Dit protocol laat zien hoe fluorescent gemerkt, genetisch bepaald klonale tumoren in de Drosophila oog / antennaal verbeelding schijven (EAD) te genereren. Het beschrijft hoe de EAD en de hersenen ontleden van de derde instar larven en hoe ze te verwerken te visualiseren en te kwantificeren genexpressie veranderingen en tumor invasiviteit.
Drosophila melanogaster has emerged as a powerful experimental system for functional and mechanistic studies of tumor development and progression in the context of a whole organism. Sophisticated techniques to generate genetic mosaics facilitate induction of visually marked, genetically defined clones surrounded by normal tissue. The clones can be analyzed through diverse molecular, cellular and omics approaches. This study describes how to generate fluorescently labeled clonal tumors of varying malignancy in the eye/antennal imaginal discs (EAD) of Drosophila larvae using the Mosaic Analysis with a Repressible Cell Marker (MARCM) technique. It describes procedures how to recover the mosaic EAD and brain from the larvae and how to process them for simultaneous imaging of fluorescent transgenic reporters and antibody staining. To facilitate molecular characterization of the mosaic tissue, we describe a protocol for isolation of total RNA from the EAD. The dissection procedure is suitable to recover EAD and brains from any larval stage. The fixation and staining protocol for imaginal discs works with a number of transgenic reporters and antibodies that recognize Drosophila proteins. The protocol for RNA isolation can be applied to various larval organs, whole larvae, and adult flies. Total RNA can be used for profiling of gene expression changes using candidate or genome-wide approaches. Finally, we detail a method for quantifying invasiveness of the clonal tumors. Although this method has limited use, its underlying concept is broadly applicable to other quantitative studies where cognitive bias must be avoided.
Kanker is een van de meest genetisch heterogene groep van ziekten, waarvan de incidentie en sterfte neemt drastisch toe, vooral onder ouderen wereldwijd. Cancer afkomstig klonaal uit een tumor-initiërende cel die inherent tumor suppressor mechanismen ontsnapt en verdeelt uit de hand. De geleidelijke toename van de genetische laesies die gezamenlijk het stimuleren van groei, proliferatie en de beweeglijkheid, terwijl het remmen van de dood en differentiatie transformeert de eerste goedaardige begroeiing in een zeer kwaadaardige, metastatische en dodelijke tumor. Gebleken is dat naast genetische veranderingen, tumorprogressie veranderingen nodig in de omliggende stroma en overspraak tussen tumortypes en verschillende celtypes (bijvoorbeeld fibroblasten, immuun- en endotheelcellen) in de micro-omgeving. Het begrijpen van de moleculaire principes die ten grondslag liggen kwaadaardige transformatie, inclusief de tumor-stroma interacties is van groot belang voor de ontwikkeling van Preventie en vroege screeningsstrategieën, alsmede nieuwe en effectieve behandelingen voor kanker en metastase geneesmiddelresistentie bestrijden.
De fruitvlieg Drosophila melanogaster is een aantrekkelijk systeem voor kankeronderzoek 1-4 dankzij zijn snelle generatie tijd geworden, opmerkelijke behoud van de signalering knooppunten tussen vliegen en de mens, beperkte genetische redundantie en de rijkdom van geavanceerde genetische tools die manipulatie van bijna elk gen in te vergemakkelijken een tijdelijk en ruimtelijk beperkte wijze. Genetische gedefinieerde tumoren van verschillende maligniteit kan reproduceerbaar worden gemanipuleerd in Drosophila door de invoering gain en verlies-van-functie mutaties in een subset van voorlopercellen in een overigens wildtype weefsel met behulp van de techniek MARCM 5. De MARCM gereedschap combineert FLP / FRT (FLP recombinase / FLP Erkenning Target) gemedieerde mitotische recombinatie 6 met FLP-out 7 en Gal4 / UAS (Upstream Activation Sequence) 8 doelwit genexpressiesystemen 9. Met deze werkwijze expressie van een-UAS gebaseerde transgene, waaronder oncogeen of fluorescerend eiwit cDNA's of geïnverteerde DNA repeats voor dsRNA-geïnduceerde genuitschakeling, wordt beperkt tot een kloon van cellen die een specifieke genetische locus en een Gal4 repressor door recombinatie verloren (Figuur 1A). Klonen plekken gemarkeerd met green fluorescent (GFP) of rood fluorescerende eiwitten (bijvoorbeeld, RFP, DsRed, mCherry) kan eenvoudig worden gevolgd tijdens de ontwikkeling, geïsoleerd en geanalyseerd. Belangrijker is dat hun gedrag rechtstreeks vergeleken met de aangrenzende wildtype weefsel. Zo vragen relevant zijn voor de cel autonome als niet-autonome effecten van genetische laesies kunnen gemakkelijk worden bestudeerd. Soortgelijke zoogdieren, alleen klonen waarin meerdere oncogene laesies combined maligne Drosophila worden en herhalen belangrijkste kenmerken van kankercellen van een zoogdier. Ze overproliferate, ontwijken apoptose, induceren ontsteking, onsterfelijk en Invasive uiteindelijk het doden van de gastheer 10-17.
Hier beschrijven we een protocol om genetisch bepaald klonale tumoren in het oog / antennaal en hersenweefsel van Drosophila larven te genereren met behulp van de MARCM techniek. De werkwijze berust op een MARCM tester materieel dat de gist FLP recombinase onder de controle van de enhancer ogenloze (eyFLP) 18,19 uitdrukt. Op deze wijze worden gemerkt GFP klonen gegenereerd in zowel peripodial en cilindrisch epitheel van de EAD en neuro-epitheel van de hersenen tijdens de embryonale en larvale stadia (Figuur 1A, B en referentie 20). Klonen kunnen eenvoudig worden gevolgd tot volwassenheid als EAD zich ontwikkelt tot de volwassen oog, antenne en het hoofd capsule, terwijl de neuroepithelium aanleiding geeft tot neuroblasts dat gedifferentieerde optische kwab neuronen produceren.
Uitgebreide moleculaire, functionele en fenotypische karakterisering van het mozaïek weefsel, we de te vergemakkelijkenschrijver een protocol voor dissectie van de EAD en hersenen van de derde instar larven en een beschrijving te verwerken voor drie verschillende toepassingen: (i) het opsporen van transgene fluorescente reporters en immunokleuring, (ii) kwantificering van tumor invasiviteit en (iii) analyse van genexpressie verandert met een kwantitatieve real-time PCR (qRT-PCR) of high-throughput sequentiebepaling mRNA (mRNA-seq) (Figuur 1C).
De immunokleuring protocol kan worden gebruikt om een eiwit van belang te visualiseren met een specifiek antilichaam. Transgene fluorescerende transcriptionele reporters bieden handige en nauwkeurige tijdruimtelijke gegevens over de activiteit van een bepaalde signaleringsroute. Cel-afstammingslijn specifieke reporters, anderzijds, tijdens kwalitatieve en kwantitatieve veranderingen in celpopulaties binnen de mozaïek weefsel en bij tumoren van verschillende genotypes. Kwantificering van invasieve gedrag maakt de vergelijking van tumor maligniteit tussen genotypes. Ten slotte is het protocol beschrijft inzameling en verwerking van mozaïek EAD voor RNA-isolatie is geschikt voor zowel kleine als grote schaal downstream-toepassingen zoals reverse transcriptie gevolgd door qRT-PCR en genoom-brede mRNA-seq, respectievelijk. De kwalitatieve en kwantitatieve gegevens verkregen uit deze testen leveren nieuwe inzichten in het sociale gedrag van klonale tumoren. Bovendien produceren ze een solide basis voor functionele studies over de rol van individuele genen, genetische netwerken en tumor micro-omgeving in verschillende stadia en aspecten van tumorigenese.
De technieken voor het genereren van genetische mozaïeken in Drosophila behoren tot de meest verfijnde hulpmiddelen voor het analyseren en manipuleren genfunctie 33. De eyFLP-MARCM systeem heeft bewezen krachtig en robuust als het laat de inductie van visueel gemarkeerd, genetisch bepaald klonen in een ruimtelijk beperkte wijze, dat wil zeggen, in de weefsels waar de eyeless enhancer actief is 9,18. Dit is vooral belangrijk wanneer meerdere genetische laesies worden geco…
The authors have nothing to disclose.
We thank the Bloomington Stock Center (Bloomington, USA), Dirk Bohmann, Katja Brückner and Istvan Ando for fly stocks, and antibodies. We thank Marek Jindra and Colin Donohoe for comments on the manuscript. This work was supported by the Sofja Kovalevskaja Award to M.U. from the Alexander von Humboldt Foundation and DFG project UH243/1-1 to M.U. from the German Research Foundation.
Agar | Gewürzmühle Brecht, Eggenstein, Germany | 00262-0500 | Fly food recipe: Prepare 20 L fly food with 160 g agar, 360 g yeast, 200 g soy flour, 1.6 kg yellow cornmeal, 1.2 L malt extract, 300 ml light corn syrup, 130 ml propionic acid and 200 ml 15% nipagin. Fly food should be cooked for 1 hour at 85°C. |
Corn syrup | Grafschafter Krautfabrik Josef Schmitz KG, Meckenheim, Germany | 01939 | |
Propionic acid | Carl Roth GmbH, Karlsruhe, Germany | 6026.1 | |
Cornmeal | ReformKontor GmbH, Zarrentin, Germany | 4010155063948 | |
Malt extract | CSM Deutschland GmbH, Bremen, Germany | 728985 | |
Soy flour | Stockmeier Food GmbH, Herford, Germany | 1000246441010 | |
Yeast | Werner Ramspeck GmbH, Schwabach, Germany | 210099K | |
Methyl-4-benzoate/ Nipagin | Sigma-Aldrich, Deisenhofen, Germany | H5501 | Prepare a 15% stock solution with 70% EtOH |
Drosophila fly food vials | Kisker Biotech, Steinfurt, Germany | 789008 | |
Vial plugs | K-TK e.K., Retzstadt, Germany | 1002 | |
Drosophila fly food bottles | Greiner Bio-One, Frickenhausen, Germany | 960177 | |
Bottle plugs | K-TK e.K., Retzstadt, Germany | 1002 S | |
Poly(vinyl alcohol) 4-88/[-CH2CHOH-]n | Sigma-Aldrich, Deisenhofen, Germany | 81381 | Mounting medium recipe: Dissolve 6 g Poly(vinyl alcohol) 4-88 in 39 ml Millipore H2O, 6 ml 1 M Tris (pH 8.5) and 12.5 ml glycerol. Stir overnight at 50°C and centrifuge 20 min at 5000 rpm. Add DABCO to the supernatant to get a final concentration of 2.5%. Store aliquots at -20°C. |
1,4-Diazabicyclo[2.2.2]octane/ DABCO | Sigma-Aldrich, Deisenhofen, Germany | D2522 | |
Triton X-100 | Sigma-Aldrich, Deisenhofen, Germany | 9002-93-1 | |
Phosphate-buffered saline/ PBS | 137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4 and 1.8 mM KH2PO4, pH 7.4 in Millipore H2O | ||
PBST | 0.1% Triton X-100 in PBS | ||
Paraformaldehyde/ PFA | Sigma-Aldrich, Deisenhofen, Germany | 158127 | 4% PFA fixative recipe: Dissolve 4 g PFA in 80 ml Millipore H2O on a magnetic stirrer plate heated to 55 °C. Add 1M NaOH dropwise until all PFA particles are dissolved. Add 10 ml 10X PBS and adjust the pH to 7.4 with 1M HCl. Mix in 100 µl Triton X-100 and fill up with Millipore H2O to 100 ml. Store aliquots at -20°C. Avoid repeated thawing. (CAUTION: PFA is highly toxic. Prepare the PFA fixative in a fume hood. Wear a self-contained breathing apparatus, gloves and clothing. Avoid contact with skin, eyes or mucous membranes) |
Bovine Serum Albumin/ BSA | Sigma-Aldrich, Deisenhofen, Germany | A3059 | Blocking solution recipe: Dissolve 0.3% BSA in PBST |
4’,6-Diamidino-2-phenylindol Dihydrochlorid/ DAPI | Carl Roth GmbH, Karlsruhe, Germany | 6335 | DAPI staining solution: Prepare a stock solution of 5 mg/ml in Millipore H2O and store aliquots at 4°C. Used in dilution 1:1000 in PBST. |
Alexa Flour 546 Phalloidin | Invitrogen, Karlsruhe, Germany | A22283 | Used in dilution 1:500 in PBST. |
Mouse anti-H2 antibody | Kurucz et al., 2003 | Used in dilution 1:500 in blocking solution | |
Cy5 AffiniPure Donkey Anti-Mouse IgG (H+L) | Jackson ImmunoResearch, Suffolk, UK | 715-175-151 | Used in dilution 1:500 in blocking solution |
Dumont #5 forceps | Fine Science Tools, Heidelberg, Germany | 11295-10 | |
Glass embryo dish (30 mm) | Thermo Scientific, Schwerte, Germany | E90 | |
Tungsten needles | Fine Science Tools, Heidelberg, Germany | 10130-20 | |
Nickel Plated Pin Holder | Fine Science Tools, Heidelberg, Germany | 26018-17 | |
Microscope slides | VWR, Darmstadt, Germany | 631-1553 | |
Coverslips 22 x 22 mm (#1 Menzel-Gläser) | VWR, Darmstadt, Germany | 631-1336 | |
Coverslips 24 x 50 mm (0.13-0.16 mm) | Thermo Scientific, Schwerte, Germany | 1076371 | |
Kimtech Science Precision Wipes | Thermo Scientific, Schwerte, Germany | 06-677-70 | |
Dissecting stereomicroscope | Olympus, Hamburg, Germany | SZX7 (DF PLAPO 1X-4 Japan) | |
Fluorescent stereomicroscope | Olympus, Hamburg, Germany | SZX16 (SDF PLAPO 0.8X Japan) with DP72 CCD camera | Equipped with the narrow blue bandpass filter set for excitation of GFP other blue excitable fluorochromes (excitation filter BP460-480 nm, barrier filter BA495-540 nm) and narrow green excitation and longpass barrier filter for RFP and other green excitable fluorochromes (excitation filter BP530-550, barrier filter BA575IF). Software: Olympus cellSens Standard 1.11. |
Confocal microscope | Olympus, Hamburg, Germany | FV1000 | Equipped with inverted IX81 microscope. Objectives: 20× UPlan S-Apo (NA 0.85), 40× UPlanFL (NA 1.30) and 60× UPlanApo (NA 1.35). Lasers: UV laser Diode LD405 (50mW), Argon laser, multi-line 457/(476)/ 488/515 (40mW), Yellow/Green laser diode LD560 (15mW) and Red Laser diode 635 (20mW). Software: Fluoview 2.1c Software |
Drosophila cooled incubator | Ewald Innovationstechnik GmbH, Bad Nenndorf, Germany | Sanyo MIR553 | |
Squirt bottle | VWR, Darmstadt, Germany | 215-8105 | |
BD Clay Adams Nutator Mixer | VWR, Darmstadt, Germany | 15172-203 | |
ELMI Digital Rocking Shaker | VWR, Darmstadt, Germany | DRS-12 | |
5 PRIME Isol-RNA Lysis Reagent | VWR, Darmstadt, Germany | 2302700 | The protocol is compatible with other TRIzol-based reagents e.g. TRIreagent from Sigma (Cat. Nr.T9424), TRIzol reagent from Thermofisher (Cat. Nr. 15596). |
Diethyl pyrocarbonate/ DEPC | Sigma-Aldrich, Deisenhofen, Germany | D5758 | Dilute DEPC 1:1000 in Millipore H2O, stir overnight and autoclave. |
UltraPure Phenol:Chloroform:Isoamyl Alcohol (25:24:1) | ThermoFischer Scientific, Invitrogen, Karlsruhe, Germany | 15593-031 | |
Chloroform | Merck, Darmstadt, Germany | 102445 | |
TURBO DNase (2 U/µl) | Thermo Scientific, Schwerte, Germany | AM2238 | |
Invitrogen UltraPure Glycogen | ThermoFischer Scientific, Invitrogen, Karlsruhe, Germany | 10-814-010 | |
Sodium acetate trihydrate | VWR, Darmstadt, Germany | 27652.232 | Prepare a 3M Sodium acetate solution with DEPC-H2O and adjust the pH to 5.2 |
2-Propanol | Merck, Darmstadt, Germany | 109634 | |
Ethanol | Merck, Darmstadt, Germany | 100983 | Prepare a 75% EtOH dilution with DEPC-H2O. |
UV/Vis-Spectrophotometre NanoDrop ND-8000 | Thermo Scientific, Schwerte, Germany | ND-8000 | |
Eppendorf Microcentrifuge (Refrigerated) | Thermo Scientific, Schwerte, Germany | 5417R | |
Experion RNA StdSens Analysis Kit | Bio-Rad Laboratories GmbH, München, Germany | 7007103 | |
Experion Automated Electrophoresis Station | Bio-Rad Laboratories GmbH, München, Germany | 7007010 | |
SuperScript III Reverse Transcriptase | Thermo Scientific, Schwerte, Germany | 18080044 | |
Oligo d(T) Primer | Integrated DNA Technologies, Leuven, Belgium | Prepare 100 µM stock solutions in DEPC-H20 and store at -20°C | |
dNTP Mixture | Takara Bio Europe/Clonetech, Saint-Germain-en-Laye, France | 4030 | Store aliquots of 25 µl at -20°C |
CFX96 Touch Real-Time PCR Detection System | Bio-Rad Laboratories GmbH, München, Germany | 1855195 | |
iQ SYBR Green Supermix | Bio-Rad Laboratories GmbH, München, Germany | 170-8882 | |
Hard-Shell PCR Plates 96-well, thin wall | Bio-Rad Laboratories GmbH, München, Germany | HSP9601 | |
Microseal 'B' Film | Bio-Rad Laboratories GmbH, München, Germany | MSB1001 | |
rp49 Forward primer | Integrated DNA Technologies, Leuven, Belgium | 5' TCCTACCAGCTTCAAGATGAC 3' | |
rp49 Reverse primer | Integrated DNA Technologies, Leuven, Belgium | 5' CACGTTGTGCACCAGGAACT 3' | |
mmp1 Forward primer | Integrated DNA Technologies, Leuven, Belgium | 5' AGGGCGACAAGTACTACAAGCTGA 3' | |
mmp1 Reverse primer | Integrated DNA Technologies, Leuven, Belgium | 5' ACGTCTTGCCGTTCTTGTAGGTGA 3' |