Summary

Sintesi e caratterizzazione di un profarmaco Aspirina-fumarato che inibisce NFκB attività e della mammella cellule tumorali staminali

Published: January 18, 2017
doi:

Summary

This procedure will demonstrate how we synthesized and characterized the anti-NFκB and anti-cancer stem cell activity of an aspirin-fumarate prodrug.

Abstract

L'infiammazione è un segno distintivo di cancro che sta alla base l'incidenza del cancro e la promozione, e la progressione alla fine di metastasi. Pertanto, l'aggiunta di un farmaco anti-infiammatorio per reggimenti standard per il cancro può migliorare l'esito dei pazienti. Uno di questi farmaci, l'aspirina (acido acetilsalicilico, ASA), è stato esplorato per la chemioprevenzione del cancro e l'attività anti-tumorale. Oltre inibendo la ciclossigenasi asse 2-prostaglandine, le attività anti-cancro di ASA sono anche stati attribuiti a fattore nucleare ĸB (NFĸB) inibizione. Poiché l'uso ASA prolungato può causare tossicità gastrointestinale, una strategia profarmaco è stata implementata con successo. In questo profarmaco progettare l'acido carbossilico di ASA viene mascherato e pharmacophores aggiuntivi sono incorporati.

Questo protocollo descrive come abbiamo sintetizzato un profarmaco aspirina-fumarato, GTCpFE, e caratterizzato la sua inibizione del percorso NFĸB nelle cellule di cancro al seno e attenuazione del cancro stelo-come correttacravatte, un importante fenotipo NFĸB-dipendente. GTCpFE inibisce in modo efficace il percorso NFĸB nelle linee di cellule di cancro al seno, mentre ASA è priva di qualsiasi attività inibitoria, che indica che l'aggiunta di fumarato alla struttura ASA contribuisce in modo significativo alla sua attività. Inoltre, GTCpFE mostra significativa l'attività delle cellule staminali anti-cancro, bloccando la formazione di mammosphere e attenuando la associati CD44 delle cellule staminali del cancro + CD24 immunofenotipo. Questi risultati stabiliscono una strategia praticabile per sviluppare farmaci anti-infiammatori migliorate per la chemioprevenzione e terapia del cancro.

Introduction

L'infiammazione è una caratteristica che sta alla base molteplici aspetti della tumorigenesi, come ad esempio l'incidenza e la promozione, e la progressione alla fine di metastasi 1. Nel carcinoma mammario, questo è ulteriormente supportata da osservazioni epidemiologiche mostrano che l'uso regolare della classica aspirina farmaci non steroidei anti-infiammatori (acido acetilsalicilico, ASA) è associato ad una riduzione sia del seno incidenza del cancro, e il rischio di metastasi e recidive 2,3. ASA agisce principalmente inibendo l'attività della cicloossigenasi-2, che è spesso upregulated nel cancro della mammella 4,5. Tuttavia, gli effetti anti-cancro di ASA possono essere mediati da sopprimere aberrante fattore nucleare kB (NFκB) di segnalazione 6-8. Questo è importante perché un percorso NFκB deregolamentato promuove la sopravvivenza delle cellule tumorali, la proliferazione, la migrazione, l'invasione, angiogenesi, e la resistenza alla terapia 9-11. attivazione della via NFκB è essenziale anche per il montaggiouna risposta immunitaria. Pertanto, per la terapia anti-cancro in cui è richiesta l'inibizione NFκB prolungato, si deve considerare gli effetti collaterali negativi coinvolgono duratura soppressione immunitaria. Quindi, ASA può servire come un buon punto di partenza per l'ottimizzazione terapeutica.

Una limitazione per l'applicazione ASA nella terapia del cancro è dosi elevate richieste per cicloossigenasi 2 e l'inibizione NFκB, che sono associati con la tossicità gastrointestinale, come ulcere e sanguinamento dello stomaco 12,13. Tuttavia, la conversione in ASA profarmaco come estere, può ridurre la tossicità gastrointestinale di ASA. Per migliorare ulteriormente la potenza e / o aggiungere funzionalità, elementi strutturali aggiuntive o pharmacophores accessori possono altresì essere incorporati nella progettazione estere profarmaco. Uno di questi farmacoforico aggiunto per migliorare la potenza ASA contro il percorso NFκB è fumarato, che abbiamo già dimostrato di essere importante per NFκB via inibizione 14,15.

<p class="jove_content"> Abbiamo sintetizzato un profarmaco aspirina-fumarato 15, GTCpFE, e ipotizzato che tale molecola ibrida sarebbe stato al sicuro ancora potente contro il percorso NFκB. Abbiamo testato la sua attività anti-NFκB nelle cellule di cancro al seno e la sua capacità di bloccare le cellule staminali del cancro al seno (CSC) 15, che si basano su NFκB segnalazione per la sopravvivenza e la crescita 16-21. Troviamo che la potenza del GTCpFE contro il percorso NFκB è notevolmente migliorata nel corso ASA 15. Inoltre, blocca la formazione GTCpFE mammosphere e attenua il CSC marcatore di superficie CD44 + CD24 immunofenotipo, indicando che GTCpFE è in grado di sradicare CSC 15. Questi risultati stabiliscono il profarmaco aspirina-fumarato come agente anti-infiammatorio efficace che può anche riguardare CSC seno. In termini di terapia del cancro al seno, GTCpFE potrebbe avere il potenziale per il trattamento di malattia aggressiva e letale.

Protocol

1. Sintesi di Aspirina-fumarato Prodrug GTCpFE Utilizzando una siringa stantuffo di plastica, misura 0,81 ml (20 mmoli) di metanolo e mescolare in acqua (10 ml) in un pallone a fondo tondo. Raffreddare la miscela risultante a 0 ° C ponendo il pallone in un bagno di ghiaccio-acqua. Aggiungere alcool 4-idrossibenzil (2,48 mg, 20 mmol) e mescolare la miscela di reazione fino a quando la soluzione è chiara. Preparare una soluzione di cloruro O -acetylsalicyloyl (3,77 mg, 19 mmoli) in toluene …

Representative Results

Nella figura 1, la struttura chimica di aspirina-fumarato profarmaco, GTCpFE, e la sua attività inibitoria sulle citochine indotta percorso NFĸB nelle cellule di cancro al seno sono indicati. GTCpFE inibisce entrambi gli endpoint NFĸB, NFĸB-RE attività luciferasi (Figura 1B) e l'espressione di NFĸB geni bersaglio, come la molecola di adesione intercellulare 1 (ICAM1), chemochine CC Motif Ligand 2 (CCL2), e fattore di necrosi tumorale (TNF) <str…

Discussion

In this protocol, we demonstrated the synthesis of an ASA prodrug, GTCpFE, where the fumarate pharmacophore was incorporated to improve the anti-NFĸB activity in breast cancer cells. GTCpFE is an effective NFĸB inhibitor, whereas ASA itself is not, even at much higher concentrations. The fumarate moiety has anti-inflammatory properties as shown by its ability to inhibit NFĸB signaling in a variety of cell lines and tissues14,25-29. The prodrug strategy described herein, is amendable to other mal…

Declarações

The authors have nothing to disclose.

Acknowledgements

This work was supported by grants provided by the National Institutes of Health (NIH), R01 CA200669 to JF and R01 CA121107 to GRJT, and by a postdoctoral fellowship grant from Susan G. Komen for the Cure to IK (PDF12229484).

Materials

RPMI 1640 Red Medium Life Technologies  11875-093 Warm up to 37°C before use
IMEM Corning 10-024-CV Warm up to 37°C before use
DMEM / F12 Medium ThermoFisher 21041-025 Warm up to 37°C before use
MEM NEAA 10mM 100X Life Technologies  11140
Penicillin Streptomycin Life Technologies  15140-122
L-Glutamine 100X Life Technologies  25030-081
Insulin Sigma-Aldrich I-1882
Fetal Bovine Serum  Atlanta Biologicals S11150
Trypsin 2.5% 10X Invitrogen 15090046
Methyl Cellulose Sigma  M0262
B27 Supplement 50X Gibco 17504-044
EGF Gibco PHG0311L
NFκB-RE Luciferase Construct  Clontech  pGL4.32
Renilla Luciferase Construct  Promega pGL4.70
Lipofectamine 2000 ThermoFisher 11668-019
Dual-Luciferase Reporter Assay  Promega 120000032
NanoDrop Spectrophotometer ThermoFisher
Eppendorf Mastercycler  Eppendorf
StepOne Real Time PCR System Thermo Scientific
Eclipse Microscope Nikon
CyAn ADP Analyzer  Beckman Coulter
QCapture Software QImaging
Summit Software Beckman Coulter
GraphPad Software Prism
TRIzol ThermoFisher 15596-018
M-MLV Reverse Transcriptase Invitrogen 28025-013
100 mM dNTP Set Invitrogen 10297-018
Random Hexamers  Invitrogen 48190-011
Fast SYBR Green Master Mix ThermoFisher 4385612
Costar 96W, ultra low attachment  Corning 3474
HBSS, 1X ThermoFisher 14025134
CD44-APC conjugated antibody  BD Pharmingen 560990 Store at 4°C, protect from light
CD24-PE antibody BD Pharmingen 560991 Store at 4°C, protect from light
Recombinant Human TNFα Fisher 210TA100 
CCL2 Primer Forward Sequence AGAATCACCAGCAGCAAGTGTCC
CCL2 Primer Reverse Sequence TCCTGAACCCACTTCTGCTTGG
ICAM1 Primer Reverse Sequence TGACGAAGCCAGAGGTCTCAG
ICAM1 Primer Forward Sequence AGCGTCACCTTGGCTCTAGG
TNF Primer Forward Sequence AAGGGTGACCGACTCAGCG
TNF Primer Reverse Sequence ATCCCAAAGTAGACCTGCCCA
36B4 Primer Forward Sequence GTGTTCGACAATGGCAGCAT
36B4 Primer Reverse Sequence GACACCCTCCAGGAAGCGA
Sodium Hydroxide Sigma-Aldrich S5881-500G
4-Hydroxybenzyl Alcohol Sigma-Aldrich 20806-10G
O-Acetylsalicyloyl Chloride Sigma-Aldrich 165190-5G
Phosphorous Pentoxide Sigma-Aldrich 79610-100G
Ethyl Fumaroyl Chloride Sigma-Aldrich 669695-1G
Sodium Sulfate Sigma-Aldrich 246980-500G
4-Dimethylaminopyridine Sigma-Aldrich 714844-100ML 0.5 M in tetrahydrofuran
Triethylamine Sigma-Aldrich T0886-100ML
Toluene Sigma-Aldrich 244511-100ML
Ethyl Acetate Sigma-Aldrich 270989-100ML
Tetrahydrofuran Sigma-Aldrich 401757-2L
400 MHz FT NMR spectrometer  See Bruker’s Avance User’s Manual, version 000822 for details

Referências

  1. Hanahan, D., Weinberg, R. A. Hallmarks of cancer: the next generation. Cell. 144, 646-674 (2011).
  2. Cuzick, J., et al. Aspirin and non-steroidal anti-inflammatory drugs for cancer prevention: an international consensus statement. Lancet Oncol. 10, 501-507 (2009).
  3. Terry, M. B., et al. Association of frequency and duration of aspirin use and hormone receptor status with breast cancer risk. JAMA. 291, 2433-2440 (2004).
  4. Wang, D., Dubois, R. N. Cyclooxygenase-2: a potential target in breast cancer. Semin Oncol. 31, 64-73 (2004).
  5. Howe, L. R. Inflammation and breast cancer. Cyclooxygenase/prostaglandin signaling and breast cancer. Breast Cancer Res. 9. 9, 210 (2007).
  6. Kopp, E., Ghosh, S. Inhibition of NF-kappa B by sodium salicylate and aspirin. Science. 265, 956-959 (1994).
  7. Yin, M. J., Yamamoto, Y., Gaynor, R. B. The anti-inflammatory agents aspirin and salicylate inhibit the activity of I(kappa)B kinase-beta. Nature. 396, 77-80 (1998).
  8. Pierce, J. W., Read, M. A., Ding, H., Luscinskas, F. W., Collins, T. Salicylates inhibit I kappa B-alpha phosphorylation, endothelial-leukocyte adhesion molecule expression, and neutrophil transmigration. J Immunol. 156, 3961-3969 (1996).
  9. Frasor, J., El-Shennawy, L., Stender, J. D., Kastrati, I. NFkappaB affects estrogen receptor expression and activity in breast cancer through multiple mechanisms. Mol Cell Endocrinol. 418, 235-239 (2014).
  10. Perkins, N. D. The diverse and complex roles of NF-kappaB subunits in cancer. Nat Rev Cancer. 12, 121-132 (2012).
  11. DiDonato, J. A., Mercurio, F., Karin, M. NF-kappaB and the link between inflammation and cancer. Immunol Rev. 246, 379-400 (2012).
  12. Scarpignato, C., Hunt, R. H. Nonsteroidal antiinflammatory drug-related injury to the gastrointestinal tract: clinical picture, pathogenesis, and prevention. Gastroenterol Clin North Am. 39, 433-464 (2010).
  13. Sostres, C., Gargallo, C. J. Gastrointestinal lesions and complications of low-dose aspirin in the gastrointestinal tract. Best Pract Res Clin Gastroenterol. 26, 141-151 (2012).
  14. Kastrati, I., et al. Dimethyl Fumarate Inhibits the Nuclear Factor kappaB Pathway in Breast Cancer Cells by Covalent Modification of p65 Protein. J Biol Chem. 291, 3639-3647 (2016).
  15. Kastrati, I., et al. A novel aspirin prodrug inhibits NFkappaB activity and breast cancer stem cell properties. BMC Cancer. 15, 845 (2015).
  16. Cao, Y., Luo, J. L., Karin, M. IkappaB kinase alpha kinase activity is required for self-renewal of ErbB2/Her2-transformed mammary tumor-initiating cells. Proc Natl Acad Sci U S A. 104, 15852-15857 (2007).
  17. Liu, M., et al. The canonical NF-kappaB pathway governs mammary tumorigenesis in transgenic mice and tumor stem cell expansion. Cancer Res. 70, 10464-10473 (2010).
  18. Korkaya, H., Liu, S., Wicha, M. S. Regulation of cancer stem cells by cytokine networks: attacking cancer’s inflammatory roots. Clin Cancer Res. 17, 6125-6129 (2011).
  19. Hinohara, K., et al. ErbB receptor tyrosine kinase/NF-kappaB signaling controls mammosphere formation in human breast cancer. Proc Natl Acad Sci U S A. 109, 6584-6589 (2012).
  20. Kendellen, M. F., Bradford, J. W., Lawrence, C. L., Clark, K. S., Baldwin, A. S. Canonical and non-canonical NF-kappaB signaling promotes breast cancer tumor-initiating cells. Oncogene. 33, 1297-1305 (2014).
  21. Yamamoto, M., et al. NF-kappaB non-cell-autonomously regulates cancer stem cell populations in the basal-like breast cancer subtype. Nat Commun. 4, 2299 (2013).
  22. Rio, D. C., Ares, M., Hannon, G. J., Nilsen, T. W. Purification of RNA using TRIzol (TRI reagent). Cold Spring Harb Protoc. , (2010).
  23. Frasor, J., et al. Positive cross-talk between estrogen receptor and NF-kappaB in breast cancer. Cancer Res. 69, 8918-8925 (2009).
  24. Al-Hajj, M., Wicha, M. S., Benito-Hernandez, A., Morrison, S. J., Clarke, M. F. Prospective identification of tumorigenic breast cancer cells. Proc Natl Acad Sci U S A. 100, 3983-3988 (2003).
  25. Vandermeeren, M., et al. Dimethylfumarate is an inhibitor of cytokine-induced nuclear translocation of NF-kappa B1, but not RelA in normal human dermal fibroblast cells. J Invest Dermatol. 116, 124-130 (2001).
  26. Loewe, R., et al. Dimethylfumarate inhibits TNF-induced nuclear entry of NF-kappa B/p65 in human endothelial cells. J Immunol. 168, 4781-4787 (2002).
  27. Seidel, P., et al. Dimethylfumarate inhibits NF-{kappa}B function at multiple levels to limit airway smooth muscle cell cytokine secretion. Am J Physiol Lung Cell Mol Physiol. 297, L326-L339 (2009).
  28. Wilms, H., et al. Dimethylfumarate inhibits microglial and astrocytic inflammation by suppressing the synthesis of nitric oxide, IL-1beta, TNF-alpha and IL-6 in an in-vitro model of brain inflammation. J Neuroinflammation. 7, 30 (2010).
  29. Peng, H., et al. Dimethyl fumarate inhibits dendritic cell maturation via nuclear factor kappaB (NF-kappaB) and extracellular signal-regulated kinase 1 and 2 (ERK1/2) and mitogen stress-activated kinase 1 (MSK1) signaling. J Biol Chem. 287, 28017-28026 (2012).
  30. Li, H. J., Reinhardt, F., Herschman, H. R., Weinberg, R. A. Cancer-stimulated mesenchymal stem cells create a carcinoma stem cell niche via prostaglandin E2 signaling. Cancer Discov. 2, 840-855 (2012).
  31. Li, X., et al. Intrinsic resistance of tumorigenic breast cancer cells to chemotherapy. J Natl Cancer Inst. 100, 672-679 (2008).
  32. Diehn, M., et al. Association of reactive oxygen species levels and radioresistance in cancer stem cells. Nature. 458, 780-783 (2009).
  33. Hollier, B. G., Evans, K., Mani, S. A. The epithelial-to-mesenchymal transition and cancer stem cells: a coalition against cancer therapies. J Mammary Gland Biol Neoplasia. 14, 29-43 (2009).
  34. Velasco-Velazquez, M. A., Popov, V. M., Lisanti, M. P., Pestell, R. G. The role of breast cancer stem cells in metastasis and therapeutic implications. Am J Pathol. 179, 2-11 (2011).
  35. Dontu, G., et al. In vitro propagation and transcriptional profiling of human mammary stem/progenitor cells. Genes Dev. 17, 1253-1270 (2003).
  36. Charafe-Jauffret, E., et al. Cancer stem cells in breast: current opinion and future challenges. Pathobiology. 75, 75-84 (2008).
  37. Clayton, H., Titley, I., Vivanco, M. Growth and differentiation of progenitor/stem cells derived from the human mammary gland. Exp Cell Res. 297, 444-460 (2004).
  38. Ginestier, C., et al. ALDH1 is a marker of normal and malignant human mammary stem cells and a predictor of poor clinical outcome. Cell Stem Cell. 1, 555-567 (2007).
  39. Rosen, J. M., Jordan, C. T. The increasing complexity of the cancer stem cell paradigm. Science. 324, 1670-1673 (2009).
  40. Visvader, J. E., Lindeman, G. J. Cancer stem cells in solid tumours: accumulating evidence and unresolved questions. Nat Rev Cancer. 8, 755-768 (2008).

Play Video

Citar este artigo
Kastrati, I., Delgado-Rivera, L., Georgieva, G., Thatcher, G. R. J., Frasor, J. Synthesis and Characterization of an Aspirin-fumarate Prodrug that Inhibits NFκB Activity and Breast Cancer Stem Cells. J. Vis. Exp. (119), e54798, doi:10.3791/54798 (2017).

View Video