라벨없는 DNA의 혼성화 분석 용 미세 유체 기반 전기 바이오칩
Summary
우리는 DNA 혼성화 검출을위한 미세 유체 기반 전기 바이오칩을 제시한다. ssDNA를 프로브 작용에 따라, 특이도, 민감도 및 검출 한계 보완 및 비 보완 ssDNA를 목표로 공부하고 있습니다. 결과는 3.8 nm의 검출 한계와 함께, 전기 화학적 시스템의 DNA 혼성화 이벤트의 영향을 예시한다.
Abstract
마이크로 규모로 분석 벤치 탑 절차의 소형화는, 반응 시간, 비용, 및 사전 처리 단계의 통합에 관해서 상당한 이점을 제공한다. 그것은 치료 시점에서 각종 질병에 대한 바이오 마커의 실시간 평가를위한 기술을 제공하기 때문에 DNA 혼성화 사건의 분석으로 이들 장치를 이용하는 것이 중요하다. 그러나, 디바이스 풋 프린트는 다양한 물리적 현상 증가의 지배력을 감소시킨다. 이러한 현상은 가공 정밀도 및 장치의 작동 안정성에 영향을 미친다. 따라서, 정확하게 전반적인 성능을 개선하기 위해 재생 가능한 방식으로 이러한 장치를 제작하고 운영하는 중대한 필요성이 존재한다. 여기서, 우리는 프로토콜과 제조 및 DNA 혼성화 사건의 정확한 분석 용 미세 유체 기반 전기 화학적 바이오 칩의 동작에 사용되는 방법을 설명한다. 바이오 칩은 두 부분으로 구성되어있다 : 미세 유체 칩세 폴리 디메틸 실록산 (PDMS)로 이루어지는 병렬 마이크로 채널, 3 × 3 배열 된 전기 마이크로 칩. DNA 혼성화 이벤트는 전기 화학 임피던스 분광법 (EIS) 분석을 이용하여 검출된다. EIS 분석이 길이 규모에서 지배적 인 전기 시스템의 특성의 모니터링 변화를 가능하게한다. 바이오 센서와 양 전하 전송 및 diffusional 저항의 변화를 모니터링 할 수있는 능력으로, 우리는 20 분 다음 상보 ssDNA를 대상으로 선택성, 3.8 ㎚의 계산 된 검출 한계, 및 다른 비 – 상보 ssDNA를 가진 13 % 교차 반응성을 보여 배양. 이 방법론은 마이크로 스케일 레짐에서 확산 동작에 의해 해명 및 DNA 혼성화 사건의 조사를 가능하게하여 소형화 된 장치의 성능을 향상시킬 수있다.
Introduction
미세 유체 랩 온어 칩 (LOC) 장치는 임상 진단, 환경 모니터링과 생물 의학 연구에 많은 장점을 제공한다. 이러한 장치는 다양한 절차 1-4 배양 시약 혼합, 결합 친화도 기반, 신호 전달, 세포를 포함하여 이루어질 수있는 칩의 영역에 유체 유동을 제어하기 위해 마이크로 유체 채널을 이용한다. 마이크로 유체는 마이크로 웰 플레이트 판독기 또는 전기 영동 겔 쉬프트 분석 같은 종래의 임상 진단 도구에 비해 많은 장점을 제공한다. 유사한 분석을 수행하기 위해 더 적은 시약 (㎕의 반대로 나노 리터) 미세 유동 장치는 크기가 2 ~ 3 명령을 필요로한다. 또한, 이러한 장치는 어떤 이벤트가 생물학적 5,6 채널 내의 종의 작은 한정으로 인해 발생할 수있는 속도를 증가시킬 수있다. 셋째, 센서는 라벨없는 detectio를 제공 할 수 리소그래피 및 에칭 기술을 이용하여 미세 유동 장치 내에 통합 될 수있다명. 마지막으로, 이러한 장치는 생산 및 7-10를 작동 할 수있는 기술자의 입장에서 약간의 작업을 필요로 저렴하다.
라벨없는 검출은 일반적으로 광학 또는 전기 변환기를 사용하여 수행됩니다. 광학 장치에 의한 샘플 분석 물과 저급 간섭 나은 감지 성능을 제공 할 수있다. 그럼에도 불구하고, 그 성능은 샘플의 배경 센서 (11)와 동일한 공진 파장을 갖는 경우에 노출된다. 마이크로 유체 시스템에서 생물학적 및 화학적 검출을 수행하는 전기적인 신호를 이용하여 여러 가지 장점이있다. 이러한 센서는 일반적으로 만 작동 전극 패턴을 필요로하기 때문에 제조는 본질적으로 덜 복잡하다. 다른 양상 신호가 신호 12-15 변환 변환기를 동시에 요구할 수있다 또한, 전기 신호는 대부분 직접 측정 장비와 인터페이스 될 수있다. 전기 센서는 일반적으로 impedanc 변화를 측정전자 (16, 17), 용량 (18), 또는 산화 환원 활동 19. 이러한 시스템의 소형화 아르 그러나 새로운 도전이되게됩니다. 극복하는 가장 중요한 과제는 포함한다 : 샘플 준비 및 (인해 낮은 샘플 볼륨과 레이놀즈 수에) 유체의 혼합, 물리적 및 화학적 효과 (모세관 력을 포함하여, 표면 거칠기, 건축 자재 및 분석 간의 화학적 상호 작용), 낮은 신호 대를 복잡한 생물학적 시료 (예, 혈액 및 타액)에서 전기 활성 분석에서 20-23, 및 잠재적 인 간섭 (감소 된 표면적과 체적에 의해 제조) 잡음비. 이러한 효과의 추가 조사는 전반적인 성능을 개선 할 재현 방식으로이 장치의 정확한 제조 및 운영 가이드 라인에서 발생합니다.
DNA 혼성화 검출 유전 질환과 24,25 canc 다양한 형태를 진단하기 위해 광범위하게 사용된다어 26. 매년 독감의 여러 균주 DNA 하이브리드 기술 (27)의 결과를 사용하는 환자에서 식별됩니다. 인플루엔자 바이러스는 미국에서만 28에서 36,000 사망자 매년를 차지한다. 이러한 예는 민감도 나 특이도를 희생하지 않고 낮은 샘플 볼륨 플레이트 리더 또는 젤 시프트 분석으로하고 적은 비용으로 동일한 분석 기법을 수행 할 수있는 벤치 탑 미세 유체 장치에서 혜택을 누릴 수 있습니다. 인해 라벨없는 전기 화학 센싱 많은 장점으로이를 DNA 혼성화 29,30 이벤트의 검출을 위해 광범위하게 사용되고있다. (mm 범위에서) 매크로 스케일 전극 관심 커 용액에 침지되어 설치 그들의 상보 서열과 일치하는 단일 가닥 DNA 서열의 결합 동력학에 대하여 매우 중요한 데이터를 제공하는데 사용될 수있다. 최근 MICR에서 전기 화학적 감지 기능을 통합의 몇 가지 발전이 있었다DNA 혼성화 용 ofluidics. 연구는 혼성화 반응 속도 (31)과 미세 유체 채널에서 검출 (15)에 대한 센서의 통합에 대해 수행되었다. 그러나, 여전히 복잡한 샘플 준비 단계없이 병렬 DNA 혼성화 이벤트를 분석 할 수있는 빠른 처리량 미세 유체 소자에 대한 요구가 존재한다.
본 연구에 제시된 장치는 다수의 상호 작용이 평행 복잡한 샘플 준비 단계없이 상영 할 수있는 플랫폼을 제공한다. 우리 프로토콜은 전기 화학적 바이오 칩은 미세 전자 기계 시스템 (MEMS) 기술 (32, 33)와 마이크로 제조되는 방법 마이크로 유체 기반 나타낸다. 우리는 전극 어레이로 구성 (PDMS), 폴리 디메틸 실록산으로 만들어진 마이크로 유체 칩, 및 전기 화학 칩 모두의 제조 공정을 설명한다. ssDNA의 프로브와 바이오 칩의 화학 작용도 해결됩니다. 마지막으로, ABIL구체적 ssDNA를 타겟을 검출하고 분석하는 바이오 센서의 성만이 설명된다. 전반적으로, 마이크로 유체 기반 전기 화학적 바이오 칩은 신속하고 높은 처리량 분석 기술이다. 이는 생물학적 분자와 전도성 센서 사이의 상호 작용을 조사하기 위해 사용될 수 있고, 랩 온어 칩 다양한 애플리케이션에 이용 될 수있다.
Protocol
Representative Results
Discussion
우리의 절차는 마이크로 유체 기반의 전기 화학적 바이오 칩의 제조 및 DNA 혼성화 이벤트 분석에 대한 활용도를 보여줍니다. 고 수율 제어 미세 공정을 통해 우리는 전기 화학 센서의 배열과 통합 마이크로 채널로 구성된 장치를 개발한다. 우리는 반복적 인 접근을 통해 전기 화학 칩 및 마이크로 유체 몰드의 포토 리소그래피 절차를위한 제어 처리 파라미터를 고안 하였다. 이 단계는 다른 소형?…
Declarações
The authors have nothing to disclose.
Acknowledgements
저자는 금융 지원을위한 로버트 W. 독일어 재단, 국방 위협 감소 기관 (DTRA), 연구의 국립 과학 재단 (National Science Foundation) 신흥 프론티어와 혁신 (EFRI)을 인정합니다. 저자는 또한 클린 룸 시설 지원을 위해 메릴랜드 Nanocenter과 Fablab 감사합니다.
Materials
| Name of Material/ Equipment | Company | Catalog Number | Comments/Description |
| Material | |||
| 4'' Silicon wafer | Ultrasil | 4-5664 | Single side polished; P-type; Boron doped; Orientation 1-0-0; Thickness 500 micron; Resistance 10-20 ohm*cm |
| Shipley 1813 photoresist ("PR1") | Microchem | positive photoresist | |
| AZ5214 photoresist ("PR2") | Hoechst Celanse | positive photoresist | |
| SU-8 50 photoresist ("PR3") | Microchem | negative photoresist | |
| Gold etchant | Transene | TFA | No dilution |
| Chromium etchant | Transene | 1020AC | No dilution |
| PDMS elastomer | Dow Corning | 3097366 1004 | |
| PDMS curing agent | Dow Corning | 3097358 1004 | |
| Biopsy punching tool | Healthlink | BP20 | |
| Tygon flexible tubing | Cole Parmer | R 3603 | .015" |
| Tygon flexible adapter | Cole Parmer | 06417-41 | .0625" |
| 1 mL syringe | Beckton-Dickenson | 301025 | |
| Monobasic potassium phosphate | Fluka | 1551139 | |
| Potassium phosphate dibasic anhydrous | Sigma | RES20765-A7 | |
| Sodium chloride | Sigma-Aldrich | S7653 | |
| tris(2-carboxyethyl)phosphine | Aldrich | C4706 | |
| 6-mercapto-1-hexanol | Aldrich | 451088 | |
| 20x concentrated saline-sodium citrate buffer | Sigma | 93017 | |
| Potassium hexacyanoferrate(III) | Aldrich | 455946 | |
| Sodium ferrocyanide | Aldrich | CDS001589 | |
| Target ssDNA #1 | Integrated DNA Technologies (IDT) | 100 nmole DNA oligo | 5’-/5ThioMC6-D/AAAGCTCCGATAGCGCTCCG TGGACGTCCC-3’ |
| Complementary ssDNA #1 | Integrated DNA Technologies (IDT) | 100 nmole DNA oligo | 5’-GGGACGTCCACGGAGCGCTA TCGGAGCTTT-3’ |
| Target ssDNA #2 | Integrated DNA Technologies (IDT) | 100 nmole DNA oligo | 5’-/5ThioMC6-D/ACGCGTCAGGTCATTGACGA ATCGATGAGT-3’ |
| Complementary ssDNA #2 | Integrated DNA Technologies (IDT) | 100 nmole DNA oligo | 5’-ACTCATCGATTCGTCAATGA CCTGACCCGT-3’ |
| Target ssDNA #3 | Integrated DNA Technologies (IDT) | 100 nmole DNA oligo | 5’-/5ThioMC6-D/ACCTAGATCCAGTAGTTAGA CCCATGATGA-3’ |
| Complementary ssDNA #3 | Integrated DNA Technologies (IDT) | 100 nmole DNA oligo | 5’-TCATCATGGGTCTAACTACT GGATCTAGGT-3’ |
| Instrument | |||
| Plasma Enhanced Chemical Vapor Deposition (PECVD) | Oxford Instruments | PlasmaLab System 100 | Chamber pressure 1000 mTorr, Tempreture 200 celsius degrees, RF power 20 W, Gasses: a) N2O flow rate 710 sccm; b) a composition of 5% SiH4 and 95% N2 gasses flow rate 170 sccm, SiO2 growth rate 690 Angstrom/minute. |
| DC sputtering unit | AJA International | ATC 1800-V | For Chrome: Chamber pressure 10 mTorr, Argon flow rate 20 sccm, Supplied DC power 200 W, Sputter rate 10 nm/min. For Gold: Chamber pressure 10 mTorr, Argon flow rate 20 sccm, Supplied DC power 200 W, Sputter rate 36 nm/min. |
| E-beam evaporation system | Denton | Custom-built | For Titanium: Chamber pressure <2E-6 Torr, Supplied power to the e-gun 7.5k W, Filament current 150-200 mA, Evaporation rate 6-10 Angstrom/second. For Platinum: Chamber pressure <2E-6 Torr, Supplied power to the e-gun 7.5k W, Filament current 150-200 mA, Evaporation rate 2-3 Angstrom/second. |
| Potentiostat | CH Instruments | 660D | |
| Syringe pump | KD Scientific | KDS230 |
Referências
- Hong, J., Edel, J. B., deMello, A. J. Micro- and nanofluidic systems for high-throughput biological screening. Drug Discov. Today. 14, 134-146 (2009).
- Sun, Y., Kwok, Y. C. Polymeric microfluidic system for DNA analysis. Anal. Chim. Acta. 556, 80-96 (2006).
- Xu, Y., Yang, X., Wang, E. Review: aptamers in microfluidic chips. Anal. Chim. Acta. 683, 12-20 (2010).
- Yang, W., Woolley, A. T. Integrated multiprocess microfluidic systems for automating analysis. J. Lab. Automat. 15, 198-209 (2010).
- Gervais, T., Jensen, K. F. Mass transport and surface reactions in microfluidic systems. Chem. Eng. Sci. 61, 1102-1121 (2006).
- Song, H., Ismagilov, R. F. Millisecond kinetics on a microfluidic chip using nanoliters of reagents. J. Am. Chem. Soc. 125, 14613-14619 (2003).
- Jiang, H., Weng, X. A., Li, D. Q. Microfluidic whole-blood immunoassays. Microfluid. Nanofluid. 10, 941-964 (2011).
- Dutse, S. W., Yusof, N. A. Microfluidics-based lab-on-chip systems in DNA-based biosensing: an overview. Sensors. 11, 5754-5768 (2011).
- Dittrich, P. S., Manz, A. Lab-on-a-chip: microfluidics in drug discovery. Nat. Rev. Drug Discov. 5, 210-218 (2006).
- Craighead, H. Future lab-on-a-chip technologies for interrogating individual molecules. Nature. 442, 387-393 (2006).
- Hunt, H. K., Armani, A. M. Label-free biological and chemical sensors. Nanoscale. 2, 1544-1559 (2010).
- Dukkipati, V. R., Pang, S. W. Integrated microfluidic system for DNA analysis. IEEE-NANO 2006. Sixth IEEE Conference on Nanotechnology. 1, 162-165 (2006).
- Fang, T. H., et al. Real-time PCR microfluidic devices with concurrent electrochemical detection. Biosens. Bioelectron. 24, 2131-2136 (2009).
- Pavlovic, E., et al. Microfluidic device architecture for electrochemical patterning and detection of multiple DNA sequences. Langmuir. 24, 1102-1107 (2008).
- Xu, X., Zhang, S., Chen, H., Kong, J. Integration of electrochemistry in micro-total analysis systems for biochemical assays: recent developments. Talanta. 80, 8-18 (2009).
- Cai, H., Lee, T. M. -. H., Hsing, I. M. Label-free protein recognition using an aptamer-based impedance measurement assay. Sensor. Actuat. B-Chem. 114, 433-437 (2006).
- Iliescu, C., Poenar, D. P., Carp, M., Loe, F. C. A Microfluidic device for impedance spectroscopy analysis of biological samples. Sensor. Actuat. B-Chem. 123, 168-176 (2007).
- Prakash, S. B., Abshire, P. Tracking cancer cell proliferation on a CMOS capacitance sensor chip. Biosens. Bioelectron. 23, 1449-1457 (2008).
- Yamaguchi, A., et al. Rapid fabrication of electrochemical enzyme sensor chip using polydimethylsiloxane microfluidic channel. Anal. Chim. Acta. 468, 143-152 (2002).
- Beebe, D. J., Mensing, G. A., Walker, G. M. Physics and applications of microfluidics in biology. Annu. Rev. Biomed. Eng. 4, 261-286 (2002).
- Mariella, R. Sample preparation: the weak link in microfluidics-based biodetection. Biomed. Microdevices. 10, 777-784 (2008).
- Bhushan, B. . Springer handbook of nanotechnology. , (2010).
- Ghallab, Y. H., Badawy, W. . Lab-on-a-chip: Techniques, circuits, and biomedical applications. , (2010).
- Chee, M., et al. Accessing genetic information with high-density DNA arrays. Science. 25, 610-614 (1996).
- Ma, K. -. S., Zhou, H., Zoval, J., Madou, M. DNA hybridization detection by label free versus impedance amplifying label with impedance spectroscopy. Sensor. Actuat. B-Chem. 114, 58-64 (2006).
- Ito, T., Hosokawa, K., Maeda, M. Detection of single-base mismatch at distal end of DNA duplex by electrochemical impedance spectroscopy. Biosens. Bioelectron. 22, 1816-1819 (2007).
- Kao, L. T. -. H., et al. Multiplexed detection and differentiation of the DNA strains for influenza A (H1N1 2009) using a silicon-based microfluidic system. Biosens. Bioelectron. 26, 2006-2011 (2011).
- Li, J., Chen, S., Evans, D. H. Typing and subtyping influenza virus using DNA microarrays and multiplex reverse transcriptase PCR. J. Clin. Microbiol. 39, 696-704 (2001).
- Gautier, C., et al. Hybridization-induced interfacial changes detected by non-faradaic impedimetric measurements compared to faradaic approach. J. Electroanal. Chem. 610, 227-233 (2007).
- Ma, Y., Jiao, K., Yang, T., Sun, D. Sensitive PAT gene sequence detection by nano-SiO2/p-aminothiophenol self-assembled films DNA electrochemical biosensor based on impedance measurement. Sensor. Actuat. B-Chem. 131, 565-571 (2008).
- Kim, J. H. -. S., Marafie, A., Jia, X. -. Y., Zoval, J. V., Madou, M. J. Characterization of DNA hybridization kinetics in a microfluidic flow channel. Sensor. Actuat. B-Chem. 113, 281-289 (2006).
- Dykstra, P. H., Roy, V., Byrd, C., Bentley, W. E., Ghodssi, R. Microfluidic electrochemical sensor array for characterizing protein interactions with various functionalized surfaces. Anal. Chem. 83, 5920-5927 (2011).
- Ben-Yoav, H., Dykstra, P. H., Bentley, W. E., Ghodssi, R. A Microfluidic-based electrochemical biochip for label-free diffusion-restricted DNA hybridization analysis. Biosens. Bioelectron. 38, 114-120 (2012).
- Wink, T., van Zuilen, S. J., Bult, A., van Bennekom, W. P. Self-assembled monolayers for biosensors. Analyst. 122, 43R-50R (1997).
- McEwen, G. D., Chen, F., Zhou, A. Immobilization, hybridization, and oxidation of synthetic DNA on gold surface: Electron transfer investigated by electrochemistry and scanning tunneling microscopy. Anal. Chim. Acta. 643, 26-37 (2009).
- Arinaga, K., Rant, U., Tornow, M., Fujita, S., Abstreiter, G., Yokoyama, N. The role of surface charging during the coadsorption of mercaptohexanol to DNA layers on gold: Direct observation of desorption and layer reorientation. Langmuir. 22, 5560-5562 (2006).
- Katz, E., Willner, I. Probing biomolecular interactions at conductive and semiconductive surfaces by impedance spectroscopy: Routes to impedimetric immunosensors, DNA-sensors, and enzyme biosensors. Electroanalysis. 15, 913-947 (2003).
