VIGS-Mediated Forward Genetics Screening for Identification of Genes Involved in Nonhost Resistance

Summary

Virus-induced gene silencing is an useful tool for identifying genes involved in nonhost resistance of plants. We demonstrate the use of bacterial pathogens expressing GFPuv in identifying gene silenced plants susceptible to nonhost pathogens. This approach is easy, fast and facilitates large scale screening and similar protocol can be applied to studying various other plant-microbe interactions.

Abstract

Nonhost disease resistance of plants against bacterial pathogens is controlled by complex defense pathways. Understanding this mechanism is important for developing durable disease-resistant plants against wide range of pathogens. Virus-induced gene silencing (VIGS)-based forward genetics screening is a useful approach for identification of plant defense genes imparting nonhost resistance. Tobacco rattle virus (TRV)-based VIGS vector is the most efficient VIGS vector to date and has been efficiently used to silence endogenous target genes in Nicotiana benthamiana.

In this manuscript, we demonstrate a forward genetics screening approach for silencing of individual clones from a cDNA library in N. benthamiana and assessing the response of gene silenced plants for compromised nonhost resistance against nonhost pathogens, Pseudomonas syringae pv. tomato T1, P. syringae pv. glycinea, and X. campestris pv. vesicatoria. These bacterial pathogens are engineered to express GFPuv protein and their green fluorescing colonies can be seen by naked eye under UV light in the nonhost pathogen inoculated plants if the silenced target gene is involved in imparting nonhost resistance. This facilitates reliable and faster identification of gene silenced plants susceptible to nonhost pathogens. Further, promising candidate gene information can be known by sequencing the plant gene insert in TRV vector. Here we demonstrate the high throughput capability of VIGS-mediated forward genetics to identify genes involved in nonhost resistance. Approximately, 100 cDNAs can be individually silenced in about two to three weeks and their relevance in nonhost resistance against several nonhost bacterial pathogens can be studied in a week thereafter. In this manuscript, we enumerate the detailed steps involved in this screening. VIGS-mediated forward genetics screening approach can be extended not only to identifying genes involved in nonhost resistance but also to studying genes imparting several biotic and abiotic stress tolerances in various plant species.

Introduction

Nonhost resistance is the resistance of all plant species against races of a particular pathogen^1,2. This imparts broad spectrum and durable disease resistance in plants^2,3. However, its mechanism, particularly against bacterial pathogens, is not well understood⁴. Screening for mutants or silenced plants that compromise nonhost resistance, and high throughput transcript profiling for identification of differentially expressed genes during nonhost resistance^5-9 are two major approaches previously used for dissecting bacterial nonhost resistance. Because nonhost resistance is controlled by a complex mechanism(s)⁴ with the involvement of many genes, a high throughput functional genomic approach for gene identification is critical for better understanding the nonhost resistance mechanism(s).

Virus-induced gene silencing (VIGS) has been successfully used to silence endogenous plant genes in many plant species^10,11. Nicotiana benthamiana is one of the best suited plants for VIGS^10,12 and its draft genome sequence is now available¹³. Tobacco rattle virus (TRV)-based VIGS has been widely used as reverse genetics tool to characterize genes involved in nonhost resistance^2,4,14. This VIGS vectors and derivatives are now available through Arabidopsis Biological Resource Center (ABRC, http://www.arabidopsis.org/abrc/catalog/individ_cloned_gene_1.html). VIGS has also been used as a forward genetics tool for identifying genes involved in plant immunity^15-17, especially nonhost resistance^6,18. Assessing hypersensitive response (HR)-mediated cell death induced by plants against a specific nonhost pathogen and assessing the disease induced cell death are two major assays mainly used for identifying susceptible gene silenced plants. However, HR cell death is induced only against type-II nonhost pathogens and not against the type-I nonhost pathogens². Hence, HR assays cannot be universally used to identify nonhost resistance strategies used by plants, especially against wide range of type-I nonhost pathogens. Also, partial loss of nonhost resistance in a gene silenced plant does not always lead to disease symptoms⁶ and hence disease scoring cannot be used for identifying plants compromising nonhost resistance. In contrary, assessing the growth of nonhost pathogens in the gene silenced plants is a better method for studying the loss of nonhost resistance in gene silenced plants.

Compared to conventional growth assay^6,19, a faster method for assessing nonhost bacterial growth on the gene silenced plants can shorten the time required for forward genetics screening. We earlier reported a method for observing bacterial pathogen growth on leaves by naked eye under ultraviolet (UV) light using bacteria expressing green fluorescent protein (GFP)¹⁹. In this manuscript we demonstrate the usefulness of GFPuv expressing nonhost bacterial pathogens for easy identification of gene silenced plants that are compromised for nonhost resistance. This methodology is accurate for identification of susceptible plants and amenable for high throughput screening.

Protocol

1. Plant Growth and Target Gene Silencing Plant growth conditions: Sow N. benthamiana seeds on soil-less potting mixture, Metro-Mix 350 and germinate the seeds in a growth chamber. Any other soil or soil-less medium can also be used instead of Metro-Mix. Transplant three-week old seedlings into individual pots and grow them in a greenhouse maintained at 21±2 °C along with other growth conditions as detailed in previous literature12. Two t…

Representative Results

Major aim of this study is to demonstrate a method for easy and accurate identification of gene silenced N. benthamiana plants that are compromised for nonhost resistance. There are four major steps in this methodology. First step is to individually silence large number of genes using TRV-VIGS. We had silenced about 5,000 genes6,18 over a period of about 1.5 years using the protocol depicted in Figure 1. Some of the gene silenced plants showed various phenotypic alterations includin…

Discussion

Plant immunity limits the growth of nonhost pathogens and hence, little or no green fluorescence is emitted from vector control plant leaves inoculated with nonhost pathogen under long wavelength UV light (Figure 3D). However, when a gene involved in nonhost resistance is silenced, the gene silenced plants favor the growth of nonhost pathogen and green fluorescence is seen (Figure 3E). This is the basic principle involved in the method described in this manuscript. This methodology has…

Materials

Name of the reagent/equipment	Company	Catalogue number	Comments (optional)
96-well U-bottom plates	Becton Dickinson Labware (Franklin Lakes, NJ, USA)	35-3077
96-pin replicator stainless steel	Nalge Nunc International (Naperville, IL, USA)	250520
High Intensity UV Inspection Lamps, Model B-100ap	Thomas scientific (Swedesboro, NJ, USA)	6283K50	Manufacturer ID 95-0127-01
Stuart SC6 colony counter	Bibby Scientific Limited, Staffordshire, UK	SC6PLUS
Soil-less potting mixture, Metro-Mix 350	SUNGRO Horticulture Distribution, Inc., (Bellevue, WA, USA)
Primers: attB1 (GGGGACAAGTTTGTACAAAAAAGCAGGCT) attB2 (GGGGACCACTTTGTACAAGAAAGCTGGGT)	Integrated DNA Technologies, Inc (Coralville, IA, USA)	Custom synthesized
MES, Monohydrate	VWR international (Radnor, PA, USA)	CAS No. 145224-94-8
Acetosyringone (Dimethoxy-4′-hydroxyacetophenone)	Sigma Aldrich (St. Louis, MO, USA)	D134406
Vac-In-Stuff (Silwet L-77)	Lehle Seeds (Round Rock, TX, USA)	VIS-30