지카 바이러스 복제억제제에 대한 화면에 높은 처리량 항 바이러스 적 소사
Summary
이 작품에서, 우리는 높은 처리량 선별 형식으로 Zika 바이러스 복제의 억제제를 선별하기 위하여 보충 기지를 둔 바이러스성 효소 기지를 둔 분석에서 이용된 프로토콜을 기술합니다.
Abstract
항바이러스 약물 발견은 높은 처리량 스크리닝(HTS) 형식으로 수행될 수 있는 신뢰할 수 있는 생화학 및 세포 분석을 개발해야 합니다. 플라비바이러스 비구조적(NS) 단백질은 폐막 성 망막(ER) 멤브레인상에서 공동 적으로 조립하여 복제 복합체(RC)를 형성하는 것으로 생각된다. NS3와 NS5는 RC의 가장 연구된 효소이며 바이러스 성 게놈 복제에 중요한 역할로 인해 약물 개발을위한 주요 목표를 구성합니다. NS3 프로테아제 도메인은 NS2B를 공동 인자로 요구하며, 미성숙 한 바이러스 성 폴리 단백질을 성숙한 NS 단백질로 절단하는 반면 NS5 RdRp 도메인은 RNA 복제를 담당합니다. 본명, 지카 바이러스(ZIKV) 복제억제제에 대한 대형 화합물 라이브러리를 테스트하기 위해 레플리콘 기반 스크리닝 및 효소 분석에 사용되는 프로토콜을 자세히 설명한다. Replicons는 바이러스 구조 유전자가 기자 유전자로 대체되는 포유류 세포에서 발현된 자기 복제 형유증 시스템입니다. 바이러스 RNA 복제에 대한 화합물의 억제 효과는 리포터 단백질 활성의 감소를 측정하여 쉽게 평가할 수 있다. 레플리콘 기반 검진은 레닐라 루시파라제를 리포터 유전자로 발현하는 BHK-21 ZIKV 레플리콘 세포주를 이용하여 수행하였다. 확인된 화합물의 특정 표적을 특성화하기 위해, 당사는 재조합발현 NS3 프로테아제 및 NS5 RdRp를 위한 체외 형광 계 의 애사를 확립했습니다. 바이러스 성 프로테아제의 프로테오리틱 활성은 불소 펩타이드 기질 Bz-nKRR-AMC를 사용하여 측정되었다. NS5 RdRp 신장 활성은 RNA 신장 동안 SYBR Green I의 형광 신호의 증가에 의해 직접 검출되었지만, 합성 바이오티니드 셀프 프라이밍 템플릿 3′UTR-U30(5′-biotin-U30-ACUGGAGAUCCUCUAGU-3′)을 이용하여.
Introduction
지카 바이러스(ZIKV)는 플라비바이러스속의 신흥 절지동물 매개 바이러스 로, 밀접하게 관련된 뎅기열 바이러스(DENV), 일본 뇌염 바이러스(JEV) 및 황열병 바이러스(YFV)를 포함하고 있으며, 이는 공중 보건1에지속적인 위협을 가한다. 2015-16 년 미주에서 ZIKV 발발은 신생아2,3 및 길랑 바레 증후군에서 선천성 ZIKV 관련 소두증과 같은 심각한 신경 장애와의 연관성으로 인해 브라질에서 출현 한 후 세계적인 주목을 받았다4. 감염 케이스의 수는 향후 2 년 내내 감소하더라도, ZIKV의 자가 술 모기 매개 전송은 2019년에 87개의 국가 및 영토에서 확인되었습니다, 그러므로, 전염병으로 다시 등장하는 바이러스의 잠재력을 공고히5. 현재까지 ZIKV 감염에 대한 승인된 백신이나 효과적인 약물은 없습니다.
항바이러스 약물 발견은 높은 처리량 스크리닝(HTS) 형식으로 수행될 수 있는 신뢰할 수 있는 세포 및 생화학적 분석을 개발해야 한다. Replicon 기반 스크리닝 및 바이러스 효소 기반 어약은 ZIKV1의억제제에 대한 소분자 화합물을 테스트하는 두 가지 중요한 전략이다. 플라비바이러스 비구조적(NS) 단백질은 폐막성 망막(ER) 멤브레인상에서 공동 적으로 조립하여 복제 복합체(RC)6을형성하는 것으로 생각된다. NS3와 NS5는 RC의 가장 연구된 효소이며 바이러스 성 게놈 복제에 중요한 역할로 인해 약물 개발을위한 주요 목표를 구성합니다. NS3 프로테아제 도메인은 NS2B를 공동 인자로 요구하며, 미성숙 한 바이러스 성 폴리 단백질을 성숙한 NS 단백질로 절단하는 반면 NS5 RdRp 도메인은 RNA 복제6을담당합니다.
Replicons는 바이러스 구조 유전자가 기자 유전자로 대체되는 포유류 세포에서 발현된 자기 복제 형유증 시스템입니다. 바이러스 RNA 복제에 대한 화합물의 억제 효과는 기자 단백질 활성 7의 감소를 측정하여 쉽게 평가할 수있다. 본명, 당사는 ZIKV 복제의 스크리닝 억제제에 사용되는 프로토콜을 96웰 플레이트 형식으로 설명한다. 레플리콘 계의 아세약은 우리가 최근에 개발한 BHK-21 ZIKV Rluc 레플리콘 세포주(8)를 사용하여 수행되었다. 확인된 화합물의 특정 표적을 특성화하기 위해, 당사는 형광 펩타이드 기판을 사용하여 재조합발현 NS3 프로테아제에 대한 체외 형광계 작용제를 확립하고, Bz-nKRR-AMC, 반면 NS5 RdRp우리는 합성 바이오티니드 셀프 프라이밍 템플릿 3′UTR-U30 (5′-biotin-U30-ACUGGAGAUCGAUCUCUAGU-3′)의 연신을 측정, 교재 염료 SYBR 그린 I를 사용하여.
ZIKV 프로테아제(45-96 잔류물 NS2B 의 잔류물 1-177NS3 프로테아제 도메인의 글리신 리치 링커[G4SG4])는YFV9에설명된 바와 같이, 100개의 RRp도메인의 폴리머라제(276-898)를 발현하였다. 두 효소 서열은 GenBank ALU33341.1에서 파생되었습니다. 1차 항바이러스 스크리닝으로서, 화합물은 10μM에서 시험되고 그 중 80%≥ 활동을 보여주는 사람들은 투여량 의존식으로 평가되어 효과적이거나 억제(EC50 또는 IC50)및 세포독성(CC50)농도가 발생한다. 대표적인 결과의 맥락에서, EC50 및 CC50 값NITD008, 알려진 플라비바이러스억제제(11)가레플리턴 기반 스크리닝으로부터 나타난다. 효소 적 흡사에 대해, 항균, 항진균 및 항바이러스 활성을 가진 400개의 분자로 구성된 라이브러리인 MMV/DNDi 전염병 반응 상자로부터 2개의 화합물의 IC50 값이 표시됩니다. 이 작업에 설명된 프로토콜은 다른 관련 플라비바이러스의 억제제를 검사하도록 수정될 수 있다.
Protocol
Representative Results
Discussion
본 명세서에 기재된 프로토콜은 384 또는 1536웰 형식으로 스크리닝에 쉽게 적응할 수 있다. HTS 형식으로 수행된 생화학 및/또는 세포 기반 스크리닝의 경우, 통계파라미터인 Z’인자 값은 각 판에 대해 계산되어 이러한분석(12)의민감도, 재현성 및 정확성을 보장한다. 0.5 이상의 Z의 계수 값은 레플리턴 기반 스크리닝에 예상되며 NS3 및 NS5 활동 에세이의 값은 0.7 이상이 될 것으로 예?…
Divulgaciones
The authors have nothing to disclose.
Acknowledgements
이 작품은 Fundação 드 Amparo à Pesquisa do Estado de 상파울루 (FAPESP), CEPID 교부금 2013/07600-3GO에 의해 지원되었다, RSF에 2018/05130-3 및 2016/19712-9 ASG에, 그리고 Coordenação 드 아페르페이소아멘토 드 페소알 드 니벨 슈페리어 (보조금 88887.516153/2020-00) ASG에 부여. 우리는 감사하게 말라리아 벤처에 대한 의학 (MMV, www.mmv.org) 및 방치 질환 이니셔티브 (DNDi, www.dndi.org)에 대한 그들의 지원, 전염병 응답 상자의 설계 및 화합물을 공급에 감사드립니다.
Materials
| 5'-biotin-U30- ACUGGAGAUCGAUCUCCAGU -3' | Dharmacon | – | 100 ng |
| 96-well cell culture plates | KASVI | K12-096 | |
| 96-well PCR Microplate | KASVI | K4-9610 | |
| 96-well White Flat Bottom Polystyrene High Bind Microplate | Corning | 3922 | |
| AMC (7-amine-4-methylcoumarine) | SIGMA-Aldrich | 257370 | 100 mg |
| Aprotinin from bovine lung | SIGMA-Aldrich | A1153 | 10 mg |
| ATP | JenaBioscience | NU-1010-1G | 1 g |
| Bz-nKRR-AMC | International Peptides | – | 5 mg |
| Class II Biohazard Safety Cabinet | ESCO | ||
| Diethyl pyrocarbonate | SIGMA-Aldrich | D5758 | 25 mL |
| DMSO (Dimethyl sulfoxide) | SIGMA-Aldrich | 472301 | 1 L |
| Dulbecco’s Modified Eagle Medium | GIBCO | 3760091 | |
| Fetal Bovine Serum | GIBCO | 12657-029 | 500 mL |
| G418 | SIGMA-Aldrich | A1720 | Disulfate salt |
| Glycerol | SIGMA-Aldrich | G5516 | 1 L |
| HERACELL VIOS 160i CO2 incubator | Thermo Scientific | ||
| MnCl2 tetrahydrate | SIGMA-Aldrich | 203734 | 25 g |
| MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide) | Invitrogen | M6494 | |
| NITD008 ≥98% (HPLC) | Sigma-Aldrich | SML2409 | 5 mg |
| qPCR system Mx3000P | Agilent | ||
| Renilla luciferase Assay System | PROMEGA | E2810 | |
| SpectraMax Gemini EM Fluorescence Reader | Molecular Devices | ||
| SpectraMax i3 Multi-Mode Detection Platform | Molecular Devices | ||
| SpectraMax Plus 384 Absorbance Microplate Reader | Molecular Devices | ||
| SYBR Green I | Invitrogen | S7563 | 500 µl |
| Triton X-100 | SIGMA-Aldrich | X100 | 500 mL |
| Trizma base | SIGMA-Aldrich | T1503 | 1 kg |
| Trypsin-EDTA Solution 1X | SIGMA-Aldrich | 59417-C | 100 mL |
Referencias
- Zou, J., Shi, P. Y. Strategies for Zika drug discovery. Current Opinion in Virology. 35, 19-26 (2019).
- Cugola, F. R., et al. The Brazilian Zika virus strain causes birth defects in experimental models. Nature. 534 (7606), 267-271 (2016).
- de Araújo, T. V. B., et al. Association between microcephaly, Zika virus infection, and other risk factors in Brazil: Final report of a case-control study. The Lancet Infectious Diseases. 18 (3), 328-336 (2018).
- Cao-Lormeau, V. -. M., et al. Guillain-Barré Syndrome outbreak associated with Zika virus infection in French Polynesia: a case-control study. The Lancet. 387 (10027), 1531-1539 (2016).
- Pielnaa, P., et al. Zika virus-spread, epidemiology, genome, transmission cycle, clinical manifestation, associated challenges, vaccine and antiviral drug development. Virology. 543, 34-42 (2020).
- Bollati, M., et al. Structure and functionality in flavivirus NS-proteins: Perspectives for drug design Flaviviral NS3 protein Flaviviral NS5 protein Protease Helicase Polymerase Methyltransferase Flavivirus protein structure Antivirals VIZIER Consortium. Antiviral Research. 87, 125-148 (2010).
- Fernandes, R. S., et al. Reporter replicons for antiviral drug discovery against positive single-stranded RNA viruses. Viruses. 12 (6), (2020).
- Fernandes, R. S., et al. Discovery of an imidazonaphthyridine and a riminophenazine as potent anti-Zika virus agents through a replicon-based high-throughput screening. Virus Research. 299, 198388 (2021).
- Noske, G. D., et al. Structural characterization and polymorphism analysis of the NS2B-NS3 protease from the 2017 Brazilian circulating strain of Yellow Fever virus. Biochimica et Biophysica Acta – General Subjects. 1864 (4), 129521 (2020).
- Godoy, A. S., et al. Crystal structure of Zika virus NS5 RNA-dependent RNA polymerase. Nature Communications. 8, 14764 (2017).
- Yin, Z., et al. An adenosine nucleoside inhibitor of dengue virus. Proceedings of the National Academy of Sciences. 106 (48), 20435-20439 (2009).
- Zhang, J. H., Chung, T. D. Y., Oldenburg, K. R. A simple statistical parameter for use in evaluation and validation of high throughput screening assays. Journal of Biomolecular Screening. 4 (2), 67-73 (1999).
- Brecher, M., Zhang, J., Li, H. The flavivirus protease as a target for drug discovery. Virologica Sinica. 28 (6), 326-336 (2013).
- Noble, C. G., Seh, C. C., Chao, A. T., Shi, P. Y. Ligand-bound structures of the dengue virus protease reveal the active conformation. Journal of Virology. 86 (1), 438-446 (2012).
- Chen, X., et al. Mechanisms of activation and inhibition of Zika virus NS2B-NS3 protease. Cell Research. 26 (11), 1260-1263 (2016).
- Eyer, L., Nencka, R., de Clercq, E., Seley-Radtke, K., Růžek, D. Nucleoside analogs as a rich source of antiviral agents active against arthropod-borne flaviviruses. Antiviral Chemistry and Chemotherapy. 26, (2018).
- Xie, X., et al. Zika Virus Replicons for Drug Discovery. EBioMedicine. 12, 156-160 (2016).
- Pan, K. L., Lee, J. C., Sung, H. W., Chang, T. Y., Hsu, J. T. A. Development of NS3/4A protease-based reporter assay suitable for efficiently assessing hepatitis C virus infection. Antimicrobial Agents and Chemotherapy. 53 (11), 4825-4834 (2009).
- Khumthong, R., Angsuthanasombat, C., Panyim, S., Katzenmeier, G. In Vitro Determination of Dengue Virus Type 2 NS2B-NS3 Protease Activity with Fluorescent Peptide Substrates. Journal of Biochemistry and Molecular Biology. 35 (2), (2002).
- Ulanday, G. E. L., Okamoto, K., Morita, K. Development and utility of an in vitro, fluorescence-based assay for the discovery of novel compounds against dengue 2 viral protease. Tropical Medicine and Health. 44 (1), 1-10 (2016).
- Ong, I. L. H., Yang, K. L. Recent developments in protease activity assays and sensors. Analyst. 142 (11), 1867-1881 (2017).
- Eltahla, A. A., Lackovic, K., Marquis, C., Eden, J. S., White, P. A. A fluorescence-based high-throughput screen to identify small compound inhibitors of the genotype 3a hepatitis c virus RNA polymerase. Journal of Biomolecular Screening. 18 (9), 1027-1034 (2013).
- Eydoux, C., et al. A fluorescence-based high throughput-screening assay for the SARS-CoV RNA synthesis complex. Journal of Virological Methods. 288, 114013 (2021).
- Shimizu, H., et al. Discovery of a small molecule inhibitor targeting dengue virus NS5 RNA-dependent RNA polymerase. PLoS Neglected Tropical Diseases. 13 (11), 1-21 (2019).
- Sáez-Álvarez, Y., Arias, A., del Águila, C., Agudo, R. Development of a fluorescence-based method for the rapid determination of Zika virus polymerase activity and the screening of antiviral drugs. Scientific Reports. 9 (1), 1-11 (2019).
- Kocabas, F., Turan, R. D., Aslan, G. S. Fluorometric RdRp assay with self-priming RNA. Virus Genes. 50 (3), 498-504 (2015).
- Niyomrattanakit, P., et al. A fluorescence-based alkaline phosphatase-coupled polymerase assay for identification of inhibitors of dengue virus RNA-Dependent RNA polymerase. Journal of Biomolecular Screening. 16 (2), 201-210 (2011).
- Simeonov, A., Davis, M. I. . Interference with Fluorescence and Absorbance Flow Chart Fluorescence Interferences. (Md). , 1-8 (2016).
- Genick, C. C., et al. Applications of biophysics in high- Throughput screening hit validation. Journal of Biomolecular Screening. 19 (5), 707-714 (2014).
- Smith, T. M., et al. Identifying initiation and elongation inhibitors of dengue virus RNA polymerase in a high-throughput lead-finding campaign. Journal of Biomolecular Screening. 20 (1), 153-163 (2015).
- Porecha, R., Herschlag, D. RNA radiolabeling. Methods in enzymology. 530, 255-279 (2013).
