유전자의 식별을위한 VIGS - 중재 앞으로 유전학 검사는 Nonhost 저항에 참여
Summary
바이러스에 의한 유전자 침묵은 식물의 nonhost 저항성에 관련된 유전자를 식별하기위한 유용한 도구입니다. 우리는 nonhost 병원균에 감염 유전자 침묵 식물을 식별 GFPuv을 표현 세균성 병원체의 사용을 보여줍니다. 이 방법은 빠르고, 간단하고 대규모 검사와 유사한 프로토콜이 다양한 식물 미생물 상호 작용을 연구에 적용 할 수있는 용이하게합니다.
Abstract
세균성 병원균에 대한 식물의 Nonhost 질병 저항은 복잡한 방어 경로에 의해 제어됩니다. 이 메커니즘을 이해하는 것은 병원균의 넓은 범위에 대한 내구성이 질병 저항성 식물 개발을위한 중요합니다. 바이러스에 의한 유전자 침묵 (VIGS) 기반의 앞으로 유전학 검사는 nonhost 저항을 부여 식물의 방어 유전자의 식별을위한 유용한 방법입니다. 담배 딸랑이 바이러스 (TRV) 기반 VIGS 벡터 날짜에 가장 효율적인 VIGS 벡터이며가 효율적으로 사용되었습니다 은 Nicotiana benthamiana에서 내생 대상 유전자를 침묵합니다.
이 논문에서, 우리는 N.에서의 cDNA 라이브러리에서 개별 클론의 침묵에 대해 앞으로 유전학 검사 방식을 보여 benthamiana와 nonhost 병원균에 대한 노출 nonhost 저항을 유전자 침묵 식물의 반응을 평가, 모나스 syringae pv를. 토마토 T1, P. syringae pv를. GLYCinea, 그리고 X. campestris pv를. vesicatoria. 이러한 세균성 병원균 표현 GFPuv 단백질을 설계하고 침묵 표적 유전자가 nonhost 저항을 부여에 관여하는 경우 그들의 녹색 형광 식민지가 nonhost 병원균 접종 공장에서 UV 빛의 밑에 육안으로 볼 수 있습니다. 이 nonhost 병원균에 감염 유전자 침묵 식물의 믿을 수있는 빠른 식별을 용이하게합니다. 또한, 유망 후보 유전자 정보는 TRV 벡터 식물 유전자 삽입 순서에 의해 알 수있다. 여기에 우리가 nonhost 저항성에 관련된 유전자를 식별하는 VIGS 매개 앞으로 유전학의 높은 처리 능력을 보여줍니다. 약 100 cDNA를 개별적 이후 주에서 공부 할 수있는 약 2~3주 여러 nonhost 세균성 병원균에 대한 nonhost 저항의 관련성에 침묵 할 수 있습니다. 이 논문에서, 우리는이 검사에 관련된 자세한 단계를 열거합니다. VIGS 매개 앞으로 유전학 screeniNG 접근 방식은 nonhost 저항에 관여 식별 유전자뿐만 아니라 다양한 식물 종의 다양한 생물과 비 생물 적 스트레스 공차를 부여 유전자를 공부하는뿐만 아니라 확장 할 수 있습니다.
Introduction
Nonhost 저항은 특정 병원체 1,2 인종에 대한 모든 식물 종의 저항이다. 이 넓은 스펙트럼과 식물 2,3 튼튼한 질병 저항을 부여. 그러나 특히 세균성 병원균에 대한 기전은 잘 4 이해되지 않습니다. 타협 nonhost 저항 및 nonhost 저항 5-9시 차등 발현 유전자의 식별을위한 높은 처리량 성적 프로파일은 이전 세균 nonhost 저항을 해부에 사용되는 두 가지 주요 방법임을 돌연변이 또는 침묵 식물 검사. nonhost 저항은 많은 유전자, 유전자 식별을위한 높은 처리량 기능 게놈 접근법의 참여와 복잡한 메커니즘 (들) 4에 의해 제어되기 때문에 nonhost 저항 메커니즘 (들)을보다 잘 이해 중요합니다.
바이러스에 의한 유전자 침묵 (VIGS)가 성공적으로 내생 식물 침묵하는 데 사용되었습니다많은 식물 종 10,11의 유전자.은 Nicotiana benthamiana는 VIGS 10,12하고 초안 게놈 시퀀스에 대한 가장 적합한 식물 중 하나입니다 지금 13 사용할 수 있습니다. 담배 딸랑이 바이러스 (TRV) 기반 VIGS 널리 역 유전학 도구로 사용되었다 nonhost 저항 2,4,14에 관련된 유전자의 특성을. 이 VIGS 벡터 및 파생 상품은 애기 장대 생물 자원 센터 (ABRC를 통해 지금 사용할 수 있습니다 http://www.arabidopsis.org/abrc/catalog/individ_cloned_gene_1.html ). VIGS는 식물의 면역 15-17, 특히 nonhost 저항 6,18에 관련된 유전자를 식별 앞으로 유전학 도구로 사용되었습니다. 과민 반응 (HR) 매개 특정 nonhost 병원균에 대한 식물에 의해 유도 된 세포 죽음을 평가하고 질병에 의한 세포 죽음을 평가하는 것은 주로 identifyin에 사용되는 두 가지 주요 분석입니다G 감수성 유전자는 식물을 침묵. 그러나 HR 세포의 죽음이 유일한 유형-II nonhost 병원균에 대한 유도가 아닌 타입-I nonhost 병원균 2에 대하여. 따라서, HR의 분석은 보편적 특히 타입 I nonhost 병원체의 넓은 범위에 식물에 의해 사용 nonhost 저항 전략을 파악하는 데 사용할 수 없습니다. 또한, 유전자 침묵 공장에서 nonhost 저항의 부분적인 손실이 항상 질병의 증상 6 따라서 질병 점수가 nonhost 저항을 저하 식물을 식별하는 데 사용할 수 없습니다 이어질하지 않습니다. 반면에, 유전자 침묵 식물 nonhost 병원균의 성장을 평가하는 유전자 침묵 식물 nonhost 저항의 손실을 공부하기위한 좋은 방법입니다.
기존의 성장 분석 6,19, 유전자 침묵 식물에 nonhost 박테리아의 성장을 평가하기위한 빠른 방법에 비해 앞으로 유전학 검사에 필요한 시간을 단축 할 수 있습니다. 우리는 이전에 박테리아를 관찰하는 방법을보고자외선 아래에서 육안으로 잎에 L 병원균의 성장 (UV)는 밝은 녹색 형광 단백질 (GFP) 19를 표현하는 박테리아를 사용하여. 이 논문에서 우리는 nonhost 저항을 손상하는 유전자 침묵 식물의 쉽게 식별 nonhost 세균성 병원체를 표현 GFPuv의 유용성을 보여줍니다. 이 방법은 감염 식물의 식별을위한 정확하고 높은 처리량 검사에 대한 의무이다.
Protocol
Representative Results
Discussion
식물 면역 거의 또는 전혀 녹색 형광 벡터 제어 공장에서 방출되지 않는, 따라서 nonhost 병원균의 성장을 제한하고 장파장 자외선 (그림 3D)에 따라 nonhost 병원균 접종 둡니다. 그러나 nonhost 저항에 관련된 유전자가 침묵 할 때, 유전자 침묵 식물 nonhost 병원균과 녹색 형광의 성장 (그림 3E) 볼을 선호. 이것은이 논문에 설명 된 방법에 관련된 기본 원칙이다. 이 방법은 HR-기반?…
Divulgaciones
The authors have nothing to disclose.
Acknowledgements
이 프로젝트는 사무엘 로버츠 노블 재단에 의해 후원되었다. 저자는 회원국 감사합니다. 제니 갤로 웨이와 콜린이 우수한 식물 관리를위한 Elles, 그리고 작품에 대한 양 케이티 브라운. 우리는 또한 회원국에게 감사의 말씀을 전합니다. 트리 나 코트렐, 푸자 Uppalapati, Moumita 사하구, Swetha Vinukonda이 프로토콜을 설정하는 동안 기술 지원을위한 씨 이삭 Greenhut.
Materials
| Name of the reagent/equipment | Company | Catalogue number | Comments (optional) |
| 96-well U-bottom plates | Becton Dickinson Labware (Franklin Lakes, NJ, USA) | 35-3077 | |
| 96-pin replicator stainless steel | Nalge Nunc International (Naperville, IL, USA) | 250520 | |
| High Intensity UV Inspection Lamps, Model B-100ap | Thomas scientific (Swedesboro, NJ, USA) | 6283K50 | Manufacturer ID 95-0127-01 |
| Stuart SC6 colony counter | Bibby Scientific Limited, Staffordshire, UK | SC6PLUS | |
| Soil-less potting mixture, Metro-Mix 350 | SUNGRO Horticulture Distribution, Inc., (Bellevue, WA, USA) | ||
| Primers: attB1 (GGGGACAAGTTTGTACAAAAAAGCAGGCT) attB2 (GGGGACCACTTTGTACAAGAAAGCTGGGT) |
Integrated DNA Technologies, Inc (Coralville, IA, USA) | Custom synthesized | |
| MES, Monohydrate | VWR international (Radnor, PA, USA) | CAS No. 145224-94-8 | |
| Acetosyringone (Dimethoxy-4′-hydroxyacetophenone) | Sigma Aldrich (St. Louis, MO, USA) | D134406 | |
| Vac-In-Stuff (Silwet L-77) | Lehle Seeds (Round Rock, TX, USA) | VIS-30 |
Referencias
- Heath, M. C. Nonhost resistance and nonspecific plant defenses. Currrent Opinion in Plant Biology. 3, 315-319 (2000).
- Mysore, K. S., Ryu, C. -. M. Nonhost resistance: how much do we know. Trends in Plant Science. 9, 97-104 (2004).
- Ellis, J. Insights into nonhost disease resistance: can they assist disease control in agriculture. The Plant Cell. 18, 523-528 (2006).
- Senthil-Kumar, M., Mysore, K. S. Nonhost resistance against bacterial pathogens: retrospects and prospects. Annual Review of Phytopathology. 51, (2013).
- Lu, M., Tang, X., Zhou, J. -. M. Arabidopsis NHO1 is required for general resistance against Pseudomonas bacteria. The Plant Cell. 13, 437-447 (2001).
- Rojas, C. M., et al. Glycolate oxidase plays a major role during nonhost resistance responses by modulating reactive oxygen species mediated signal transduction pathways. The Plant Cell. 24, 336-352 (2012).
- Daurelio, L. D., et al. Transcriptome analysis reveals novel genes involved in nonhost response to bacterial infection in tobacco. Journal of Plant Physiology. 168, 382-391 (2011).
- Moreau, M., et al. EDS1 contributes to nonhost resistance of Arabidopsis thaliana against Erwinia amylovora. Molecular Plant-Microbe Interactions. 25, 421-430 (2012).
- Senthil-Kumar, M., Mysore, K. S. Ornithine-delta-aminotransferase and proline dehydrogenase genes play a role in non-host disease resistance by regulating pyrroline-5-carboxylate metabolism-induced hypersensitive response. Plant, Cell & Environment. 35, 1329-1343 (2012).
- Burch-Smith, T. M., Anderson, J. C., Martin, G. B., Dinesh-Kumar, S. P. Applications and advantages of virus-induced gene silencing for gene function studies in plants. The Plant Journal. 39, 734-746 (2004).
- Senthil-Kumar, M., Mysore, K. S. New dimensions for VIGS in plant functional genomics. Trends in Plant Science. 16, 656-665 (2011).
- Senthil-Kumar, M., Mysore, K. S. Virus-induced gene silencing can persist for more than 2 years and also be transmitted to progeny seedlings in Nicotiana benthamiana and tomato. Plant Biotechnology Journal. 9, 797-806 (2011).
- Bombarely, A., et al. A draft genome sequence of Nicotiana benthamiana to enhance molecular plant-microbe biology research. Molecular Plant-Microbe Interactions. 25, 1523-1530 (2012).
- Sharma, P. C., et al. Virus-induced silencing of WIPK and SIPK genes reduces resistance to a bacterial pathogen, but has no effect on the INF1-induced hypersensitive response (HR) in Nicotiana benthamiana. Mol Gen Genomics. 269, 583-591 (2003).
- Baulcombe, D. C. Fast forward genetics based on virus-induced gene silencing. Current Opinion in Plant Biology. 2, 109-113 (1999).
- Lu, R., et al. High throughput virus-induced gene silencing implicates heat shock protein 90 in plant disease resistance. EMBO Journal. 22, 5690-5699 (2003).
- Pozo, O., Pedley, K. F., Martin, G. B. MAPKKK[alpha] is a positive regulator of cell death associated with both plant immunity and disease. EMBO Journal. 23, 3072-3082 (2004).
- Wang, K., Senthil-Kumar, M., Ryu, C. -. M., Kang, L., Mysore, K. S. Phytosterols play a key role in plant innate immunity against bacterial pathogens by regulating nutrient efflux into the apoplast. Plant Physiology. 158, 1789-1802 (2012).
- Wang, K., Kang, L., Anand, A., Lazarovits, G., Mysore, K. S. Monitoring in planta bacterial infection at both cellular and whole-plant levels using the green fluorescent protein variant GFPuv. New Phytologist. 174, 212-223 (2007).
- Ratcliff, F., Martin-Hernandez, A. M., Baulcombe, D. C. Technical Advance: Tobacco rattle virus as a vector for analysis of gene function by silencing. The Plant Journal. 25, 237-245 (2001).
- MacFarlane, S. A. Molecular biology of the tobraviruses. Journal of General Virology. 80, 2799-2807 (1999).
- Anand, A., et al. Identification and characterization of plant genes involved in Agrobacterium-mediated plant transformation by virus-induced gene silencing. Molecular Plant-Microbe Interactions. 20, 41-52 (2007).
- Liu, E., Page, J. Optimized cDNA libraries for virus-induced gene silencing (VIGS) using tobacco rattle virus. Plant Methods. 4, 5 (2008).
- Velásquez, A. C., Chakravarthy, S., Martin, G. B. Virus-induced gene silencing (VIGS) in Nicotiana benthamiana and tomato. J. Vis. Exp. (28), e1292 (2009).
- Peart, J. R., et al. Ubiquitin ligase-associated protein SGT1 is required for host and nonhost disease resistance in plants. Proceedings of the National Academy of Sciences. 99. , 99-10869 (2002).
- Oh, S. -. K., et al. Insight into Types I and II nonhost resistance using expression patterns of defense-related genes in tobacco. Planta. 223, 1101-1107 (2006).
- Senthil-Kumar, M., Mysore, K., Kodama, H., Komamine, A. RNAi and Plant Gene Function Analysis. Methods in Molecular Biology. 744, 13-25 (2011).
