JoVE Journal > Genetics
Summary
Abstract
Introduction
Protocol
Results
Discussion
Disclosures
Acknowledgements
Materials
References
Automatic Translation
Please note that all translations are automatically generated. Click here for the English version.
Genetics

Een robuuste polymerase kettingreactie op basis van Cytosine-guanine-guanine Trinucleotide herhalingen in fragiele X mentale retardatie-1 gen

Published: September 16, 2019
doi:
10.3791/59963
, , , , , , , , , ,
1Central Laboratory, Bao’an Maternity and Child Health Hospital,Jinan University, 2Department of Obstetrics and Gynaecology,The Chinese University of Hong Kong, 3Shenzhen Research Institute,The Chinese University of Hong Kong, 4Department of Genetics and Metabolism,Maternal and Child Health Hospital of Guangxi Zhuang Autonomous Region, 5PerkinElmer Diagnostics, 6Department of Obstetrics and Gynecology, Bao’an Maternity and Child Health Hospital,Jinan University, 7Maternal-Fetal Medicine Institute, Bao’an Maternity and Child Health Hospital,Jinan University

Summary

Een nauwkeurige en robuuste polymerase kettinggebaseerde assay test voor het kwantificeren van Cytosine-guanine-guanine trinucleotide herhalingen in het fragiele X mentale retardatie-1 gen vergemakkelijkt de moleculaire diagnose en screening van fragiel X-syndroom en fragiele X-gerelateerde aandoeningen met kortere turn-around tijd en investering in apparatuur.

Abstract

Fragiel X-syndroom (FXS) en geassocieerde aandoeningen worden veroorzaakt door uitbreiding van de Cytosine-guanine-guanine (CGG) trinucleotide REPEAT in de 5 ‘ onvertaalde regio (UTR) van de fragiele X Mental Retardation-1 (FMR1) Gene Promoter. Conventioneel, capillaire elektroforese fragment analyse op een genetische analysator wordt gebruikt voor de dimensionering van de CGG herhalingen van FMR1, maar extra Southern blot analyse is vereist voor exacte meting wanneer het herhalingsnummer hoger is dan 200. Hier presenteren we een accurate en robuuste polymerase kettingreactie (PCR)-gebaseerde methode voor de kwantificering van de CGG-herhalingen van FMR1. De eerste stap van deze test is de PCR-versterking van de herhalings sequenties in de 5 ‘ UTR van de FMR1 -promotor met behulp van een fragiele X PCR-Kit, gevolgd door zuivering van de PCR-producten en fragment dimensionering op een microfluïdisch capillair elektroforese-instrument, en latere interpretatie van het aantal CGG herhalingen door te verwijzen naar normen met bekende herhalingen met behulp van de analyse software. Deze PCR-gebaseerde test is reproduceerbaar en kan het volledige bereik van CGG-herhalingen van FMR1 -promotors identificeren, waaronder die met een herhaald aantal van meer dan 200 (geclassificeerd als volledige mutatie), 55 tot 200 (premutatie), 46 tot 54 (intermediair) en 10 tot 45 (normaal). Het is een kosteneffectieve methode die de classificatie van de FXS en fragiele X-geassocieerde aandoeningen met robuustheid en snelle rapportage tijd vergemakkelijkt.

Introduction

Fragiele X syndroom (FXS) en fragiele X geassocieerde aandoeningen, bijvoorbeeld tremor en ataxie syndroom (FX-TAS), en primaire ovariële insufficiëntie (FX-POI) worden voornamelijk veroorzaakt door Cytosine-guanine-guanine (CGG) trinucleotide herhalings uitbreiding in de 5 ‘ onvertaalde regio (UTR) van het fragiele X Mental Retardation-1 (FMR1) gen op xq 27,31,2. De FMR1 gecodeerd eiwit (FMRP) is een poly ribosome-geassocieerde RNA-bindende proteïne dat functioneert in neuronale ontwikkeling en synaptische plasticiteit door het reguleren van alternatieve splicing, stabiliteit, en dendritische transport van mRNA of modulerende synthese van partiële postsynaptische eiwitten3,4,5,6,7.

De dynamische variatie met een CGG herhalings grootte van > 200 wordt beschreven als volledige mutatie, die de afwijkende hypermethylatie en daaropvolgende transcriptionele uitschakeling van de FMR1 Promoter8induceert. De resulterende afwezigheid of het ontbreken van het FMRP-eiwit verstoort de normale neuronale ontwikkeling en veroorzaakt FXS9, gekenmerkt door verschillende klinische symptomen, waaronder matige tot ernstige verstandelijke handicap, ontwikkelingsachterstand, hyperactieve gedragingen, slechte contacten en autistische manifestaties10,11,12. De presentatie bij vrouwelijke FXS-patiënten is over het algemeen mildere dan die bij mannen. De CGG herhalings grootte variërend van 55 tot 200 en 45 tot 54 zijn geclassificeerd als premutatie en tussenliggende status, respectievelijk. Vanwege de hoge mate van instabiliteit, breidt de CGG-herhalings grootte in een premutatie of intermediair allel vermoedelijk uit wanneer ze worden overgebracht van ouders naar nakomelingen13,14. Zo zijn dragers met premutatie allelen met een hoog risico op het krijgen van kinderen getroffen met FXS vanwege de herhaalde expansie, en in sommige gevallen kunnen intermediaire allelen hun herhalings grootte uitbreiden tot het volledige mutatie bereik van twee generaties15, 16. Bovendien geven mannetjes met premutatie ook een verhoogd risico op het ontwikkelen van Late-onset FX-tas17,18,19, terwijl premutatie vrouwtjes voorbestemd zijn voor zowel FX-tas als FX-POI20, 21,22. Onlangs is gemeld dat autistische spectrum stoornissen met vertraging in de ontwikkeling en problemen in sociaal gedrag worden gepresenteerd bij kinderen met premutatie FMR1 allelen23,24.

Om te bepalen van de exacte CGG REPEAT grootte is van groot belang voor de classificatie en voorspelling van de FXS en fragiele X-geassocieerde aandoeningen25,26. Historisch gezien is de CGG herhalings regiospecifieke polymerase kettingreactie (PCR) met fragment dimensionering plus Southern blot analyse de gouden standaard voor moleculaire profilering van de FMR1 CGG REPEAT27. Traditionele specifieke PCR is echter minder gevoelig voor grote premutaties met meer dan 100 tot 130 herhalingen en is niet in staat om volledige mutaties te versterken27,28. Bovendien kan capillaire elektroforese op een traditionele genetische analysator voor herhaalde dimensionering FMR1 PCR-producten niet detecteren met meer dan 200 CGG-herhalingen. De Southern blot-analyse maakt differentiatie mogelijk van een breder scala aan herhalings grootte, van normale tot volledige mutatie herhalings nummers, en is op grote schaal gebruikt voor het bevestigen van volledige mutaties (bij mannetjes) en het differentiëren van heterozygoot allelen met een volledige mutatie uit blijkbaar homozygoot allelen met normale herhaalde maten (bij vrouwtjes). De resolutie voor het kwantificeren van de herhalingen is echter beperkt. Nog belangrijker is dat deze stapsgewijze teststrategie arbeidsintensieve, tijdrovende en kosten ineffectief is.

Hier presenteren we een accurate en robuuste PCR-gebaseerde methode voor de kwantificering van de CGG herhalingen van FMR1. De eerste stap van deze test is de PCR-versterking van de herhalings sequenties in de 5 ‘ UTR van de FMR1 Promoter met behulp van de FRAGIELE X PCR Kit. De PCR-producten worden gezuiverd en fragment dimensionering wordt uitgevoerd op een microfluïdisch capillair elektroforese instrument, en de daaropvolgende interpretatie van het aantal CGG herhalingen met behulp van de analyse software door te verwijzen naar normen met bekende herhalingen op basis van de de reden dat de lengte van het PCR-fragment recht evenredig is aan het aantal CGG-herhalingen. Het PCR-systeem omvat reagentia die de versterking van het zeer GC-rijke trinucleotide herhalingsgebied vergemakkelijken. Deze PCR-gebaseerde test is reproduceerbaar en kan alle bereiken van CGG-herhalingen van FMR1 -promotors identificeren. Dit is een kosteneffectieve methode die een brede toepassing kan vinden in de moleculaire diagnostiek en screening van FXS en fragiele X-gerelateerde aandoeningen met minder turn-around tijd en investeringen in apparatuur en dus kan worden gebruikt in een breder spectrum van klinische Laboratoria.

Protocol

Ethische goedkeuring werd verleend door de joint Chinese University of Hong Kong-New Territories East cluster klinisch onderzoek ethiek Commissie (referentienummer: 2013,055) 1. PCR-versterking Verwijder vóór het starten de PCR-buffer mix, monster verdunningsmiddel en DNA-monsters (zowel test-als referentie-DNA) (Zie de tabel met materialen) van de-20 °c vriezer en bewaar ze gedurende 20 – 30 minuten op kamertemperatuur om te controleren of alle reagentia en DNA…

Representative Results

De dimensionerings resultaten van het vrouwelijke referentiemonster van de premutatie (NA20240, herhalings grootten van 30 en 80) en het vrouwelijke referentiemonster voor de volledige Mutatie (NA20239, herhalings grootten van 20 en 200) worden respectievelijk weergegeven in Figuur 1a en Figuur 1b. Meestal zijn twee markerings pieken (lagere marker 50 basis paren [BP] en bovenste marker 10.380 BP) opgenomen in het fragment grootte profiel. Er is meestal een prim…

Discussion

FXS is de tweede meest voorkomende oorzaak van verstandelijke beperking na trisomie 21, die bijna de helft van de X-gebonden mentale retardatie30, die ongeveer 1 bij 4.000 mannetjes en 1 in 8.000 vrouwtjes kan treffen. Nog belangrijker is dat bijna 1 op de 250 – 1000 vrouwtjes een premutatie dragen, en deze frequentie is 1 in 250 – 1600 bij mannetjes26,31,32,33. Omda…

Disclosures

The authors have nothing to disclose.

Acknowledgements

Dit onderzoek werd gesteund door subsidies van het NSFC Emergency Management project (Grant No. 81741004), de National Natural Science Foundation of China (Grant No. 81860272), het belangrijkste onderzoeksplan van de provinciale wetenschap en technologiestichting van Guangxi ( Grant No. AB16380219), de China postdoctoral Science Foundation subsidie (Grant No. 2018M630993), en de Guangxi Natural Science Foundation (Grant No. 2018GXNSFAA281067).

Materials

Agilent 2100 Bioanalyzer instrument: 0.2 mL PCR tubes Axygen PCR-02D-C
Agilent 2100 Bioanalyzer instrument: 1X TE buffer, pH 8.0, Rnase-free Ambion AM9849
Agilent 2100 Bioanalyzer instrument: 2100 Bioanalyzer instrument Agilent G2939AA
Agilent 2100 Bioanalyzer instrument: 96-well PCR Plate Thermo Fisher AB0800
Agilent 2100 Bioanalyzer instrument: Electrode cartridge Agilent Supplies equipment of the 2100 Bioanayzer instrument
Agilent 2100 Bioanalyzer instrument: IKA vortex mixer Agilent Supplies equipment of the 2100 Bioanayzer instrument
Agilent 2100 Bioanalyzer instrument: Sizing software 2100 Expert software Agilent Supplies equipment of the 2100 Bioanayzer instrument
Agilent 2100 Bioanalyzer instrument: Test chips Agilent Supplies equipment of the 2100 Bioanayzer instrument
Agilent DNA 7500 kit Agilent 5067-1506 For Fragment sizing
Agilent DNA 7500 kit: DNA 7500 Ladder (yellow cap) Agilent In kit: Agilent DNA 7500 kit (catalog number: 5067-1506)
Agilent DNA 7500 kit: DNA 7500 Markers (green cap) Agilent In kit: Agilent DNA 7500 kit (catalog number: 5067-1506)
Agilent DNA 7500 kit: DNA chips Agilent In kit: Agilent DNA 7500 kit (catalog number: 5067-1506)
Agilent DNA 7500 kit: DNA Dye Concentrate (blue cap) Agilent In kit: Agilent DNA 7500 kit (catalog number: 5067-1506)
Agilent DNA 7500 kit: DNA Gel Matrix Vial (red cap) Agilent In kit: Agilent DNA 7500 kit (catalog number: 5067-1506)
Agilent DNA 7500 kit: Electrode Cleaner Agilent In kit: Agilent DNA 7500 kit (catalog number: 5067-1506)
Agilent DNA 7500 kit: Spin Filter Agilent Supplies of Agilent DNA 7500 kit (catalog number: 5067-1506)
Agilent DNA 7500 kit: Syringe Agilent Supplies of Agilent DNA 7500 kit (catalog number: 5067-1506)
Chip priming station Agilent 5065-4401 Supplies equipment of the 2100 Bioanayzer instrument
Cubee Mini-centrifuge GeneReach aqbd-i
Filter plate vacuum Manifold: MultiScreenHTS Vacuum Manifold Merck Millipore MSVMHTS00 Vacuum instrument for Filter plate vacuum Manifold for PCR product purification
Filter plate vacuum Manifold: Silicone stopper Merck Millipore XX2004718 Filter plate vacuum Manifold
Filter plate vacuum Manifold: Vacuum pump Merck Millipore WP6122050 Filter plate vacuum Manifold
Filter plate vacuum Manifold: Waste collection vessel Merck Millipore XX1004705 Filter plate vacuum Manifold
FragilEase Fragile X PCR kit PerkinElmer 3101-0010 For PCR amplification
FragilEase Fragile X PCR kit: Sample Diluent PerkinElmer In kit: FragilEase Fragile X PCR kit (catalog number: 3101-0010 )
FragilEase PCR Buffer mix PerkinElmer In kit: FragilEase Fragile X PCR kit (catalog number: 3101-0010 ), containing primers. Primer sequences: TCAGGCGCTCAGCTCCGTTTCGGTTTCA (forward)
FAM-AAGCGCCATTGGAGCCCCGCACTTCC (reverse)
FragilEase Polymerase PerkinElmer In kit: FragilEase Fragile X PCR kit (catalog number: 3101-0010 )
FraXsoft analysis software PerkinElmer
NanoDrop ND-2000 Spectrophotometer Thermo Fisher
Paper towels
PCR clean up plate: NucleoFast 96 PCR plate MACHEREY-NAGEL 743100
reference DNA sample Coriell NA20240 & NA20239
S1000 96-well Thermal Cycler Bio-Rad 1852196 This can be replaced by other Thermal Cyclers (eg. Veriti™ 96-Well Thermal Cycler, Applied Biosystems, catalog number: 4375786)
TriNEST Incubator/Shaker instrument PerkinElmer 1296-0050
UltraPure DNase/RNase-Free Distilled Water Life Technologies 10977015 For 2100 Bioanalyzer electrode cleaning
Vortex-Genie 2 Scientific Industries SI-0256 (Model G560E) Conventional vortex mixer
DOWNLOAD MATERIALS LIST

References

  1. Verkerk, A. J., et al. Identification of a gene (FMR-1) containing a CGG repeat coincident with a breakpoint cluster region exhibiting length variation in fragile X syndrome. Cell. 65, 905-914 (1991).
  2. Fu, Y. H., et al. Variation of the CGG repeat at the fragile X site results in genetic instability: resolution of the Sherman paradox. Cell. 67, 1047-1058 (1991).
  3. Antar, L. N., Li, C., Zhang, H., Carroll, R. C., Bassell, G. J. Local functions for FMRP in axon growth cone motility and activity-dependent regulation of filopodia and spine synapses. Molecular and Cellular Neurosciences. 32, 37-48 (2006).
  4. Didiot, M. C., et al. The G-quartet containing FMRP binding site in FMR1 mRNA is a potent exonic splicing enhancer. Nucleic Acids Research. 36, 4902-4912 (2008).
  5. Bechara, E. G., et al. A novel function for fragile X mental retardation protein in translational activation. PLoS Biology. 7, e16 (2009).
  6. Ascano, M., et al. FMRP targets distinct mRNA sequence elements to regulate protein expression. Nature. 492, 382-386 (2012).
  7. Kenny, P. J., et al. MOV10 and FMRP regulate AGO2 association with microRNA recognition elements. Cell Reports. 9, 1729-1741 (2014).
  8. Oberle, I., et al. Instability of a 550-base pair DNA segment and abnormal methylation in fragile X syndrome. Science. 252, 1097-1102 (1991).
  9. Hagerman, R., Lauterborn, J., Au, J., Berry-Kravis, E. Fragile X syndrome and targeted treatment trials. Results and Problems in Cell Differentiation. 54, 297-335 (2012).
  10. Hatton, D. D., et al. Autistic behavior in children with fragile X syndrome: prevalence, stability, and the impact of FMRP. American Journal of Medical Genetics Part A. 140A, 1804-1813 (2006).
  11. Mattei, J. F., Mattei, M. G., Aumeras, C., Auger, M., Giraud, F. X-linked mental retardation with the fragile X. A study of 15 families. Human Genetics. 59, 281-289 (1981).
  12. Backes, M., et al. Cognitive and behavioral profile of fragile X boys: correlations to molecular data. American Journal of Medical Genetics. 95, 150-156 (2000).
  13. Nolin, S. L., et al. Fragile X analysis of 1112 prenatal samples from 1991 to 2010. Prenatal Diagnosis. 31, 925-931 (2011).
  14. Nolin, S. L., et al. Expansion of the fragile X CGG repeat in females with premutation or intermediate alleles. American Journal of Human Genetics. 72, 454-464 (2003).
  15. Fernandez-Carvajal, I., et al. Expansion of an FMR1 grey-zone allele to a full mutation in two generations. Journal of Molecular Diagnostics. 11, 306-310 (2009).
  16. Terracciano, A., et al. Expansion to full mutation of a FMR1 intermediate allele over two generations. European Journal of Human Genetics. 12, 333-336 (2004).
  17. Garcia-Arocena, D., Hagerman, P. J. Advances in understanding the molecular basis of FXTAS. Human Molecular Genetics. 19, R83-R89 (2010).
  18. Juncos, J. L., et al. New clinical findings in the fragile X-associated tremor ataxia syndrome (FXTAS). Neurogenetics. 12, 123-135 (2011).
  19. Hagerman, R. J., et al. Intention tremor, parkinsonism, and generalized brain atrophy in male carriers of fragile X. Neurology. 57, 127-130 (2001).
  20. Conway, G. S. Premature ovarian failure and FMR1 gene mutations: an update. Annales d’endocrinologie. 71, 215-217 (2010).
  21. Conway, G. S., Hettiarachchi, S., Murray, A., Jacobs, P. A. Fragile X premutations in familial premature ovarian failure. Lancet. 346, 309-310 (1995).
  22. Van Esch, H., Buekenhout, L., Race, V., Matthijs, G. Very early premature ovarian failure in two sisters compound heterozygous for the FMR1 premutation. European Journal of Medical Genetics. 52, 37-40 (2009).
  23. Bourgeois, J. A., et al. A review of fragile X premutation disorders: expanding the psychiatric perspective. Journal of Clinical Psychiatry. 70, 852-862 (2009).
  24. Farzin, F., et al. Autism spectrum disorders and attention-deficit/hyperactivity disorder in boys with the fragile X premutation. Journal of Developmental and Behavioral Pediatrics. 27, S137-S144 (2006).
  25. Hantash, F. M., et al. FMR1 premutation carrier frequency in patients undergoing routine population-based carrier screening: insights into the prevalence of fragile X syndrome, fragile X-associated tremor/ataxia syndrome, and fragile X-associated primary ovarian insufficiency in the United States. Genetics in Medicine. 13, 39-45 (2011).
  26. Kraan, C. M., et al. FMR1 allele size distribution in 35,000 males and females: a comparison of developmental delay and general population cohorts. Genetics in Medicine. 20 (12), 1627-1634 (2018).
  27. Saul, R. A., Tarleton, J. C. FMR1-Related Disorders. GeneReviews. , (2012).
  28. Amos Wilson, J., et al. Consensus characterization of 16 FMR1 reference materials: a consortium study. Journal of Molecular Diagnostics. 10, 2-12 (2008).
  29. Kwok, Y. K., et al. Validation of a robust PCR-based assay for quantifying fragile X CGG repeats. Clinica Chimica Acta. 456, 137-143 (2016).
  30. Rousseau, F., Rouillard, P., Morel, M. L., Khandjian, E. W., Morgan, K. Prevalence of carriers of premutation-size alleles of the FMRI gene–and implications for the population genetics of the fragile X syndrome. American Journal of Human Genetics. 57, 1006-1018 (1995).
  31. Tassone, F., et al. FMR1 CGG allele size and prevalence ascertained through newborn screening in the United States. Genome Medicine. 4, 100 (2012).
  32. Dombrowski, C., et al. Premutation and intermediate-size FMR1 alleles in 10572 males from the general population: loss of an AGG interruption is a late event in the generation of fragile X syndrome alleles. Human Molecular Genetics. 11, 371-378 (2002).
  33. Cronister, A., Teicher, J., Rohlfs, E. M., Donnenfeld, A., Hallam, S. Prevalence and instability of fragile X alleles: implications for offering fragile X prenatal diagnosis. Obstetrics and Gynecology. 111, 596-601 (2008).
  34. Hayward, B. E., Kumari, D., Usdin, K. Recent advances in assays for the fragile X-related disorders. Human Genetics. 136, 1313-1327 (2017).
  35. Seltzer, M. M., et al. Prevalence of CGG expansions of the FMR1 gene in a US population-based sample. American Journal of Medical Genetics Part B Neuropsychiatrics Genetics. 259B, 589-597 (2012).
  36. Hayward, B. E., Usdin, K. Assays for determining repeat number, methylation status, and AGG interruptions in the Fragile X-related disorders. Methods in Molecular Biology. , 49-59 (1942).
  37. Orrico, A., et al. Mosaicism for full mutation and normal-sized allele of the FMR1 gene: a new case. American Journal of Medical Genetics. 78, 341-344 (1998).
  38. Schmucker, B., Seidel, J. Mosaicism for a full mutation and a normal size allele in two fragile X males. American Journal of Medical Genetics. 84, 221-225 (1999).

Tags

PCR AssayFragile X Mental Retardation-1 GeneCGG Trinucleotide RepeatsMolecular DiagnosisFragile X SyndromeFragile X-related DisordersCost-effectiveRapid ReportingDNA Sample PreparationPCR Master MixPCR Cleanup
check_url/59963?article_type=t

Play Video
PDF
DOI
DOWNLOAD MATERIALS LIST
Cite This Article
Wang, H., Zhu, X., Gui, B., Cheung, W. C., Shi, M., Yang, Z., Kwok, K. Y., Lim, R., Pietilä, S., Zhu, Y., Choy, K. W. A Robust Polymerase Chain Reaction-based Assay for Quantifying Cytosine-guanine-guanine Trinucleotide Repeats in Fragile X Mental Retardation-1 Gene. J. Vis. Exp. (151), e59963, doi:10.3791/59963 (2019).
Download Citation
Reprints and Permissions

View Video

✖

To prove you're not a robot, please enter the text in the image below

CAPTCHA Image
Play CAPTCHA Audio
Refresh Image