Synthèse et caractérisation d'un promédicament Aspirin-fumarate qui inhibe l'activité de NFkB et du sein des cellules souches du cancer
Summary
This procedure will demonstrate how we synthesized and characterized the anti-NFκB and anti-cancer stem cell activity of an aspirin-fumarate prodrug.
Abstract
L'inflammation est une caractéristique du cancer qui sous-tend l'incidence et de la promotion du cancer, et la progression éventuellement à des métastases. Par conséquent, l'ajout d'un médicament anti-inflammatoire à des régiments de cancer standards peut améliorer les résultats des patients. Un tel médicament, l'aspirine (acide acétylsalicylique, ASA), a été explorée pour la chimioprévention du cancer et de l'activité anti-tumorale. Outre l'inhibition de l'axe 2-prostaglandine cyclooxygénase, les activités anti-cancéreuses de l'ASA ont également été attribués à facteur nucléaire ĸB (NFĸB) inhibition. Parce que l'utilisation de l'AAS prolongé peut causer une toxicité gastro-intestinale, une stratégie de promédicament a été mis en œuvre avec succès. Dans cette conception promédicament l'acide carboxylique est masqué de l'ASA et des pharmacophores supplémentaires sont incorporés.
Ce protocole décrit la façon dont nous avons synthétisé un promédicament aspirine fumarate, GTCpFE, et caractérisé l'inhibition de la voie NFĸB dans les cellules cancéreuses du sein et de l'atténuation du cancer de la tige en forme correcteliens, une importante phénotype NFĸB dépendant. GTCpFE inhibe efficacement la voie NFĸB dans des lignées cellulaires de cancer du sein tandis que l'AAS est dépourvue d'activité inhibitrice, ce qui indique que l'ajout à la structure du fumarate ASA contribue de manière significative à son activité. En outre, GTCpFE montre anti-cancer activité de cellules souches significative en bloquant la formation mammosphere et atténuer la CD44 associée aux cellules souches du cancer + CD24 – immunophénotypage. Ces résultats établissent une stratégie viable pour développer des médicaments anti-inflammatoires améliorés pour la chimioprévention et le traitement du cancer.
Introduction
L' inflammation est une caractéristique qui sous – tend plusieurs aspects de la tumorigenèse, tels que l' incidence et la promotion, et la progression éventuellement à des métastases 1. Dans le cancer du sein, il est en outre étayée par les observations épidémiologiques montrent que l'utilisation régulière de la non-stéroïdiens anti-inflammatoires de l'aspirine médicamenteuse classique (acide acétylsalicylique, ASA) est associée à une réduction à la fois l'incidence du cancer du sein et le risque de métastases et de la récurrence 2,3. ASA agit principalement en inhibant l' activité de la cyclooxygénase-2, qui est souvent régulé à la hausse dans le cancer du sein 4,5. Cependant, les effets anti-cancéreux d'ASA peuvent également être médiés par la suppression de facteur nucléaire kB aberrante (NFkB) de signalisation 6-8. Ceci est important car une voie de NFkB dérégulée favorise la survie des cellules tumorales, de la prolifération, la migration, l' invasion, l' angiogenèse et la résistance à la thérapie 11/09. activation de la voie NFkB est également critique pour le montageune réponse immunitaire. Par conséquent, pour un traitement anti-cancéreux, où l'inhibition de NFkB prolongée est requise, il faut tenir compte des effets secondaires néfastes impliquant une immunosuppression à long terme. Par conséquent, l'AAS peut servir comme un bon point de départ pour l'optimisation thérapeutique.
Une limitation à l' application ASA dans le traitement du cancer aux doses élevées requises pour l' inhibition de la cyclo – oxygénase 2 et de NFkB, qui sont associés à une toxicité gastro – intestinale, tels que les ulcères et les saignements de l' estomac 12,13. Toutefois, la conversion ASA en promédicament sous forme d'ester, peut réduire la toxicité gastro-intestinale de l'ASA. Afin d'améliorer davantage la puissance et / ou ajouter des fonctionnalités supplémentaires ou des éléments structuraux pharmacophores auxiliaires peuvent également être incorporés dans la conception de prodrogue ester. Un tel pharmacophore ajouté pour améliorer l' ASA puissance contre la voie NFkB est fumarate, que nous avons précédemment montré comme important pour l' inhibition de la voie NFkB 14,15.
<p class="jove_content"> Nous avons synthétisé une prodrogue aspirine-fumarate 15, GTCpFE, et émis l' hypothèse que cette molécule hybride serait sûr encore efficace contre la voie NFkB. Nous avons testé l'activité anti-NFkB dans les cellules cancéreuses du sein et de sa capacité à bloquer les cellules souches du cancer du sein (CCM) 15, qui reposent sur NFkB de signalisation pour la survie et la croissance 16-21. Nous constatons que la puissance de GTCpFE contre la voie NFkB est significativement améliorée par rapport à l' AAS 15. En outre, les blocs GTCpFE formation mammosphere et atténue la CSC marqueur de surface CD44 + CD24 – immunophénotypage, indiquant que GTCpFE est capable d'éradiquer CSCs 15. Ces résultats établissent le promédicament aspirine fumarate en tant qu'agent anti-inflammatoire efficace qui peut également cibler des cellules souches cancéreuses du sein. En termes de traitement du cancer du sein, GTCpFE peut avoir le potentiel pour traiter la maladie agressive et mortelle.Protocol
Representative Results
Discussion
In this protocol, we demonstrated the synthesis of an ASA prodrug, GTCpFE, where the fumarate pharmacophore was incorporated to improve the anti-NFĸB activity in breast cancer cells. GTCpFE is an effective NFĸB inhibitor, whereas ASA itself is not, even at much higher concentrations. The fumarate moiety has anti-inflammatory properties as shown by its ability to inhibit NFĸB signaling in a variety of cell lines and tissues14,25-29. The prodrug strategy described herein, is amendable to other mal…
Declarações
The authors have nothing to disclose.
Acknowledgements
This work was supported by grants provided by the National Institutes of Health (NIH), R01 CA200669 to JF and R01 CA121107 to GRJT, and by a postdoctoral fellowship grant from Susan G. Komen for the Cure to IK (PDF12229484).
Materials
| RPMI 1640 Red Medium | Life Technologies | 11875-093 | Warm up to 37°C before use |
| IMEM | Corning | 10-024-CV | Warm up to 37°C before use |
| DMEM / F12 Medium | ThermoFisher | 21041-025 | Warm up to 37°C before use |
| MEM NEAA 10mM 100X | Life Technologies | 11140 | |
| Penicillin Streptomycin | Life Technologies | 15140-122 | |
| L-Glutamine 100X | Life Technologies | 25030-081 | |
| Insulin | Sigma-Aldrich | I-1882 | |
| Fetal Bovine Serum | Atlanta Biologicals | S11150 | |
| Trypsin 2.5% 10X | Invitrogen | 15090046 | |
| Methyl Cellulose | Sigma | M0262 | |
| B27 Supplement 50X | Gibco | 17504-044 | |
| EGF | Gibco | PHG0311L | |
| NFκB-RE Luciferase Construct | Clontech | pGL4.32 | |
| Renilla Luciferase Construct | Promega | pGL4.70 | |
| Lipofectamine 2000 | ThermoFisher | 11668-019 | |
| Dual-Luciferase Reporter Assay | Promega | 120000032 | |
| NanoDrop Spectrophotometer | ThermoFisher | ||
| Eppendorf Mastercycler | Eppendorf | ||
| StepOne Real Time PCR System | Thermo Scientific | ||
| Eclipse Microscope | Nikon | ||
| CyAn ADP Analyzer | Beckman Coulter | ||
| QCapture Software | QImaging | ||
| Summit Software | Beckman Coulter | ||
| GraphPad Software | Prism | ||
| TRIzol | ThermoFisher | 15596-018 | |
| M-MLV Reverse Transcriptase | Invitrogen | 28025-013 | |
| 100 mM dNTP Set | Invitrogen | 10297-018 | |
| Random Hexamers | Invitrogen | 48190-011 | |
| Fast SYBR Green Master Mix | ThermoFisher | 4385612 | |
| Costar 96W, ultra low attachment | Corning | 3474 | |
| HBSS, 1X | ThermoFisher | 14025134 | |
| CD44-APC conjugated antibody | BD Pharmingen | 560990 | Store at 4°C, protect from light |
| CD24-PE antibody | BD Pharmingen | 560991 | Store at 4°C, protect from light |
| Recombinant Human TNFα | Fisher | 210TA100 | |
| CCL2 Primer Forward Sequence | AGAATCACCAGCAGCAAGTGTCC | ||
| CCL2 Primer Reverse Sequence | TCCTGAACCCACTTCTGCTTGG | ||
| ICAM1 Primer Reverse Sequence | TGACGAAGCCAGAGGTCTCAG | ||
| ICAM1 Primer Forward Sequence | AGCGTCACCTTGGCTCTAGG | ||
| TNF Primer Forward Sequence | AAGGGTGACCGACTCAGCG | ||
| TNF Primer Reverse Sequence | ATCCCAAAGTAGACCTGCCCA | ||
| 36B4 Primer Forward Sequence | GTGTTCGACAATGGCAGCAT | ||
| 36B4 Primer Reverse Sequence | GACACCCTCCAGGAAGCGA | ||
| Sodium Hydroxide | Sigma-Aldrich | S5881-500G | |
| 4-Hydroxybenzyl Alcohol | Sigma-Aldrich | 20806-10G | |
| O-Acetylsalicyloyl Chloride | Sigma-Aldrich | 165190-5G | |
| Phosphorous Pentoxide | Sigma-Aldrich | 79610-100G | |
| Ethyl Fumaroyl Chloride | Sigma-Aldrich | 669695-1G | |
| Sodium Sulfate | Sigma-Aldrich | 246980-500G | |
| 4-Dimethylaminopyridine | Sigma-Aldrich | 714844-100ML | 0.5 M in tetrahydrofuran |
| Triethylamine | Sigma-Aldrich | T0886-100ML | |
| Toluene | Sigma-Aldrich | 244511-100ML | |
| Ethyl Acetate | Sigma-Aldrich | 270989-100ML | |
| Tetrahydrofuran | Sigma-Aldrich | 401757-2L | |
| 400 MHz FT NMR spectrometer | See Bruker’s Avance User’s Manual, version 000822 for details |
Referências
- Hanahan, D., Weinberg, R. A. Hallmarks of cancer: the next generation. Cell. 144, 646-674 (2011).
- Cuzick, J., et al. Aspirin and non-steroidal anti-inflammatory drugs for cancer prevention: an international consensus statement. Lancet Oncol. 10, 501-507 (2009).
- Terry, M. B., et al. Association of frequency and duration of aspirin use and hormone receptor status with breast cancer risk. JAMA. 291, 2433-2440 (2004).
- Wang, D., Dubois, R. N. Cyclooxygenase-2: a potential target in breast cancer. Semin Oncol. 31, 64-73 (2004).
- Howe, L. R. Inflammation and breast cancer. Cyclooxygenase/prostaglandin signaling and breast cancer. Breast Cancer Res. 9. 9, 210 (2007).
- Kopp, E., Ghosh, S. Inhibition of NF-kappa B by sodium salicylate and aspirin. Science. 265, 956-959 (1994).
- Yin, M. J., Yamamoto, Y., Gaynor, R. B. The anti-inflammatory agents aspirin and salicylate inhibit the activity of I(kappa)B kinase-beta. Nature. 396, 77-80 (1998).
- Pierce, J. W., Read, M. A., Ding, H., Luscinskas, F. W., Collins, T. Salicylates inhibit I kappa B-alpha phosphorylation, endothelial-leukocyte adhesion molecule expression, and neutrophil transmigration. J Immunol. 156, 3961-3969 (1996).
- Frasor, J., El-Shennawy, L., Stender, J. D., Kastrati, I. NFkappaB affects estrogen receptor expression and activity in breast cancer through multiple mechanisms. Mol Cell Endocrinol. 418, 235-239 (2014).
- Perkins, N. D. The diverse and complex roles of NF-kappaB subunits in cancer. Nat Rev Cancer. 12, 121-132 (2012).
- DiDonato, J. A., Mercurio, F., Karin, M. NF-kappaB and the link between inflammation and cancer. Immunol Rev. 246, 379-400 (2012).
- Scarpignato, C., Hunt, R. H. Nonsteroidal antiinflammatory drug-related injury to the gastrointestinal tract: clinical picture, pathogenesis, and prevention. Gastroenterol Clin North Am. 39, 433-464 (2010).
- Sostres, C., Gargallo, C. J. Gastrointestinal lesions and complications of low-dose aspirin in the gastrointestinal tract. Best Pract Res Clin Gastroenterol. 26, 141-151 (2012).
- Kastrati, I., et al. Dimethyl Fumarate Inhibits the Nuclear Factor kappaB Pathway in Breast Cancer Cells by Covalent Modification of p65 Protein. J Biol Chem. 291, 3639-3647 (2016).
- Kastrati, I., et al. A novel aspirin prodrug inhibits NFkappaB activity and breast cancer stem cell properties. BMC Cancer. 15, 845 (2015).
- Cao, Y., Luo, J. L., Karin, M. IkappaB kinase alpha kinase activity is required for self-renewal of ErbB2/Her2-transformed mammary tumor-initiating cells. Proc Natl Acad Sci U S A. 104, 15852-15857 (2007).
- Liu, M., et al. The canonical NF-kappaB pathway governs mammary tumorigenesis in transgenic mice and tumor stem cell expansion. Cancer Res. 70, 10464-10473 (2010).
- Korkaya, H., Liu, S., Wicha, M. S. Regulation of cancer stem cells by cytokine networks: attacking cancer’s inflammatory roots. Clin Cancer Res. 17, 6125-6129 (2011).
- Hinohara, K., et al. ErbB receptor tyrosine kinase/NF-kappaB signaling controls mammosphere formation in human breast cancer. Proc Natl Acad Sci U S A. 109, 6584-6589 (2012).
- Kendellen, M. F., Bradford, J. W., Lawrence, C. L., Clark, K. S., Baldwin, A. S. Canonical and non-canonical NF-kappaB signaling promotes breast cancer tumor-initiating cells. Oncogene. 33, 1297-1305 (2014).
- Yamamoto, M., et al. NF-kappaB non-cell-autonomously regulates cancer stem cell populations in the basal-like breast cancer subtype. Nat Commun. 4, 2299 (2013).
- Rio, D. C., Ares, M., Hannon, G. J., Nilsen, T. W. Purification of RNA using TRIzol (TRI reagent). Cold Spring Harb Protoc. , (2010).
- Frasor, J., et al. Positive cross-talk between estrogen receptor and NF-kappaB in breast cancer. Cancer Res. 69, 8918-8925 (2009).
- Al-Hajj, M., Wicha, M. S., Benito-Hernandez, A., Morrison, S. J., Clarke, M. F. Prospective identification of tumorigenic breast cancer cells. Proc Natl Acad Sci U S A. 100, 3983-3988 (2003).
- Vandermeeren, M., et al. Dimethylfumarate is an inhibitor of cytokine-induced nuclear translocation of NF-kappa B1, but not RelA in normal human dermal fibroblast cells. J Invest Dermatol. 116, 124-130 (2001).
- Loewe, R., et al. Dimethylfumarate inhibits TNF-induced nuclear entry of NF-kappa B/p65 in human endothelial cells. J Immunol. 168, 4781-4787 (2002).
- Seidel, P., et al. Dimethylfumarate inhibits NF-{kappa}B function at multiple levels to limit airway smooth muscle cell cytokine secretion. Am J Physiol Lung Cell Mol Physiol. 297, L326-L339 (2009).
- Wilms, H., et al. Dimethylfumarate inhibits microglial and astrocytic inflammation by suppressing the synthesis of nitric oxide, IL-1beta, TNF-alpha and IL-6 in an in-vitro model of brain inflammation. J Neuroinflammation. 7, 30 (2010).
- Peng, H., et al. Dimethyl fumarate inhibits dendritic cell maturation via nuclear factor kappaB (NF-kappaB) and extracellular signal-regulated kinase 1 and 2 (ERK1/2) and mitogen stress-activated kinase 1 (MSK1) signaling. J Biol Chem. 287, 28017-28026 (2012).
- Li, H. J., Reinhardt, F., Herschman, H. R., Weinberg, R. A. Cancer-stimulated mesenchymal stem cells create a carcinoma stem cell niche via prostaglandin E2 signaling. Cancer Discov. 2, 840-855 (2012).
- Li, X., et al. Intrinsic resistance of tumorigenic breast cancer cells to chemotherapy. J Natl Cancer Inst. 100, 672-679 (2008).
- Diehn, M., et al. Association of reactive oxygen species levels and radioresistance in cancer stem cells. Nature. 458, 780-783 (2009).
- Hollier, B. G., Evans, K., Mani, S. A. The epithelial-to-mesenchymal transition and cancer stem cells: a coalition against cancer therapies. J Mammary Gland Biol Neoplasia. 14, 29-43 (2009).
- Velasco-Velazquez, M. A., Popov, V. M., Lisanti, M. P., Pestell, R. G. The role of breast cancer stem cells in metastasis and therapeutic implications. Am J Pathol. 179, 2-11 (2011).
- Dontu, G., et al. In vitro propagation and transcriptional profiling of human mammary stem/progenitor cells. Genes Dev. 17, 1253-1270 (2003).
- Charafe-Jauffret, E., et al. Cancer stem cells in breast: current opinion and future challenges. Pathobiology. 75, 75-84 (2008).
- Clayton, H., Titley, I., Vivanco, M. Growth and differentiation of progenitor/stem cells derived from the human mammary gland. Exp Cell Res. 297, 444-460 (2004).
- Ginestier, C., et al. ALDH1 is a marker of normal and malignant human mammary stem cells and a predictor of poor clinical outcome. Cell Stem Cell. 1, 555-567 (2007).
- Rosen, J. M., Jordan, C. T. The increasing complexity of the cancer stem cell paradigm. Science. 324, 1670-1673 (2009).
- Visvader, J. E., Lindeman, G. J. Cancer stem cells in solid tumours: accumulating evidence and unresolved questions. Nat Rev Cancer. 8, 755-768 (2008).
