Síntese e Caracterização de um pró-fármaco Aspirina-fumarato que inibe a actividade NFkB e da mama câncer de células estaminais
Summary
This procedure will demonstrate how we synthesized and characterized the anti-NFκB and anti-cancer stem cell activity of an aspirin-fumarate prodrug.
Abstract
A inflamação é uma característica marcante do câncer que está subjacente a incidência de câncer e promoção e progressão, eventualmente, para metástase. Portanto, a adição de uma droga anti-inflamatória a regimentos de câncer padrão podem melhorar o resultado paciente. Um tal medicamento, a aspirina (ácido acetilsalicílico, ASA), tem sido explorada para a quimioprevenção do cancro e actividade anti-tumoral. Além de inibir o eixo 2-prostaglandina ciclooxigenase, actividades anti-câncer da ASA também têm sido atribuídas ao fator nuclear ĸB (NFĸB) inibição. Porque o uso ASA prolongado pode causar toxicidade gastrointestinal, uma estratégia pró-fármaco foi implementado com sucesso. Neste prodroga conceber o ácido carboxílico de ASA é mascarado e farmacóforos adicionais são incorporados.
Este protocolo descreve a forma como um pró-fármaco sintetizado aspirina-fumarato, GTCpFE, e caracteriza-se a sua inibição da via NFĸB em células de cancro da mama e cancro da atenuação da haste do tipo adequadolaços, um importante fenótipo NFĸB-dependente. GTCpFE inibe eficazmente a via NFĸB em linhas celulares de cancro de mama, a ASA não possui qualquer actividade inibidora, indicando que a adição de fumarato de estrutura ASA contribui de forma significativa para a sua actividade. Além disso, GTCpFE mostra a atividade de células-tronco anti-câncer significativa, bloqueando a formação mammosphere e atenuando a CD44 associado com células-tronco do câncer + CD24 – imunofenotipagem. Estes resultados estabelecem uma estratégia viável para desenvolver melhores medicamentos anti-inflamatórios para quimioprevenção e terapia do cancro.
Introduction
A inflamação é uma característica que subjaz múltiplos aspectos da tumorigénese, tais como incidência e promoção e progressão, eventualmente, para a metástase 1. No cancro da mama, este é ainda apoiada por observações epidemiológicas que mostram que o uso regular da aspirina não-esteróides anti-inflamatórios clássica de drogas (ácido acetilsalicílico, ASA) está associada a uma redução tanto da incidência do cancro da mama, eo risco de metástases e recidiva 2,3. ASA actua principalmente por inibição da actividade da ciclo-oxigenase-2, que é frequentemente sobre-regulada no cancro da mama 4,5. No entanto, os efeitos anti-cancro de ASA pode também ser mediada por supressão aberrante factor nuclear kB (NFkB) de sinalização 6-8. Isto é importante porque uma via NFkB desregulada promove a sobrevivência de células de tumor, proliferação, migração, invasão, angiogénese, e resistência à terapia 9-11. NFkB activação da via também é crítico para a montagemuma resposta imune. Por conseguinte, para a terapia anti-cancro em que é necessária a inibição de NFkB prolongado, devem ser considerados os efeitos secundários prejudiciais que envolvem supressão imunológica de longa duração. Assim, ASA pode servir como um bom ponto de partida para otimização terapêutica.
Uma limitação para a aplicação ASA na terapia do cancro é a doses elevadas requeridas para a inibição da ciclo-oxigenase 2 e NFkB, que estão associadas com toxicidade gastrointestinal, tais como úlceras e hemorragias gástricas 12,13. No entanto, a conversão de pró-fármaco como ASA em éster, podem reduzir a toxicidade gastrointestinal do ASA. Para aumentar ainda mais a potência e / ou adicionar funcionalidade, elementos estruturais adicionais ou auxiliares farmacóforos, também podem ser incorporados na concepção éster pró-droga. Um tal farmacóforo adicionado para aumentar a potência contra o ASA via NFkB é o fumarato, que demonstraram anteriormente ser importante para a inibição da via de NFkB 14,15.
<p class="jove_content"> Nós sintetizado um pró-fármaco aspirina-fumarato 15, GTCpFE, e levantaram a hipótese de que essa molécula híbrida seria seguro ainda potente contra a via NFkB. Testamos a sua actividade anti-NFkB em células de câncer de mama e sua capacidade de bloquear as células-tronco do câncer de mama (CSCs) 15, que dependem de NFkB sinalização para a sobrevivência e crescimento 16-21. Nós descobrimos que a potência de GTCpFE contra a via NFkB é significativamente melhorado em relação ASA 15. Além disso, os blocos GTCpFE formação mammosphere e atenua a CSC marcador de superfície CD44 + CD24 – imunofenotipagem, indicando que GTCpFE é capaz de erradicar CSCs 15. Estes resultados estabelecem o pró-fármaco a aspirina-fumarato como um agente anti-inflamatório eficaz que também pode ter como alvo CSCs de mama. Em termos de terapia do cancro da mama, GTCpFE pode ter o potencial para tratar a doença agressiva e mortal.Protocol
Representative Results
Discussion
In this protocol, we demonstrated the synthesis of an ASA prodrug, GTCpFE, where the fumarate pharmacophore was incorporated to improve the anti-NFĸB activity in breast cancer cells. GTCpFE is an effective NFĸB inhibitor, whereas ASA itself is not, even at much higher concentrations. The fumarate moiety has anti-inflammatory properties as shown by its ability to inhibit NFĸB signaling in a variety of cell lines and tissues14,25-29. The prodrug strategy described herein, is amendable to other mal…
Declarações
The authors have nothing to disclose.
Acknowledgements
This work was supported by grants provided by the National Institutes of Health (NIH), R01 CA200669 to JF and R01 CA121107 to GRJT, and by a postdoctoral fellowship grant from Susan G. Komen for the Cure to IK (PDF12229484).
Materials
| RPMI 1640 Red Medium | Life Technologies | 11875-093 | Warm up to 37°C before use |
| IMEM | Corning | 10-024-CV | Warm up to 37°C before use |
| DMEM / F12 Medium | ThermoFisher | 21041-025 | Warm up to 37°C before use |
| MEM NEAA 10mM 100X | Life Technologies | 11140 | |
| Penicillin Streptomycin | Life Technologies | 15140-122 | |
| L-Glutamine 100X | Life Technologies | 25030-081 | |
| Insulin | Sigma-Aldrich | I-1882 | |
| Fetal Bovine Serum | Atlanta Biologicals | S11150 | |
| Trypsin 2.5% 10X | Invitrogen | 15090046 | |
| Methyl Cellulose | Sigma | M0262 | |
| B27 Supplement 50X | Gibco | 17504-044 | |
| EGF | Gibco | PHG0311L | |
| NFκB-RE Luciferase Construct | Clontech | pGL4.32 | |
| Renilla Luciferase Construct | Promega | pGL4.70 | |
| Lipofectamine 2000 | ThermoFisher | 11668-019 | |
| Dual-Luciferase Reporter Assay | Promega | 120000032 | |
| NanoDrop Spectrophotometer | ThermoFisher | ||
| Eppendorf Mastercycler | Eppendorf | ||
| StepOne Real Time PCR System | Thermo Scientific | ||
| Eclipse Microscope | Nikon | ||
| CyAn ADP Analyzer | Beckman Coulter | ||
| QCapture Software | QImaging | ||
| Summit Software | Beckman Coulter | ||
| GraphPad Software | Prism | ||
| TRIzol | ThermoFisher | 15596-018 | |
| M-MLV Reverse Transcriptase | Invitrogen | 28025-013 | |
| 100 mM dNTP Set | Invitrogen | 10297-018 | |
| Random Hexamers | Invitrogen | 48190-011 | |
| Fast SYBR Green Master Mix | ThermoFisher | 4385612 | |
| Costar 96W, ultra low attachment | Corning | 3474 | |
| HBSS, 1X | ThermoFisher | 14025134 | |
| CD44-APC conjugated antibody | BD Pharmingen | 560990 | Store at 4°C, protect from light |
| CD24-PE antibody | BD Pharmingen | 560991 | Store at 4°C, protect from light |
| Recombinant Human TNFα | Fisher | 210TA100 | |
| CCL2 Primer Forward Sequence | AGAATCACCAGCAGCAAGTGTCC | ||
| CCL2 Primer Reverse Sequence | TCCTGAACCCACTTCTGCTTGG | ||
| ICAM1 Primer Reverse Sequence | TGACGAAGCCAGAGGTCTCAG | ||
| ICAM1 Primer Forward Sequence | AGCGTCACCTTGGCTCTAGG | ||
| TNF Primer Forward Sequence | AAGGGTGACCGACTCAGCG | ||
| TNF Primer Reverse Sequence | ATCCCAAAGTAGACCTGCCCA | ||
| 36B4 Primer Forward Sequence | GTGTTCGACAATGGCAGCAT | ||
| 36B4 Primer Reverse Sequence | GACACCCTCCAGGAAGCGA | ||
| Sodium Hydroxide | Sigma-Aldrich | S5881-500G | |
| 4-Hydroxybenzyl Alcohol | Sigma-Aldrich | 20806-10G | |
| O-Acetylsalicyloyl Chloride | Sigma-Aldrich | 165190-5G | |
| Phosphorous Pentoxide | Sigma-Aldrich | 79610-100G | |
| Ethyl Fumaroyl Chloride | Sigma-Aldrich | 669695-1G | |
| Sodium Sulfate | Sigma-Aldrich | 246980-500G | |
| 4-Dimethylaminopyridine | Sigma-Aldrich | 714844-100ML | 0.5 M in tetrahydrofuran |
| Triethylamine | Sigma-Aldrich | T0886-100ML | |
| Toluene | Sigma-Aldrich | 244511-100ML | |
| Ethyl Acetate | Sigma-Aldrich | 270989-100ML | |
| Tetrahydrofuran | Sigma-Aldrich | 401757-2L | |
| 400 MHz FT NMR spectrometer | See Bruker’s Avance User’s Manual, version 000822 for details |
Referências
- Hanahan, D., Weinberg, R. A. Hallmarks of cancer: the next generation. Cell. 144, 646-674 (2011).
- Cuzick, J., et al. Aspirin and non-steroidal anti-inflammatory drugs for cancer prevention: an international consensus statement. Lancet Oncol. 10, 501-507 (2009).
- Terry, M. B., et al. Association of frequency and duration of aspirin use and hormone receptor status with breast cancer risk. JAMA. 291, 2433-2440 (2004).
- Wang, D., Dubois, R. N. Cyclooxygenase-2: a potential target in breast cancer. Semin Oncol. 31, 64-73 (2004).
- Howe, L. R. Inflammation and breast cancer. Cyclooxygenase/prostaglandin signaling and breast cancer. Breast Cancer Res. 9. 9, 210 (2007).
- Kopp, E., Ghosh, S. Inhibition of NF-kappa B by sodium salicylate and aspirin. Science. 265, 956-959 (1994).
- Yin, M. J., Yamamoto, Y., Gaynor, R. B. The anti-inflammatory agents aspirin and salicylate inhibit the activity of I(kappa)B kinase-beta. Nature. 396, 77-80 (1998).
- Pierce, J. W., Read, M. A., Ding, H., Luscinskas, F. W., Collins, T. Salicylates inhibit I kappa B-alpha phosphorylation, endothelial-leukocyte adhesion molecule expression, and neutrophil transmigration. J Immunol. 156, 3961-3969 (1996).
- Frasor, J., El-Shennawy, L., Stender, J. D., Kastrati, I. NFkappaB affects estrogen receptor expression and activity in breast cancer through multiple mechanisms. Mol Cell Endocrinol. 418, 235-239 (2014).
- Perkins, N. D. The diverse and complex roles of NF-kappaB subunits in cancer. Nat Rev Cancer. 12, 121-132 (2012).
- DiDonato, J. A., Mercurio, F., Karin, M. NF-kappaB and the link between inflammation and cancer. Immunol Rev. 246, 379-400 (2012).
- Scarpignato, C., Hunt, R. H. Nonsteroidal antiinflammatory drug-related injury to the gastrointestinal tract: clinical picture, pathogenesis, and prevention. Gastroenterol Clin North Am. 39, 433-464 (2010).
- Sostres, C., Gargallo, C. J. Gastrointestinal lesions and complications of low-dose aspirin in the gastrointestinal tract. Best Pract Res Clin Gastroenterol. 26, 141-151 (2012).
- Kastrati, I., et al. Dimethyl Fumarate Inhibits the Nuclear Factor kappaB Pathway in Breast Cancer Cells by Covalent Modification of p65 Protein. J Biol Chem. 291, 3639-3647 (2016).
- Kastrati, I., et al. A novel aspirin prodrug inhibits NFkappaB activity and breast cancer stem cell properties. BMC Cancer. 15, 845 (2015).
- Cao, Y., Luo, J. L., Karin, M. IkappaB kinase alpha kinase activity is required for self-renewal of ErbB2/Her2-transformed mammary tumor-initiating cells. Proc Natl Acad Sci U S A. 104, 15852-15857 (2007).
- Liu, M., et al. The canonical NF-kappaB pathway governs mammary tumorigenesis in transgenic mice and tumor stem cell expansion. Cancer Res. 70, 10464-10473 (2010).
- Korkaya, H., Liu, S., Wicha, M. S. Regulation of cancer stem cells by cytokine networks: attacking cancer’s inflammatory roots. Clin Cancer Res. 17, 6125-6129 (2011).
- Hinohara, K., et al. ErbB receptor tyrosine kinase/NF-kappaB signaling controls mammosphere formation in human breast cancer. Proc Natl Acad Sci U S A. 109, 6584-6589 (2012).
- Kendellen, M. F., Bradford, J. W., Lawrence, C. L., Clark, K. S., Baldwin, A. S. Canonical and non-canonical NF-kappaB signaling promotes breast cancer tumor-initiating cells. Oncogene. 33, 1297-1305 (2014).
- Yamamoto, M., et al. NF-kappaB non-cell-autonomously regulates cancer stem cell populations in the basal-like breast cancer subtype. Nat Commun. 4, 2299 (2013).
- Rio, D. C., Ares, M., Hannon, G. J., Nilsen, T. W. Purification of RNA using TRIzol (TRI reagent). Cold Spring Harb Protoc. , (2010).
- Frasor, J., et al. Positive cross-talk between estrogen receptor and NF-kappaB in breast cancer. Cancer Res. 69, 8918-8925 (2009).
- Al-Hajj, M., Wicha, M. S., Benito-Hernandez, A., Morrison, S. J., Clarke, M. F. Prospective identification of tumorigenic breast cancer cells. Proc Natl Acad Sci U S A. 100, 3983-3988 (2003).
- Vandermeeren, M., et al. Dimethylfumarate is an inhibitor of cytokine-induced nuclear translocation of NF-kappa B1, but not RelA in normal human dermal fibroblast cells. J Invest Dermatol. 116, 124-130 (2001).
- Loewe, R., et al. Dimethylfumarate inhibits TNF-induced nuclear entry of NF-kappa B/p65 in human endothelial cells. J Immunol. 168, 4781-4787 (2002).
- Seidel, P., et al. Dimethylfumarate inhibits NF-{kappa}B function at multiple levels to limit airway smooth muscle cell cytokine secretion. Am J Physiol Lung Cell Mol Physiol. 297, L326-L339 (2009).
- Wilms, H., et al. Dimethylfumarate inhibits microglial and astrocytic inflammation by suppressing the synthesis of nitric oxide, IL-1beta, TNF-alpha and IL-6 in an in-vitro model of brain inflammation. J Neuroinflammation. 7, 30 (2010).
- Peng, H., et al. Dimethyl fumarate inhibits dendritic cell maturation via nuclear factor kappaB (NF-kappaB) and extracellular signal-regulated kinase 1 and 2 (ERK1/2) and mitogen stress-activated kinase 1 (MSK1) signaling. J Biol Chem. 287, 28017-28026 (2012).
- Li, H. J., Reinhardt, F., Herschman, H. R., Weinberg, R. A. Cancer-stimulated mesenchymal stem cells create a carcinoma stem cell niche via prostaglandin E2 signaling. Cancer Discov. 2, 840-855 (2012).
- Li, X., et al. Intrinsic resistance of tumorigenic breast cancer cells to chemotherapy. J Natl Cancer Inst. 100, 672-679 (2008).
- Diehn, M., et al. Association of reactive oxygen species levels and radioresistance in cancer stem cells. Nature. 458, 780-783 (2009).
- Hollier, B. G., Evans, K., Mani, S. A. The epithelial-to-mesenchymal transition and cancer stem cells: a coalition against cancer therapies. J Mammary Gland Biol Neoplasia. 14, 29-43 (2009).
- Velasco-Velazquez, M. A., Popov, V. M., Lisanti, M. P., Pestell, R. G. The role of breast cancer stem cells in metastasis and therapeutic implications. Am J Pathol. 179, 2-11 (2011).
- Dontu, G., et al. In vitro propagation and transcriptional profiling of human mammary stem/progenitor cells. Genes Dev. 17, 1253-1270 (2003).
- Charafe-Jauffret, E., et al. Cancer stem cells in breast: current opinion and future challenges. Pathobiology. 75, 75-84 (2008).
- Clayton, H., Titley, I., Vivanco, M. Growth and differentiation of progenitor/stem cells derived from the human mammary gland. Exp Cell Res. 297, 444-460 (2004).
- Ginestier, C., et al. ALDH1 is a marker of normal and malignant human mammary stem cells and a predictor of poor clinical outcome. Cell Stem Cell. 1, 555-567 (2007).
- Rosen, J. M., Jordan, C. T. The increasing complexity of the cancer stem cell paradigm. Science. 324, 1670-1673 (2009).
- Visvader, J. E., Lindeman, G. J. Cancer stem cells in solid tumours: accumulating evidence and unresolved questions. Nat Rev Cancer. 8, 755-768 (2008).
