소 난모세포에서 미토콘드리아 DNA를 감소시키기 위한 Bisection의 사용
Summary
여기에서, 소 난모세포에서 미토콘드리아 DNA 카피 수를 유의하게 감소시키기 위한 프로토콜을 제시한다(P< 0.0001). 이 방법은 원심분리 및 이절제를 사용하여 난모세포 미토콘드리아를 실질적으로 감소시키고 재구성 된 종간 체세포 핵 전달 배아에서 발달 가능성을 높일 수 있습니다.
Abstract
종간 체세포 핵 전이 (iSCNT)는 멸종 위기에 처한 종을 구출하는 데 사용될 수 있지만, 재구성 된 배아 내에 미토콘드리아 DNA (mtDNA)의 두 개의 별개의 집단이 존재합니다 : 하나는 수용자 ooplasm 내에, 다른 하나는 공여자 체세포 내에 있습니다. 이 미토콘드리아 헤테로 플라스마는 배아와 태아의 발달 문제를 일으킬 수 있습니다. 수제 클로닝 프로토콜은 난모세포 이절편을 포함하며, 이는 재구성된 배아에서 mtDNA 카피 수를 감소시키고, 미토콘드리아 헤테로플라스마의 정도를 감소시키는데 사용될 수 있다. 뾰족하고 성숙한 소 난모세포의 원심분리는 난모세포의 한 극에서 눈에 보이는 미토콘드리아 밀도 분획을 생성하였다. 난모세포의 zonae pellucidae는 프로나제 용액에 노출됨으로써 제거되었다. 바이섹션은 가시적인 미토콘드리아 분획을 제거하기 위해 마이크로블레이드를 사용하여 수행되었다. qPCR을 사용하여 전체 난모세포 및 이등분된 ooplasts로부터 추출된 DNA 샘플에 존재하는 mtDNA를 정량화하여, 절제 전후의 mtDNA 카피 수의 비교를 제공하였다. 카피 숫자는 사이클 역치, 표준 곡선의 회귀선 공식, 및 mtDNA PCR 산물 및 게놈 PCR 산물의 각각의 크기를 포함하는 비율을 사용하여 계산하였다. 하나의 소 난모세포는 137,904 ± 94,768 (n = 38)의 평균 mtDNA 카피 수 (± 표준 편차)를 가졌다. 미토콘드리아-고갈된 ooplast의 평균 mtDNA 카피 수는 8,442 ± 13,806 (n = 33)이었다. 미토콘드리아가 풍부한 ooplast에 존재하는 평균 mtDNA 카피는 79,390 ± 58,526 mtDNA 카피 (n = 28)이었다. 이들 계산된 평균 사이의 차이는 원심분리 및 후속 분리가 원래의 난모세포와 비교했을 때 미토콘드리아-고갈된 ooplast에 존재하는 mtDNA 카피 수를 유의하게 감소시킬 수 있음을 나타낸다(P < 0.0001, 단방향 ANOVA에 의해 결정됨). mtDNA의 감소는 재구성 된 배아에서 미토콘드리아 헤테로 플라스마의 정도를 감소시켜야하며, 아마도 표준 배아 및 태아 발달을 촉진 할 수 있습니다. 체세포 공여체로부터의 미토콘드리아 추출물을 보충하는 것은 또한 성공적인 배아 발달을 달성하는 데 필수적일 수 있다.
Introduction
체세포 핵 전달 (SCNT)은 한 동물로부터의 enucleated 난모세포와 동일한 종의 동물로부터의 체세포의 융합을 포함한다. 대부분의 경우, 난모세포와 체세포는 같은 종에서 유래하며 출생률은 6 % 미만입니다.1. 일부 연구는 두 개의 다른 종에서 유래 체세포와 난모세포의 융합을 포함하는 종간 SCNT (iSCNT)의 사용을 포함한다. 이 연구에서 출생률은 SCNT보다 훨씬 낮습니다 – 일반적으로 1 % 1 미만입니다. 그러나, iSCNT는 멸종 위기에 처한 종을 구출하는 방법으로 사용될 수 있는 능력을 가지고 있는데, 이는 이들 동물로부터의 체세포가 그들의 생식세포보다 더 접근하기 쉽기때문이다1. iSCNT에 사용되는 수용자 난모세포는 종종 소, 돼지 및 마우스와 같은 국내 또는 일반적인 실험실 종입니다. 지금까지 이루어진 몇 가지 시도는 성공적으로 살아있는 젊음을 생산했지만, 생산 된 자손은 제네릭 동물 (수용자 난자 종과 기증자 세포 종은 동일한 속의 구성원이었다)2,3,4. 제네릭 모델 (다른 유전자에있는 동물의 난모세포 및 체세포를 활용하는)은 아직 살아있는 동물을 생산하지 않았으며, 재구성 된 배아의 대부분은 시험관 내 발달의 8-16 세포 단계에서 체포됩니다 5,6,7,8. 이 배아 발달 정지에 대한 한 가지 가능한 설명은 배아에서 미토콘드리아 이종 혈장의 발생 – 단일 세포에서 하나 이상의 미토콘드리아 DNA (mtDNA) 유형의 존재입니다. 이질형질은 배아 또는 살아있는 동물에서 발달 비효율 또는 실패와 같은 문제를 야기할 수 있다1. 병인은 또한 동물의 일생 9에서 나중에 발생할 수있습니다. 이 문제는 SCNT 자손에도 존재하지만 iSCNT 배아 내의 상호 특이적 구성 요소는 문제를 악화시킵니다.
배아 mtDNA가 두 개의 다른 종에서 유래 할 때, 대다수를 대표하는 수용자 난모세포 미토콘드리아는 공여체 세포의 핵1,10과 함께 효율적이거나 효과적으로 작동하지 않습니다. iSCNT에 사용 된 두 종 사이의 분류 적 격차가 커지면이 문제가 심화 될 수 있습니다. 제네릭 내 생산된 살아있는 자손(보스가러스 및 보스 황소 난모세포를 이용한 보스 인디쿠스 자손)뿐만 아니라 전통적인 SCNT를 통해 생산된 자손(예를 들어 난소 양자리 난모세포를 사용하는 난소 양자리 자손)은 키메라인 것으로 나타났다(두 개체로부터의 mtDNA는 이들 동물에 존재하였다 11,12,13). 그러나 그들은 제네릭 간 SCNT 배아14,15보다 훨씬 더 발전했습니다. 난모세포 미토콘드리아와 기증자 세포의 핵 사이의 정보 교환은 제네릭 배아16보다 제네릭 내 배아에서 더 성공적일 수 있다.
성숙한 소 난모세포에서 mtDNA의 양은 하나의 체세포(12)에서 발견되는 양보다 약 100배 더 크다. 이 비율을 줄이면 체세포 미토콘드리아가 재건 된 배아 내에서 증식하도록 장려하여 생산적인 미토콘드리아의 더 많은 인구가 존재할 수 있습니다16. 이것은 차례로 발달하는 배아(15)의 요구 사항을 충족시키기 위해 더 많은 에너지를 제공 할 수 있습니다. 난모세포 또는 배아의 mtDNA 카피 수를 감소시키기 위한 이전의 시도는 화학적 적용, 미세조작, 및 공여체 세포 종 16,17,18,19,20으로부터의 추가적인 미토콘드리아로 난모세포 또는 배아를 보충하는 것을 포함한다. 그러나 화학적 적용 (예 : 2′,3′-디데옥시시티딘)은 배아 발달에 이상적이지 않으며 난모세포 mtDNA 사본 수를 약18 % 줄였습니다. 미세조작에 의한 이전의 난모세포 mtDNA 감소는 난모세포의 mtDNA17의 평균 64%만을 제거하였다. 기증자 세포 미토콘드리아의 보충이 실행 가능한 옵션이 될 수 있지만, 그 사용은 아직 iSCNT 연구21 내에서 살아있는 제네릭 동물을 생산하지 못했습니다.
난모세포 mtDNA 카피 수를 줄이기 위한 이절제술의 사용은 아직 발표된 연구에서 사용되지 않았다. ooplasts를 체세포와 융합시키려는 의도로 난모세포를 이견하는 것은 수제 클로닝 (HMC)의 전제이며, 이는 전형적으로 메타상 II (MII) 난모세포로부터 극성 체내 및 메타상 플레이트를 제거하는 방법으로서 분리를 이용한다. HMC는 염소, 소, 돼지, 양 및 말 22,23,24,25,26을 포함한 여러 종에서 자손을 성공적으로 생산했지만 일반적으로 이절 전에 원심분리 단계를 포함하지 않습니다. 난모세포의 고속 원심분리를 통합하면 난모세포의 한 극에서 미토콘드리아(따라서 mtDNA)를 분리할 수 있으며, 이를 마이크로블레이드를 사용하여 미토콘드리아 밀도가 높은 분획을 제거하기 위해 이분할 수 있습니다. 두 개의 미토콘드리아-고갈된 ooplasts는 HMC의 경우와 같이 체세포와 융합되어 난모세포 종으로부터 상당히 적은 mtDNA를 포함하는 재구성된 배아를 형성할 수 있다.
우리가이 프로토콜로 대답하려고하는 질문은 덜 이질성 mtDNA를 포함하는 실행 가능한 재구성 된 배아를 생산하기 위해 소 난모세포에서 mtDNA를 줄이는 방법입니다. 이 프로토콜에서, 난모세포를 원심분리하고 이분하였다. Ooplast 및 무손상 난모세포 mtDNA 카피 수를 계산하여 소 난모세포의 mtDNA 카피 수를 감소시키는 데 있어서 이 기술의 효과를 결정하였다.
Protocol
Representative Results
Discussion
난모세포에서 mtDNA 카피 수를 줄이기 위해 이전에 사용 된 방법은 각각의 단점을 가지고 있습니다. 난모세포에서 미토콘드리아를 미세 조작 기반으로 제거하면 mtDNA 카피 수가 평균 64%27 감소합니다. 이전에 enucleation에 사용 된 독특한 방법은 작은 직경의 파스퇴르 피펫을 사용하고 미세 방울의 배지와 주변 미네랄 오일 사이의 경계에서 조나 펠루시다가없는 난모세포를 분할하는…
Disclosures
The authors have nothing to disclose.
Acknowledgements
저자들은 유타 주립 대학의 동료들, 샌디에고 동물원의 생식 과학 연구원, 그리고 Genus PLC의 Rebecca Krisher 박사에게 감사하고 싶습니다.
Materials
| 1.5 mL centrifuge tubes | Fisher Scientific | 5408129 | |
| 60 mm dish | Sigma-Aldrich | D8054 | |
| Centrifuge | Eppendorf | 5424 | |
| Cytochalasin B | Sigma-Aldrich | C6762 | |
| Fetal Bovine Serum | Sigma-Aldrich | F2442 | |
| M199 Media | Sigma-Aldrich | M4530 | |
| Mineral Oil | Sigma-Aldrich | M8410 | |
| Mini Centrifuge | SCILOGEX | D1008 | |
| mtDNA Primer: Forward (12S) | GGGCTACATTCTCTACACCAAG | ||
| mtDNA Primer: Reverse (12S) | GTGCTTCATGGCCTAATTCAAC | ||
| NanoDrop Spectrophotometer | Thermo Scientific | ND2000 | |
| Opthalmic Scalpel with Aluminum Handle | PFM Medical | 207300633 | Microblade for bisection |
| Protease/pronase | Sigma-Aldrich | P5147 | |
| QIAamp DNA Micro Kit | Qiagen | 56304 | |
| QuantStudio™ 3 – 96-Well 0.2-mL | ThermoFisher | A28567 | |
| Search plate | Fisher Scientific | FB0875711A | |
| SYBR Green qPCR Master Mix | ThermoFisher | K0221 | qPCR master mix |
| Synthetic Oviductal Fluid with HEPES (HSOF) | |||
| ThermoPlate | Tokai Hit | TPi-SMZSSX | Heating stage |
References
- Loi, P., Modlinski, J. A., Ptak, G. Interspecies somatic cell nuclear transfer: A salvage tool seeking first aid. Theriogenology. 76 (2), 217-228 (2011).
- Wani, N. A., Vettical, B. S., Hong, S. B. First cloned Bactrian camel (camelus bactrianus) calf produced by interspecies somatic cell nuclear transfer: A step towards preserving the critically endangered wild Bactrian camels. PLOS ONE. 12 (5), 0177800 (2017).
- Oh, H. J., et al. Cloning endangered gray wolves (canis lupus) from somatic cells collected postmortem. Theriogenology. 70 (4), 638-647 (2008).
- Srirattana, K., et al. Full-term development of gaur-bovine interspecies somatic cell nuclear transfer embryos: Effect of trichostatin a treatment. Cellular Reprogramming. 14 (3), 248-257 (2012).
- Kwon, D. K., et al. Blastocysts derived from adult fibroblasts of a rhesus monkey (macaca mulatta) using interspecies somatic cell nuclear transfer. Zygote. 19 (3), 199-204 (2011).
- Lee, E., et al. Production of cloned sei whale (Balaenoptera borealis) embryos by interspecies somatic cell nuclear transfer using enucleated pig oocytes. Journal of Veterinary Science. 10 (4), 285 (2009).
- Lorthongpanich, C., Laowtammathron, C., Chan, A. W., Kedutat-Cairns, M., Parnpai, R. Development of interspecies cloned monkey embryos reconstructed with bovine enucleated oocytes. Journal of Reproduction and Development. 54 (5), 306-313 (2008).
- Hong, S. G., et al. Production of transgenic canine embryos using interspecies somatic cell nuclear transfer. Zygote. 20 (1), 67-72 (2011).
- Stewart, J. B., Chinnery, P. F. The dynamics of mitochondrial DNA heteroplasmy: Implications for human health and disease. Nature Reviews Genetics. 16 (9), 530-542 (2015).
- Takeda, K. Mitochondrial DNA transmission and confounding mitochondrial influences in cloned cattle and pigs. Reproductive Medicine and Biology. 12 (2), 47-55 (2013).
- Lanza, R. P., et al. Cloning of an endangered species (Bos Gaurus) using interspecies nuclear transfer. Cloning. 2 (2), 79-90 (2000).
- Evans, M. J., et al. Mitochondrial DNA genotypes in nuclear transfer-derived cloned sheep. Nature Genetics. 23 (1), 90-93 (1999).
- Meirelles, F. V., et al. Complete replacement of the mitochondrial genotype in a Bos indicus calf reconstructed by nuclear transfer to a Bos taurus oocyte. Genetics. 158 (1), 351-356 (2001).
- Beyhan, Z., Iager, A. E., Cibelli, J. B. Interspecies nuclear transfer: Implications for embryonic stem cell biology. Cell Stem Cell. 1 (5), 502-512 (2007).
- Lagutina, I., Fulka, H., Lazzari, G., Galli, C. Interspecies somatic cell nuclear transfer: advancements and problems. Cellular Reprogramming. 15 (5), 374-384 (2013).
- Jiang, Y., et al. Interspecies somatic cell nuclear transfer is dependent on compatible mitochondrial DNA and reprogramming factors. PLoS ONE. 6 (4), 14805 (2011).
- Chiaratti, M. R., et al. Embryo mitochondrial DNA depletion is reversed during early embryogenesis in cattle. Biology of Reproduction. 82 (1), 76-85 (2010).
- Spikings, E. C., Alderson, J., John, J. C. Regulated mitochondrial DNA replication during oocyte maturation is essential for successful porcine embryonic development. Biology of Reproduction. 76 (2), 327-335 (2007).
- Cagnone, G. L., et al. Restoration of normal embryogenesis by mitochondrial supplementation in pig oocytes exhibiting mitochondrial DNA deficiency. Scientific Reports. 6 (1), 1-15 (2016).
- Spikings, E. C., Alderson, J., John, J. C. Regulated mitochondrial DNA replication during oocyte maturation is essential for successful porcine embryonic development. Biology of Reproduction. 76 (2), 327-335 (2007).
- Ferreira, A. F., et al. Does supplementation with mitochondria improve oocyte competence? A systematic review. Reproduction. 161 (3), 269-287 (2021).
- Bhat, M. H., et al. Live birth of a pashmina goat kid after transfer of handmade cloned embryos. Journal of Reproduction and Development. , (2019).
- Tecirlioglu, R. T., et al. Birth of a cloned calf derived from a vitrified hand-made cloned embryo. Reproduction, Fertility and Development. 15 (7), 361 (2003).
- Zhang, P., et al. Handmade cloned transgenic piglets expressing the nematode fat-1 gene. Cellular Reprogramming. 14 (3), 258-266 (2012).
- Zhang, P., et al. Handmade cloned transgenic sheep rich in omega-3 fatty acids. PLOS ONE. 8 (2), 55941 (2013).
- Lagutina, I., et al. Somatic cell nuclear transfer in horses: Effect of oocyte morphology, embryo reconstruction method and donor cell type. Reproduction. 130 (4), 559-567 (2005).
- Chiaratti, M. R., et al. Embryo mitochondrial DNA depletion is reversed during early embryogenesis in cattle. Biology of Reproduction. 82 (1), 76-85 (2010).
- Hosseini, S. M., et al. and efficient method of manual oocyte enucleation using a pulled pasteur pipette. In Vitro Cellular and Developmental Biology – Animal. 49 (8), 569-575 (2013).
- Zampolla, T., Spikings, E., Rawson, D., Zhang, T. Cytoskeleton proteins F-actin and tubulin distribution and interaction with mitochondria in the granulosa cells surrounding stage III zebrafish (danio rerio) oocytes. Theriogenology. 76 (6), 1110-1119 (2011).
- International Union for Conservation of Nature. The IUCN Red List of Threatened Species. International Union for Conservation of Nature. , (2021).
- Berg, D. K., Li, C., Asher, G., Wells, D. N., Oback, B. Red deer cloned from antler stem cells and their differentiated progeny. Biology of Reproduction. 77 (3), 384-394 (2007).
- Gómez, M. C., et al. Birth of African wildcat cloned kittens born from domestic cats. Cloning and Stem Cells. 6 (3), 247-258 (2004).
- Lanza, R. P., et al. Cloning of an endangered species (Bos gaurus) using interspecies nuclear transfer. Cloning. 2 (2), 79-90 (2000).
