JoVE Journal > Biology
Summary
Abstract
Introduction
Protocol
Results
Discussion
Disclosures
Acknowledgements
Materials
References
Automatic Translation
Please note that all translations are automatically generated. Click here for the English version.
Biology

Verbeterde Northern Blot detectie van kleine RNA Species in<em> Drosophila melanogaster</em

Published: August 21, 2014
doi:
10.3791/51814
,
1Département de Génomique Fonctionnelle et Cancer,Institut de Génétique et de Biologie Moléculaire et Cellulaire, 2Center for Life NanoScience,Istituto Italiano di Tecnologia

Summary

Het doel van deze publicatie is om te visualiseren en te discussiëren over de operatieve stappen van een Enhanced Northern Blot protocol op RNA geëxtraheerd uit Drosophila melanogaster embryo's, cellen en weefsels. Dit protocol is bijzonder bruikbaar voor de efficiënte detectie van kleine RNA species.

Abstract

De laatste decennia hebben de explosie van wetenschappelijke belangstelling rond genexpressie controlemechanismen op het RNA-niveau meegemaakt. Deze tak van de moleculaire biologie is sterk aangewakkerd door de ontdekking van niet-coderende RNA's als belangrijke spelers in het post-transcriptionele regulatie. Zo'n revolutionair perspectief is gepaard gegaan en veroorzaakt door de ontwikkeling van krachtige technologieën voor het profileren van korte RNA expressie, zowel op de high-throughput niveau (genoom-brede identificatie) of als single-kandidaat-analyse (steady state accumulatie van specifieke soorten). Hoewel verschillende state-of-art strategieën zijn momenteel beschikbaar voor het doseren of het visualiseren van een dergelijke vlucht voor moleculen, Northern Blot test blijft de in aanmerking komende aanpak in de moleculaire biologie voor de onmiddellijke en nauwkeurige evaluatie van RNA-expressie. Het is een eerste stap naar de toepassing van meer geavanceerde, dure technologieën en in veel gevallen blijft preferentiële werkwijze gemakkelijk inzichtenin RNA biologie. Hier het overzicht hebben we een efficiënt protocol (Enhanced Northern Blot) voor het detecteren zwak uitgedrukt microRNAs (of andere kleine regulerende RNA-soorten) van Drosophila melanogaster hele embryo's, handmatig ontleed larvale / volwassen weefsels of in vitro gekweekte cellen. Een zeer beperkte hoeveelheid RNA is vereist en het gebruik van materiaal van flowcytometrie-geïsoleerde cellen kunnen ook overwogen.

Introduction

RNA biochemie heeft spectaculaire vooruitgang ervaren in de afgelopen jaren 1. Ons begrip van RNA potentieel in de controle van genexpressie werd barsten van het identificatienummer van krachtige noncoding ribo-regulatoren 2, door de ontdekking van nieuwe RNA gebaseerde regulerende mechanismen 3,4 en een diepere karakterisering van reeds bekende post-transcriptionele gebeurtenissen 5. Alles bij elkaar deze studies hebben toegestaan ​​RNA biologie drastisch maken de scène, steeds in de huidige wetenschappelijke landschap een belangrijk onderwerp van onderzoek. Met name de laatste jaren krijgen we een gevoel van de doordringende invloed van de 'RNA-wereld "op moleculaire neurobiologie 6, een van de meest dynamische onderzoeksgebieden in de moderne life science. In het laatste decennium van de vorige eeuw, heeft de algemene wetenschappelijke scenario is een revolutie door de ontdekking van de RNA-interferentie 7,8 en van de kleine regulerende RNA's 9,10met bijzondere aandacht voor microRNAs 11, endogeen tot expressie kleine niet-coderende RNA's betrokken bij de controle van bijna alle cellulaire functies als pleiotropische en combinatorische regulatoren van genexpressie.

Bijna 10 jaar na miRNA eerste ontdekking in Caenorhabditis elegans door Ambros en Ruvkun's laboratoria, werd hernieuwd aandacht gericht op het veld bij hoge aantallen van miRNAs werden geïdentificeerd in Drosophila en in menselijke cellen en 12-15. Sindsdien, dankzij de veelzijdige transgene benaderingen, Drosophila melanogaster heeft opviel als een waardevolle biologische context te verdiepen in miRNA biosynthese en activiteit. Drosophila miRNAs hebben verschillende functies onthuld in insect-specifieke of evolutionair geconserveerd processen, variërend van veroudering om de stofwisseling, signaalwegen , gedrag en natuurlijk, neurogenese. Langs deze richting, hebben we onlangs een nieuwe koppeling 16 in de intrigerende co onthuldrrelation optreden tussen de master-gen GCM / glijden en de RNA-pad. De fly transcriptiefactor Gcm / Glide 17-19 vormt een uniek voorbeeld van lot van de cel determinant, die dicteert de gliale versus neuronale lot keuze in multipotente vliegen neurale voorlopers 20. Twintig jaar lang onderzoek naar dit onderwerp is duidelijk onderstreept het optreden van meerdere en overlappende ingangen van genexpressie regulatie convergerende dan GCM / glijden 21-28 aan de drempelwaarden die nodig zijn voor het balanceren van de delicate verhouding tussen neuronale en gliale tegenhangers tijdens neurale ontwikkeling vast te stellen.

We ontdekten dat regulering via DMEL-miR279 targeting is een verdere controle niveau bij te dragen tot post-transcriptionele fine-tuning van GCM / glijden meningsuiting 16. Wereldwijd zijn deze onderzoekslijnen vereist specifieke methodologische verbeteringen: langs jaren hebben verschillende technologieën oorspronkelijk ontwikkeld om trad analyserennele RNA's zijn omgebouwd voor het kwantificeren van kleine niet-coderende RNA's, zoals zoals RNAse bescherming assays, cDNA arrays 29-31, real-time PCR methoden 32-35 en sequentiebepaling van 36,37. Aan de andere kant, heeft herijking van technische benaderingen voortdurende vooruitgang bevorderd in het veld.

Northern Blot assay (NB, of RNA gel blotbepaling) vormt een representatief voorbeeld: het wordt grotendeels gebruikt om RNA accumulatie profileren, omdat zij garant staat voor expressie kwantificatie evenals grootte bepalen. De intrinsieke lage sensitiviteit van de werkwijze wordt beperkt wanneer het moet worden toegepast op lage overvloedige genexpressie fijnstemmers, zoals korte RNA's. Een nadelig gevolg is het vereiste van grote hoeveelheden totaal RNA, die moeilijk zijn toepassing op specifieke biologische monsters maakt. Om bovenstaande redenen is specifiek NB varianten voor kleine RNA-detectie zijn ontwikkeld 38-40: we hebben geprofiteerd van een verbeterde NB procedure 41 (ENB, Enhanced Northern Blot), terwijl het ophelderen van de bovengenoemde wisselwerking tussen DMEL-miR279 en GCM / glide.

Deze werkwijze berust op een chemische verknopende stap gebaseerd op de activiteit van een carbodiimide derivaat [1-ethyl-3-(3-dimethylaminopropyl) carbodiimide, EDC] nucleïnezuur bevestigen op vaste dragers. Carbodiimide is een veelzijdige verknoper waarover de vorming van amidebindingen tussen geactiveerde carboxyl of fosfaatgroepen en aminegroepen 42 katalyseren. Deze eigenschap kan worden benut om covalent paar kleine RNAs via hun mono-gefosforyleerde 5'-hydroxylgroep aminogroepen aan het oppervlak van nylon membranen. De resulterende configuratie onderdeel vergroot de toegankelijkheid van het geïmmobiliseerde nucleïnezuur en op zijn beurt de efficiëntie van probe-doel hybridisatie, wat resulteert in opmerkelijke detectieverfijning 43.

De techniek gaat ervan bijzonder relevance in Drosophila moleculaire studies, waarbij het ​​optreden van nieuwe en onderscheidende klassen van kleine niet-coderende RNA's is in opkomst 44. Hiervan rasiRNAs 45,46 vormen een specifiek subtype van piwi interactie RNAs (piRNAs 47) betrokken bij sequentie-specifieke gen-silencing. Operative details van deze werkwijze zijn volledig beschreven en gevisualiseerd hierna opzichte van de analyse van de microRNA DMEL-miR279 en DMEL-miR286 en, voor het eerst van een rasiRNA, rasi4. We geduwd deze werkwijze, die ons toegelaten onthullen slecht uitgedrukt doelen van minimale hoeveelheden RNA (minder dan 1 ug) uitersten.

Protocol

1 Sample Collection Los semi-adherente Schneider 2 cellen (1-5 x 10 6 cellen gemiddeld), door pipetteren en oogsten ze door centrifugeren (100 g gedurende 1 min). In het geval van in vitro gekweekte hechtende cellen, trypsinize ze in normale omstandigheden of direct te verzamelen van platen in een geschikte hoeveelheid RNA extractie reagens, met behulp van een cel schraper. Voor het embryo, groeien Drosophila stammen in fly kooien en laat embryo's zich ophopen op eie…

Representative Results

Door het volgen van de in de tekst beschreven en schematisch weergegeven in figuur 1 algemeen procedure, onderzochten we kleine RNA expressie van complexe RNA-monsters van verschillende oorsprong. In het experiment weergegeven in figuur 1, werd RNA geïsoleerd uit Drosophila Schneider 2-cellen door Proteinase K extractie, gecontroleerd op integriteit (optionele stap: denaturerende agarose gel fractionering) en dubbel geladen. Een helft van de gel werd geblot op een membraan en …

Discussion

Hoewel onze waardering voor de verfijnde verwevenheid waardoor RNA reguleert neurogenese neemt voortdurend toe, de mechanistische implicaties van RNA gebaseerde circuits beïnvloeden neurale stamcellen biologie, neuronale differentiatie / functionele integratie, ontwikkeling van neurale aandoeningen en kanker blijft onontgonnen. Het onderhoud van deze netwerken door koninkrijken maakt van de mogelijkheden van genetische systemen zoals Drosophila melanogaster instrumenteel om onontgonnen cellulaire routes, waarb…

Disclosures

The authors have nothing to disclose.

Acknowledgements

Dit werk werd ondersteund door het Institut National de la Sante et de la Recherche Medicale, giet het Centre National de la Recherche Scientifique, de Universite de Strasbourg, het Hôpital de Strasbourg, de Vereniging la Recherche sur le Cancer, het Institut National du Cancer, de Agence Nationale de la Recherche en de Elzas.

Pietro Laneve werd ondersteund door de Fondation pour la Recherche Medicale. Momenteel is hij een ontvanger van een Istituto Italiano Tecnologia (IIT) fellowship. Publicatiekosten worden ondersteund door de Neurex netwerk (TriNeuron – Programma Interreg IV Boven-Rijn)

Materials

FINAL COMPOSITION/NAME COMPANY CATALOGUE (Stock) COMMENTS
GENERAL REQUIREMENT
Centrifuge, 5418 Eppendorf 5418 000.017
Decontaminant, RNase Away Sigma-Aldrich 83931 Apply on glass/plasticware, wipe and rinse
RNase inhibitor, DEPC Sigma-Aldrich D5758 Hazardous //// 1609-47-8
0.1 % DEPC suspension Incubate 2 hr at 37 ˚C, then sterilize by autoclave
SAMPLE PREPARATION
Stereo Microscope, M60 Leica 
1X PBS Buffer
137 mM NaCl Sigma-Aldrich S3014 7647-14-5  
2.7 mM KCl Sigma-Aldrich P9541 7447-40-7 
10 mM Na2HPO4 Sigma-Aldrich S3264 7558-79-4 
1.8 mM KH2PO4 Sigma-Aldrich P9791 7778-77-0 
RNA EXTRACTION/ANALYSIS
UV-Vis Spectrophotometer Thermo Scientific Nanodrop 2000
Gel Imager, ChemiDoc XRS+ Biorad 170-8265
Horizontal Electrophoresys, Mini-Sub Cell GT BioRad 170-4487EDU
RNA extraction reagent, TRIzol Reagent Life Technologies 15596026 Hazardous
PCA (25:24:1), 1:1 for extraction Sigma-Aldrich 77617 136112-00-0
Chlorophorm, 1:1 for extraction Sigma-Aldrich C2432 67-66-3  
EtOH, 2.5 vol. for precipitation, 70% for washing Sigma-Aldrich 59844 64-17-5 
Gene Ruler 1Kb DNA Ladder Thermo Scientific SM0311
Stop Mix
300 mM NaOAc, pH 5.5 Sigma-Aldrich S2889 127-09-3
1x RSB Solution
2% sodium dodecyl sulfate (SDS) Sigma-Aldrich 71736 Never cool down SDS to avoid  precipitation //// 151-21-3
2 mg/ml Proteinase K Roche Applied Science 0-3115828001 EC 3.4.21.64 9
10X Reticulocyte Standard Buffer (RSB)
100 mM Tris-Cl, pH 7.4 Sigma-Aldrich T5941 1185-53-1  
100 mM NaCl Sigma-Aldrich S3014 7647-14-5  
30 mM MgCl2 Sigma-Aldrich M8266 7786-30-3
Denaturing Agarose Gel
1.2% Agarose Sigma-Aldrich A9539 Let the gel solidify for at least 1 hr //// 9012-36-2
1x MOPS Buffer Add when T < 60 ˚C
3% formaldehayde Sigma-Aldrich F8775 Hazardous. Add when T < 60 ˚C //// 50-00-0
10X MOPS Buffer
0.2 M MOPS sodium salt, pH 7 Sigma-Aldrich M9381 Do not confuse MOPS sodium salt with MOPS //// 71119-22-7
Agarose Loading Dye
1x MOPS Buffer
3% formaldehyde Sigma-Aldrich F8775 Hazardous //// 50-00-0
50% formamide Sigma-Aldrich 47670 Hazardous //// 75-12-7
Ethidium bromide (EtBr) 30 μg/ml Sigma-Aldrich E1510 Hazardous //// 1239-45-8
Bromophenol blue  Sigma-Aldrich B0126 115-39-9 
SMALL RNA FRACTIONATION
Flat gel loading tips Life Technologies LC1002
Savant SpeedVac Concentrator Thermo Scientific  DNA120
Vertical Electrophoresis, Mini-PROTEAN Tetra Cell  Biorad 165-8000
Denaturing Acrilamide Gel
10% acrylamide/bis-acrylamide (19:1) Sigma-Aldrich A3449 Hazardous. Let the gel polymerizefor 45 min before use
1x TBE Buffer (or 1x MOPS Buffer)
7 M urea Sigma-Aldrich U6504 57-13-6
0.1% ammonium persulfate Sigma-Aldrich 215589 7727-54-0 
0.1% TEMED Sigma-Aldrich T9281 110-18-9
Gene Ruler Ultra Low Range DNA Ladder (10 bp-step) Thermo Scientific SM1211 Label 0.1 μg, as described in the "probe labeling" reaction
Acrylamide Blue Dye 
50% formamide Sigma-Aldrich 47670 Hazardous //// 75-12-7
Bromophenol blue Sigma-Aldrich B0126 115-39-9 
Running Buffer (RB)
1x MOPS Buffer 
Alternative RB: 1x TBE Buffer
1x TBE Buffer
5X TBE
445 mM Tris-base Sigma-Aldrich T1503 77-86-1 
445 mM boric acid Sigma-Aldrich B7901 10043-35-3
20 mM EDTA Sigma-Aldrich EDS 60-00-4  
Gel Staining Solution
Ethidium bromide 0.5 μg/ml Sigma-Aldrich E1510 Hazardous //// 1239-45-8
1x RB Stain for 15 min with EtBr, destain for 15 min w/o EtBr
BLOTTING
3MM Whatman paper Sigma-Aldrich Z270849
Neutral Nylon Membrane, Hybond NX GE Healthcare Life Science RPN203T Photosensitive
CROSSLINKING
Crosslinking Solution (XLS)
1% 1-methylimidazole (v/v) Sigma-Aldrich 336092 Always prepare a fresh aliquot of XLS //// 616-47-7
12.5 mM HCl Sigma-Aldrich H1758 Hazardous //// 7647-01-0
3.1% EDC (w/v) Sigma-Aldrich 3450 25952-53-8  
(PRE)-HYBRIDIZATION
Liquid Scintillation Counter  Beckmann LS 6500
Sheared Salmon Sperm, 0.1 mg/ml  Life Technologies AM9680
rasi4 antisense probe 5' CGGUGUUCGACAGUUCCUCGGG -3'
5s-rRNA antisense probe 5'-CAACACGCGGTGTTCCCAAGCCG-3'
Dmel-miR279 antisense probe 5'-TTAATGAGTGTGGATCTAGTCA-3'
Dmel-miR286 antisense probe 5'-AGCACGAGTGTTCGGTCTAGTCA-3'
Purification Kit, Illustra MicroSpin G-25 Columns GE Healthcare Life Science 27-5325-01
(Pre)-Hybridization Solution (HS)
6x SSPE Pre-warm HS at 37 ˚C before use
0.5% SDS Sigma-Aldrich 71736 151-21-3 
5x Denhardt's Solution
20X SSPE
3.6 M NaCl Sigma-Aldrich S3014 7647-14-5  
0.2 M sodium phosphate Sigma-Aldrich 342483 7601-54-9  
20 mM EDTA (pH 8.0) Sigma-Aldrich EDS  60-00-4  
50x Denhardt's Solution
1% Ficoll 400 (w/v) Sigma-Aldrich F2637 26873-85-8
1% Polyvinylpyrrolidone Sigma-Aldrich PVP40 9003-39-8
1% BSA Sigma-Aldrich A7906 9048-46-8  
1X TEN Buffer
10 mM Tris-Cl (pH 8.0) Sigma-Aldrich T1503 77-86-1 
100 mM NaCl Sigma-Aldrich S3014 7647-14-5  
1 mM EDTA (pH 8.0) Sigma-Aldrich EDS  60-00-4  
Probe Labelling
0.4 μM oligonucleotide
1.5 μl Ci/μl [γ-32P] ATP Perkin Elmer NEG002A Hazardous //// 51963-61-2
1x T4 Polynucleotide Kinase Buffer Biolabs B0201
T4 Polynucleotide Kinase 0.5 units/μl Biolabs M0201 EC 2.7.1.78
30 min at 37 ˚C, stop by 20 mM EDTA
WASHING
Geiger Mueller Detectors Canberra Industries MCB2/CPS – EM77021
Washing Buffer (WB), 2x SSPE
Stringent Washing Buffers
0.2x SSPE
2x SSPE, 0.5% SDS
0.2x SSPE, 0.5% SDS
SIGNAL DETECTION
PharosFX Plus System Biorad 170-9460
Image J Freely available
Quantity One Biorad
X-ray films , BioMax XAR Sigma-Aldrich F5888 Photosensitive
Developer for X-ray films Sigma-Aldrich P7042
Fixer for X-ray films Sigma-Aldrich P7167
STRIPPING
Stripping Solution
10 mM Tris-HCl pH 8.8 Sigma-Aldrich T1503 77-86-1 
5 mM EDTA Sigma-Aldrich EDS  60-00-4  
0.1% SDS Sigma-Aldrich 71736 Add SDS after boiling to avoid foaming //// 151-21-3
DOWNLOAD MATERIALS LIST

References

  1. Gesteland, R. F., Cech, T. R., Atkins, J. F. . The RNA World. , (2006).
  2. Mercer, T. R., Dinger, M. E., Mattick, J. S. Long non-coding RNAs: insights into functions. Nat Rev Genet. 10, 155-159 (2009).
  3. Salmena, L., Poliseno, L., Tay, Y., Kats, L., Pandolfi, P. P. A ceRNA hypothesis: the Rosetta Stone of a hidden RNA language?. Cell. 146, 353-358 (2011).
  4. Cesana, M., et al. A long noncoding RNA controls muscle differentiation by functioning as a competing endogenous RNA. Cell. 147, 358-369 (2011).
  5. Orphanides, G., Reinberg, D. A unified theory of gene expression. Cell. 108, 439-451 (2002).
  6. Mehler, M. F., Mattick, J. S. Noncoding RNAs and RNA editing in brain development, functional diversification, and neurological disease. Physiol Rev. 87, 799-823 (2007).
  7. Fire, A., Xu, S., Montgomery, M., Kostas, S., Driver, S., Mello, C. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature. 391, 806-811 (1998).
  8. Hamilton, A., Baulcombe, D. A species of small antisense RNA in posttranscriptional gene silencing in plants. Science. 286, 950-952 (1999).
  9. Lee, R. C., Feinbaum, R. L., Ambros, V. The C. Elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell. 75, (1993).
  10. Wightman, B., Ha, I., Ruvkun, G. Posttranscriptional regulation of the heterochronic gene lin-14 by lin-4 mediates temporal pattern formation in C. elegans. Cell. 75, 855-862 (1993).
  11. Fabian, M. R., Sonenberg, N., Filipowicz, W. Regulation of mRNA translation and stability by microRNAs. Annu Rev Biochem. 79, 351-379 (2010).
  12. Pasquinelli, A. E., et al. Conservation of the sequence and temporal expression of let-7 heterochronic regulatory RNA. Nature. 408, 86-89 (2000).
  13. Lagos-Quintana, M., Rauhut, R., Lendeckel, W., Tuschl, T. Identification of novel genes coding for small expressed RNAs. Science. 294, 853-858 (2001).
  14. Lau, N. C., Lim, L. P., Weinstein, E. G., Bartel, D. P. An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans. Science. 294, 858-862 (2001).
  15. Lee, R. C., Ambros, V. An extensive class of small RNAs in Caenorhabditis elegans. Science. 294, 862-864 (2001).
  16. Laneve, P., et al. The Gcm/Glide molecular and cellular pathway: new actors and new lineages. Dev Biol. 375, 65-78 (2013).
  17. Hosoya, T., Takizawa, K., Nitta, K., Hotta, Y. Glial cells missing: a binary switch between neuronal and glial determination in Drosophila. Cell. 82, 1025-1036 (1995).
  18. Jones, B. W., Fetter, R. D., Tear, G., Goodman, C. S. Glial cells missing: a genetic switch that controls glial versus neuronal fate. Cell. 82, 1013-1023 (1995).
  19. Vincent, S., Vonesch, J. L., Giangrande, A. Glide directs glial fate commitment and cell fate switch between neurons and glia. Developement. 122, 131-139 (1996).
  20. Cattenoz, P. B., Giangrande, A. Lineage specification in the fly nervous system and evolutionary implications. Cell Cycle. 12, 2753-2759 (2013).
  21. Jones, B. W., Abeysekera, M., Galinska, J., Jolicoeur, E. M. Transcriptional control of glial and blood cell development in Drosophila: cis-regulatory elements of glial cells missing. Dev Biol. 266, 374-387 (2004).
  22. Ragone, G., et al. Transcriptional regulation of glial cell specification. Dev Biol. 255, 138-150 (2003).
  23. Akiyama-Oda, Y., Hosoya, T., Hotta, Y. Asymmetric cell division of thoracic neuroblast 6-4 to bifurcate glial and neuronal lineage in Drosophila. Development. 126, 1967-1974 (1999).
  24. Bernardoni, R., Kammerer, M., Vonesch, J. L., Giangrande, A. Gliogenesis depends on glide/gcm through asymmetric division of neuroglioblasts. Dev Biol. 216, 265-275 (1999).
  25. Ragone, G., Bernardoni, R., Giangrande, A. A novel mode of asymmetric division identifies the fly neuroglioblast 6-4T. Dev Biol. 235, 74-85 (2001).
  26. Soustelle, L., Roy, N., Ragone, G., Giangrande, A. Control of gcm RNA stability is necessary for proper glial cell fate acquisition. Mol Cell Neurosci. 37, 657-662 (2008).
  27. Akiyama, Y., Hosoya, T., Poole, A. M., Hotta, Y. The gcm-motif: a novel DNA-binding motif conserved in Drosophila and mammals. Proc. Natl. Acad. Sci. USA. 25, 14912-14916 (1996).
  28. Miller, A. A., Bernardoni, R., Giangrande, A. Positive autoregulation of the glial promoting factor glide/gcm. EMBO J. 17, 6316-6326 (1998).
  29. Krichevsky, A. M., King, K. S., Donahue, C. P., Khrapko, K., Kosik, K. S. A microRNA array reveals extensive regulation of microRNAs during brain development. RNA. 9, 1274-1281 (2003).
  30. Liu, C. G., et al. An oligonucleotide microchip for genome-wide microRNA profiling in human and mouse tissues. Proc. Natl. Acad. Sci. USA. 101, 9740-9744 (2004).
  31. Yin, J. Q., Zhao, R. C., Morris, K. V. Profiling microRNA expression with microarrays. Trends Biotechnol. 26, 70-76 (2008).
  32. Schmittgen, T. D., Jiang, J., Liu, Q., Yang, L. A high-throughput method to monitor the expression of microRNA precursors. Nucleic Acids Res. 32, E43 (2004).
  33. Chen, C., et al. Real-time quantification of microRNAs by stem-loop RT-PCR. Nucleic Acids Res. 33, e179 (2005).
  34. Shi, R., Chiang, V. L. Facile means for quantifying microRNA expression by real-time PCR. Biotechniques. 39, 519-525 (2005).
  35. Raymond, C. K., Roberts, B. S., Garrett-Engele, P., Lim, L. P., Johnson, J. M. Simple quantitative primer-extension PCR assay for direct monitoring of microRNAs and short-interfering RNAs. RNA. 11, 1737-1744 (2005).
  36. Wang, Z., Gerstein, M., Snyder, M. RNA-Seq: a revolutionary tool for transcriptomics. Nat Rev Genet. 10, 57-63 (2009).
  37. Linsen, S. E., et al. Limitations and possibilities of small RNA digital gene expression profiling. Nat Methods. 6, 474-476 (2009).
  38. Valoczi, A., et al. Sensitive and specific detection of microRNAs by northern blot analysis using LNA-modified oligonucleotide probes. Nucleic Acids Res. 32, e175 (2004).
  39. Varallyay, E., Burgyan, J., Havelda, Z. Detection of microRNAs by Northern blot analyses using LNA probes. Methods. 43, 140-145 (2007).
  40. Kim, S. W., et al. A sensitive non-radioactive northern blot method to detect small RNAs. Nucleic Acids Res. 38, e98 (2010).
  41. Pall, G. S., Hamilton, A. J. Improved northern blot method for enhanced detection of small RNA. Nat Protoc. 3, 1077-1084 (2008).
  42. Hermanson, G. T. . Bioconjugate Techniques. , (2008).
  43. Pall, G. S., Codony-Servat, C., Byrne, J., Ritchie, L., Hamilton, A. Carbodiimide-mediated cross-linking of RNA to nylon membranes improves the detection of siRNA, miRNA and piRNA by northern blot. Nucleic Acids Res. 35, e60 (2007).
  44. Guzzardo, P. M., Muerdter, F., Hannon, G. J. The piRNA pathway in flies: highlights and future directions. Curr Opin Genet Dev. 23, 44-52 (2013).
  45. Aravin, A. A., et al. Double-stranded RNA-mediated silencing of genomic tandem repeats and transposable elements in the D. melanogaster germline. Curr. Biol. 11, 1017-1027 (2001).
  46. Vagin, V. V., et al. A distinct small RNA pathway silences selfish genetic elements in the germline. Science. 313, 320-324 (2006).
  47. Brennecke, J., et al. Discrete small RNA-generating loci as master regulators of transposon activity in Drosophila. Cell. 128, 1089-1103 (2007).
  48. Sullivan, W., Ashburner, M., Hawley, R. S. . Drosophila protocols. , (2008).
  49. Zamore, P. D., Ma, S. Isolation of Drosophila melanogaster testes. J. Vis. Exp. (51), e2641 (2011).
  50. Sambrook, J., Fritsch, E. F., Maniatis, T. . Molecular cloning : a laboratory manual. , (1989).
  51. Alwine, J. C., Kemp, D. J., Stark, G. R. Method for detection of specific RNAs in agarose gels by transfer to diazobenzyloxymethyl-paper and hybridisation with DNA probes. Proc. Natl. Acad. Sci. USA. 74, 5350-5354 (1977).
  52. Hansen, T. B., et al. Natural RNA circles function as efficient microRNA sponges. Nature. 495, 384-388 (2013).
  53. Flores-Jasso, C. F., Salomon, W. E., Zamore, P. D. Rapid and specific purification of Argonaute-small RNA complexes from crude cell lysates. RNA. 19, 271-279 (2013).
  54. Specchia, V., et al. Hsp90 prevents phenotypic variation by suppressing the mutagenic activity of transposons. Nature. 463, 662-665 (2010).
  55. Várallyay, E., Burgyán, J., Havelda, Z. MicroRNA detection by northern blotting using locked nucleic acid probes. Nat Protoc. 3, 190-196 (2008).
  56. Koscianska, E., Starega-Roslan, J., Czubala, K., Krzyzosiak, W. J. High-resolution northern blot for a reliable analysis of microRNAs and their precursors. ScientificWorldJournal. 11, 102-117 (2011).

Tags

Keywords: Enhanced Northern BlotSmall RNAMicroRNADrosophila MelanogasterGene ExpressionPost-transcriptional RegulationNoncoding RNARNA ProfilingRNA DetectionMolecular BiologyEmbryoCell Culture
check_url/51814?article_type=t

Play Video
PDF
DOI
DOWNLOAD MATERIALS LIST
Cite This Article
Laneve, P., Giangrande, A. Enhanced Northern Blot Detection of Small RNA Species in Drosophila Melanogaster. J. Vis. Exp. (90), e51814, doi:10.3791/51814 (2014).
Download Citation
Reprints and Permissions

View Video

✖

To prove you're not a robot, please enter the text in the image below

CAPTCHA Image
Play CAPTCHA Audio
Refresh Image