
Estratiol (E2) Sigma Aldrich E1024-1G 10 nM
Formaldehyde 16% in aqueous solution, EM Grade VWR 15710 4%
Epredia Cassette 1 Slotted Tissue Cassettes Fisher Scientific 1000961
Epredia Stainless-Steel Embedding Base Molds Fisher Scientific 64-010-15 
Ethanol, 200 proof (100%) Fisher Scientific 22-032-601 
Histoclear Fisher Scientific 50-899-90147
Permount Mounting Medium Fisher Scientific 50-277-97
Epredia Nylon Biopsy Bags Fisher Scientific 6774010
HistoGel Specimen Processing Gel VWR 83009-992
Hematoxylin solution Premium VWR 95057-844
Eosin Y (yellowish) solution Premium VWR 95057-848
TBS Buffer, 20X, pH 7.4 GenDEPORT T8054 1X
TBST (10X), pH 7.4 GenDEPORT T8056 1X
Citric acid  Sigma Aldrich C0759-1KG
Sodium citrate tribasic dihydrate Sigma Aldrich S4641-500G
Tween20 Fisher Scientific BP337-500 
Bovine Serum Albumin (BSA) Sigma Aldrich A2153-100G 3%
DAPI Solution (1 mg/mL) ThermoFisher 62248 1:1000 dilution
VECTASHIELD Antifade Mounting Medium Vector Labs H-1000-10
Clear Nail Polish Fisher Scientific NC1849418
Fisherbrand Superfrost Plus Microscope Slides Fisher Scientific 22037246
VWR Micro Cover Glasses VWR 48393-106
SuperScript VILO Master Mix ThermoFisher 11755050
SYBR Green PCR Master Mix ThermoFisher 4364346
Krt8 Antibody (TROMA-I)  DSHB TROMA-I  1:50 dilution
Vimentin Antobody Cell Signaling 5741S 1:200 dilution
Donkey anti-Rat IgG (H+L) Highly Cross-Adsorbed Secondary
Antibody, Alexa Fluor 594
ThermoFisher A-21209 1:250 dilution
Donkey anti-Rabbin IgG (H+L) Highly Cross-Adsorbed Secondary
Antibody, Alexa Fluor 488
ThermoFisher A-21206 1:250 dilution
ZEISS Stemi 508 Stereo Microscope ZEISS
ZEISS Axio Vert.A1 Inverted Routine Microscope with digital camera ZEISS
Primer Sequence Forward (5'-3') Reverse (5'-3') _
Lipocalin 2 (Lcn2) GCAGGTGGTACGTTGTGGG CTCTTGTAGCTCATAGATGGTGC
Lactoferrin (Ltf) TGAGGCCCTTGGACTCTGT ACCCACTTTTCTCATCTCGTTC
Progesterone (Pgr) CCCACAGGAGTTTGTCAAGCTC TAACTTCAGACATCATTTCCGG
Glyceraldehyde 3 phosphate dehydrogenase (Gapdh) CAATGTGTCCGTCGTGGATCT GCCTGCTTCACCACCTTCTT

References

  1. Wang, H., Dey, S. K. Roadmap to embryo implantation: clues from mouse models. Nature Reviews Genetics. 7 (3), 185-199 (2006).
  2. Hibaoui, Y., Feki, A. Organoid models of human endometrial development and disease. Frontiers in Cell and Developmental Biology. 8, 84 (2020).
  3. Rawlings, T. M., Makwana, K., Tryfonos, M., Lucas, E. S. Organoids to model the endometrium: implantation and beyond. Reproduction & Fertility. 2 (3), 85-101 (2021).
  4. Boretto, M., et al. Development of organoids from mouse and human endometrium showing endometrial epithelium physiology and long-term expandability. Development. 144 (10), 1775-1786 (2017).
  5. Turco, M. Y., et al. Long-term, hormone-responsive organoid cultures of human endometrium in a chemically defined medium. Nature Cell Biology. 19 (5), 568-577 (2017).
  6. Murphy, A. R., Wiwatpanit, T., Lu, Z., Davaadelger, B., Kim, J. J. Generation of multicellular human primary endometrial organoids. Journal of Visualized Experiments. (152), e60384 (2019).
  7. Wiwatpanit, T., et al. Scaffold-free endometrial organoids respond to excess androgens associated with polycystic ovarian syndrome. The Journal of Clinical Endocrinology and Metabolism. 105 (3), 769-780 (2020).
  8. Rawlings, T. M., et al. Modelling the impact of decidual senescence on embryo implantation in human endometrial assembloids. Elife. 10, 69603 (2021).
  9. Lou, L., Kong, S., Sun, Y., Zhang, Z., Wang, H. Human endometrial organoids: recent research progress and potential applications. Frontiers in Cell and Developmental Biology. 10, 844623 (2022).
  10. Soyal, S. M., et al. Cre-mediated recombination in cell lineages that express the progesterone receptor. Genesis. 41 (2), 58-66 (2005).
  11. Daikoku, T., et al. Lactoferrin-iCre: a new mouse line to study uterine epithelial gene function. Endocrinology. 155 (7), 2718-2724 (2014).
  12. Winuthayanon, W., Hewitt, S. C., Orvis, G. D., Behringer, R. R., Korach, K. S. Uterine epithelial estrogen receptor alpha is dispensable for proliferation but essential for complete biological and biochemical responses. Proceedings of the National Academy of Sciences. 107 (45), 19272-19277 (2010).
  13. Seishima, R., et al. Neonatal Wnt-dependent Lgr5 positive stem cells are essential for uterine gland development. Nature Communications. 10 (1), 5378 (2019).
  14. Syed, S. M., et al. Endometrial Axin2(+) cells drive epithelial homeostasis, regeneration, and cancer following oncogenic transformation. Cell Stem Cell. 26 (1), 64-80 (2020).
  15. Caligioni, C. S. Assessing reproductive status/stages in mice. Current Protocols in Neuroscience. , (2009).
  16. Fitzgerald, H. C., Schust, D. J., Spencer, T. E. In vitro models of the human endometrium: evolution and application for women’s health. Biology of Reproduction. 104 (2), 282-293 (2021).
  17. Hewitt, S. C., et al. Progesterone signaling in endometrial epithelial organoids. Cells. 11 (11), 1760 (2022).
  18. Sadeghipour, A., Babaheidarian, P. Making formalin-fixed, paraffin embedded blocks. Methods in Molecular Biology. 1897, 253-268 (2019).
  19. Qin, C., et al. The cutting and floating method for paraffin-embedded tissue for sectioning. Journal of Visualized Experiments. (139), e58288 (2018).
  20. Rekhtman, N., et al. Novel modification of HistoGel-based cell block preparation method: improved sufficiency for molecular studies. Archives of Pathology & Laboratory Medicine. 142 (4), 529-535 (2018).
  21. Shidham, V. B. CellBlockistry: Chemistry and art of cell-block making – A detailed review of various historical options with recent advances. Cytojournal. 16, 12 (2019).
  22. Ali, A., Syed, S. M., Tanwar, P. S. Protocol for in vitro establishment and long-term culture of mouse vaginal organoids. STAR Protocols. 1 (2), 100088 (2020).
  23. Kurihara, I., et al. COUP-TFII mediates progesterone regulation of uterine implantation by controlling ER activity. PLoS Genet. 3 (6), 102 (2007).
  24. McMaster, M. T., Teng, C. T., Dey, S. K., Andrews, G. K. Lactoferrin in the mouse uterus: analyses of the preimplantation period and regulation by ovarian steroids. Molecular Endocrinology. 6 (1), 101-111 (1992).
  25. Huang, H. L., Chu, S. T., Chen, Y. H. Ovarian steroids regulate 24p3 expression in mouse uterus during the natural estrous cycle and the preimplantation period. The Journal of Endocrinology. 162 (1), 11-19 (1999).
  26. Clevers, H. Modeling development and disease with organoids. Cell. 165 (7), 1586-1597 (2016).
  27. Bigsby, R. M., Cunha, G. R. Estrogen stimulation of deoxyribonucleic acid synthesis in uterine epithelial cells which lack estrogen receptors. Endocrinology. 119 (1), 390-396 (1986).
  28. Clementi, C., et al. Activin-like kinase 2 functions in peri-implantation uterine signaling in mice and humans. PLoS Genetics. 9 (11), 1003863 (2013).
  29. Jeong, J. W., et al. Foxa2 is essential for mouse endometrial gland development and fertility. Biology of Reproduction. 83 (3), 396-403 (2010).
  30. Song, Y., et al. Endometriotic organoids: a novel in vitro model of endometriotic lesion development. bioRxiv. , (2022).
  31. Miyazaki, K., et al. Generation of progesterone-responsive endometrial stromal fibroblasts from human induced pluripotent stem cells: role of the WNT/CTNNB1 pathway. Stem Cell Reports. 11 (5), 1136-1155 (2018).
  32. Yoshimatsu, S., Kisu, I., Qian, E., Noce, T. A new horizon in reproductive research with pluripotent stem cells: successful in vitro gametogenesis in rodents, its application to large animals, and future in vitro reconstitution of reproductive organs such as "Uteroid" and "Oviductoid&#34. Biology. 11 (7), 987 (2022).
  33. Cheung, V. C., et al. Pluripotent stem cell-derived endometrial stromal fibroblasts in a cyclic, hormone-responsive, coculture model of human decidua. Cell Reports. 35 (7), 109138 (2021).
  34. McGowen, M. R., Erez, O., Romero, R., Wildman, D. E. The evolution of embryo implantation. The International Journal of Development Biology. 58 (2-4), 155-161 (2014).
  35. Carson, D. D., et al. Embryo implantation. Developmental Biology. 223 (2), 217-237 (2000).
  36. Li, Y., Sun, X., Dey, S. K. Entosis allows timely elimination of the luminal epithelial barrier for embryo implantation. Cell Reports. 11 (3), 358-365 (2015).
  37. Jain, V., Chodankar, R. R., Maybin, J. A., Critchley, H. O. D. Uterine bleeding: how understanding endometrial physiology underpins menstrual health. Nature Reviews Endocrinology. 18 (5), 290-308 (2022).
  38. Hayashi, K., et al. Wnt genes in the mouse uterus: potential regulation of implantation. Biology of Reproduction. 80 (5), 989-1000 (2009).
  39. Dunlap, K. A., et al. Postnatal deletion of Wnt7a inhibits uterine gland morphogenesis and compromises adult fertility in mice. Biology of Reproduction. 85 (2), 386-396 (2011).
  40. Ter Steege, E. J., Bakker, E. R. M. The role of R-spondin proteins in cancer biology. Oncogene. 40 (47), 6469-6478 (2021).
  41. Brazil, D. P., Church, R. H., Surae, S., Godson, C., Martin, F. BMP signalling: agony and antagony in the family. Trends in Cell Biology. 25 (5), 249-264 (2015).
  42. Tojo, M., et al. The ALK-5 inhibitor A-83-01 inhibits Smad signaling and epithelial-to-mesenchymal transition by transforming growth factor-beta. Cancer Science. 96 (11), 791-800 (2005).
  43. Zhang, Y., Que, J. BMP signaling in development, stem cells, and diseases of the gastrointestinal tract. Annual Review of Physiology. 82, 251-273 (2020).
  44. Plikus, M. V., et al. Cyclic dermal BMP signalling regulates stem cell activation during hair regeneration. Nature. 451 (7176), 340-344 (2008).
  45. Gurung, S., Werkmeister, J. A., Gargett, C. E. Inhibition of transforming growth factor-β receptor signaling promotes culture expansion of undifferentiated human endometrial mesenchymal stem/stromal cells. Scientific Reports. 5, 15042 (2015).
  46. Lucciola, R., et al. Impact of sustained transforming growth factor-β receptor inhibition on chromatin accessibility and gene expression in cultured human endometrial MSC. Frontiers in Cell and Developmental Biology. 8, 567610 (2020).
  47. Hernandez-Gordillo, V., et al. Fully synthetic matrices for in vitro culture of primary human intestinal enteroids and endometrial organoids. Biomaterials. 254, 120125 (2020).
  48. Gnecco, J. S., et al. Physiomimetic Models of Adenomyosis. Seminars in Reproductive Medicine. 38 (2-03), 179-196 (2020).
  49. Nikolakopoulou, K., Turco, M. Y. Investigation of infertility using endometrial organoids. Reproduction. 161 (5), 113-127 (2021).
  50. Kim, J. J. Preparing for implantation. Elife. 10, 73739 (2021).

Play Video

Cite This Article
Tang, S., Parks, S. E., Liao, Z., Cope, D. I., Blutt, S. E., Monsivais, D. Establishing 3D Endometrial Organoids from the Mouse Uterus. J. Vis. Exp. (191), e64448, doi:10.3791/64448 (2023).

View Video