Determining the Role of Maternally-Expressed Genes in Early Development with Maternal Crispants

Published: December 21, 2021

doi:

Cara E. Moravec, Gabriella C. Voit, Francisco Pelegri

¹Laboratory of Genetics,University of Wisconsin-Madison

Summary

Early development is dependent on maternally-inherited products, and the role of many of these products is currently unknown. Herein, we described a protocol that uses CRISPR-Cas9 to identify maternal-effect phenotypes in a single generation.

Abstract

Early development depends on a pool of maternal factors incorporated into the mature oocyte during oogenesis that perform all cellular functions necessary for development until zygotic genome activation. Typically, genetic targeting of these maternal factors requires an additional generation to identify maternal-effect phenotypes, hindering the ability to determine the role of maternally-expressed genes during development. The discovery of the biallelic editing capabilities of CRISPR-Cas9 has allowed screening of embryonic phenotypes in somatic tissues of injected embryos or “crispants,” augmenting the understanding of the role zygotically-expressed genes play in developmental programs. This article describes a protocol that is an extension of the crispant method. In this method, the biallelic editing of germ cells allows for the isolation of a maternal-effect phenotype in a single generation, or “maternal crispants.” Multiplexing guide RNAs to a single target promotes the efficient production of maternal crispants, while sequence analysis of maternal crispant haploids provides a simple method to corroborate genetic lesions that produce a maternal-effect phenotype. The use of maternal crispants supports the rapid identification of essential maternally-expressed genes, thus facilitating the understanding of early development.

Introduction

A pool of maternally deposited products (e.g., RNAs, proteins, and other biomolecules) is necessary for all early cellular processes until the embryo's zygotic genome is activated¹. The premature depletion of these products from the oocyte is typically embryonic lethal. Despite the importance of these genes in development, the role of many maternally-expressed genes is currently unknown. Advancement in gene-editing technology in zebrafish, such as CRISPR-Cas9, enables the targeting of maternally-expressed genes²^,³^,⁴. However, the identification of a maternal-effect phenotype requires an extra generation when compared to a zygotic phenotype, thus requiring more resources. Recently, the biallelic editing capability of CRISPR-Cas9 has been used to screen for embryonic phenotypes in somatic tissues of injected (F0) embryos, known as "crispants"⁵^,⁶^,⁷^,⁸^,⁹^,¹⁰. The crispant technique permits resource-efficient screening of candidate genes in somatic cells, facilitating understanding of specific aspects in development. The protocol described in this paper allows for the identification of maternal-effect phenotypes, or "maternal crispants," in a single generation¹¹. This scheme is attainable by multiplexing guide RNAs to a single gene and promoting biallelic editing events in the germline. These maternal crispant embryos can be identified by gross morphological phenotypes and undergo primary characterization, such as labeling for cell boundaries and DNA patterning¹¹. Combined analysis of the observable phenotype and basic molecular characterization of the induced INDELs allows for the prediction of the targeted gene's role in early development.

In zebrafish, during the first 24 h post-fertilization (hpf), a small group of cells develops into the primordial germ cells, a precursor to the germline¹²^,¹³^,¹⁴^,¹⁵. In clutches laid by F0 females, the proportion of maternal crispant embryos recovered depends on how many germ cells contain a biallelic editing event in the targeted gene. In general, the earlier the editing event occurs in the embryo, the higher the probability of CRISPR-Cas9 mutations being observed in the germline. In most cases, the phenotypes of maternal crispant embryos come from the loss of function in the two maternal alleles present in the developing oocyte. As the oocyte finishes meiosis, one of the maternal alleles is extruded from the embryo via the polar body, while the other allele becomes incorporated into the maternal pronucleus. The sequencing of multiple maternal crispant haploids will represent a mixture of the mutations (insertions and/or deletions (INDELs)) present in the germline that contribute to the phenotype¹¹.

The following protocol describes the necessary steps to create CRISPR-Cas9 mutations in maternal-effect genes and identify the corresponding phenotype using a maternal crispant approach (Figure 1). Section one will explain how to effectively design and create guide RNAs, while sections two and three contain critical steps for creating maternal crispants by microinjection. After injecting the CRISPR-Cas9 mixture, injected embryos are screened for somatic edits via PCR (section four). Once the injected F0 embryos develop and reach sexual maturity, the F0 females are crossed to wild-type males, and their offspring are screened for maternal-effect phenotypes (section five). Section six includes instructions on making maternal crispant haploids that can be combined with Sanger sequencing to identify the CRISPR-Cas9-induced INDELs. In addition, the Discussion contains modifications that can be made to the protocol to increase the sensitivity and power of this method.

Protocol

In studies leading to the development of this protocol, all zebrafish housing and experiments were approved by the University of Wisconsin-Madison Institutional Animal Care and Use Committee (IACUC-M005268-R2). 1. Synthesis of Guide RNAs NOTE: Zygotic crispants have been created using a single guide RNA or multiplexing multiple guide RNAs to a single target5,6,7</s…

Representative Results

The experimental approach described in this protocol allows for the identification of maternal effect phenotypes in a rapid, resource-efficient manner (Figure 1). Generating maternal crispants: When designing the four guide RNAs to target a single candidate maternal-effect gene, special consideration should be given to where the guide RNAs will bind to DNA. In general, they should all be clustered together with minimal to no overlapping regi…

Discussion

The protocol presented in this manuscript allows for the identification and primary molecular characterization of a maternal-effect phenotype in a single generation instead of the multiple generations required for both forward and reverse genetic techniques. Currently, the role of many maternally expressed genes is unknown. This lack of knowledge is partly due to the extra generation required to visualize a phenotype when identifying maternal-effect genes. In the past, the rapid identification of maternal-effect genes in…

Declarações

The authors have nothing to disclose.

Acknowledgements

We thank past and current Pelegri lab animal husbandry staff members for their care of the aquatic facility. We are also grateful for the comments and insight on the manuscript by Ryan Trevena and Diane Hanson. Funding was provided by NIH grant to F.P. (GM065303)

Materials

1 M Tris-HCl (pH 8.4)	Invirogen	15568025	For PCR mix
1.5 mL Eppendorf Tubes	Any Maker
10 mM dNTPs	Thermo Fischer Scientific	18427013	Synthesis of gRNA
100 BP ladder	Any Maker		For gel electrophoresis
100% RNAse free ethanol	Any Maker
100% RNAse free ethanol	Any Maker
100ml Beaker	Any Maker		For IVF
5 M Ammonium Accetate	Thermo Fischer Scientific	Found in the MEGAshortscript T7 Transcription Kit	Synthesis of gRNA
70% Ethanol			Synthesis of gRNA (70 mL of ethanol + 30 mL of nuclease free water)
Borosil 1.0 mm OD x 0.5 mm ID	FHC INC	27-30-1	for Microinjection
Bulk Pharma Sodium Bicarbonate 35 pounds	Bulk Reef Supply	255	Fish supplies
CaCl₂	MiliporeSigma	C7902
Cas9 Protein with NLS	PNABio	CP01
ChopChop			https://chopchop.cbu.uib.no/
Constant oligonucleotide	Integrated DNA Technologies (IDT)		AAAAGCACCGACTCGGTGCCAC TTTTTCAAGTTGATAACGGACTA GCCTTATTTTAACTTGCTATTTC TAGCTCTAAAAC
Depression Glass Plate	Thermo Fischer Scientific	13-748B	For IVF
Dissecting Forceps	Dumont	SS	For IVF
Dissecting Scissors	Fine Science Tools	14091-09	For IVF
Dissecting Steroscope( with transmitted light source)	Any Maker		For IVF
DNA Clean & Concentrator -5	Zymo Research	D4014	Synthesis of gRNA
DNA Gel Loading Dye (6x)	Any Maker		For gel electrophoresis
EconoTaq DNA Polymerase	Lucigen	30032-1	For PCR mix
Electropheresis Power Supply	Any Maker		For gel electrophoresis
Ensemble			https://useast.ensembl.org/index.html
Eppendorf Femtotips Microloader Tips for Femtojet Microinjector	Thermo Fischer Scientific	E5242956003	for Microinjection
Ethanol (200 proof, nuclease-free)	Any Maker
FemtoJet 4i	Eppendorf	5252000021	for Microinjection
Fish Net	Any Maker		Fish supplies
Frozen Brine Shrimp	Brine Shrimp Direct		Fish supplies
General All Purpose Agarose	Any Maker		For gel electrophoresis
Gene-Specific oligonucleotide	Integrated DNA Technologies (IDT)		TAATACGACTCACTATA- N²⁰ -GTTTTAGAGCTAGAAATAGCAAG
Gloves	Any Maker
Ice Bucket	Any Maker
Instant Ocean salt	Any Maker		Fish supplies
Invitrogen UltraPure Ethidium Bromide, 10 mg/mL	Thermo Fischer Scientific	15-585-011
KCl	MiliporeSigma	P5405
KH₂PO₄	MiliporeSigma	7778-77-0
Kimwipes	Thermo Fischer Scientific	06-666
Male & Female zebrafish
MEGAshortscript T7 Transcription Kit	Thermo Fischer Scientific	AM1354	Synthesis of gRNA
Methylene Blue	Thermo Fischer Scientific	AC414240250	For E3
MgCl₂	MiliporeSigma	7791-18-6	For PCR mix
MgSO₂·7H₂O	MiliporeSigma	M2773
Microinjection plastic mold	World Precision Instruments	Z-Molds	for Microinjection
Micromanipulator	Any Maker		for Microinjection
Micropipeters	Any Maker
Micropipette Puller	Sutter	P-87	for Microinjection
Micropipetter tips with filters (all sizes)	Any Maker
Micropippetter tips without filters ( all sizes)	Any Maker
Microwave	Any Maker
Mineral Oil	MiliporeSigma	m5904-5ml	for Microinjection
MS-222 ( Tricaine-D)	Any Maker		FDA approved
Na₂HPO₄	MiliporeSigma	S3264
NaCl	MiliporeSigma	S5886
NaHC0₃	MiliporeSigma	S5761
Nanodrop	Any Maker
NaOH	MiliporeSigma	567530
Nonstick, RNase-free Microfuge Tubes, 1.5 mL	Ambion	AM12450	Synthesis of gRNA
nuclease-free water	Any Maker
Paper Towel	Any Maker
Pastro Pipettes	Any Maker
PCR Strip Tubes	Any Maker
Petri Plates 100 mm diameter	Any Maker
Phenol Red solution	MiliporeSigma	P0290	for Microinjection
Plastic Pestals	VWR	47747-358	For IVF
Plastic Spoon	Any Maker		For IVF
Premium Grade Brine Shrimp Eggs	Brine Shrimp Direct		Fine Mesh
RNA Gel Loading Dye		found in MEGAshortscript T7 Transcription Kit	For gel electrophoresis
RNAse AWAY	Thermo Fischer Scientific	21-402-178
Scale	Any Maker
Sharpie	Any Maker
Spatula	Any Maker
Sterile H2O	Any Maker		For PCR mix
T4 DNA Polymerase	NEB	M0203	Synthesis of gRNA
Tape	Any Maker
TBE (Tris-Borate-EDTA) 10x	Any Maker		For gel electrophoresis
Tea Stainer	Amazon	IMU-71133W	Fish supplies
Thermo Scientific Owl 12-Tooth Comb, 1.0/1.5 mm Thick, Double Sided for B2	Thermo Fischer Scientific	B2-12	For gel electrophoresis
Thermo Scientific Owl EasyCast B2 Mini Gel Electrophoresis Systems	Thermo Fischer Scientific	09-528-110B	For gel electrophoresis
Thermocycler	Any Maker
Thermocycler	Any Maker
Transilluminator	Any Maker
UV lamp	UVP	Model XX-15 (Cat NO. UVP18006201)	For IVF
UV safety glasses	Any Maker		For IVF
Wash Bottle	Thermo Fischer Scientific	S39015	Fish supplies
Zebrafish mating boxes	Aqua Schwarz	SpawningBox1	Fish supplies
1.5ml Eppendorf Tubes	Fisher Scientific	05-402-11
10 Molar dNTPs	Thermo Fischer Scientific	18427013
100 BP ladder	Thermo Fischer Scientific	15628019
100% RNAse free ethanol	any maker
5m Ammonium Accetate	Thermo Fischer Scientific
70% Ethanol			70ml ethanol and 30 ml of nuclease free water
Accessories for Horizontal Gel Box	Fisher Scientific		0.625 mm
Agarose	any maker
CaCl2	Sigma	10043-52-4
CaCl2, dihydrate	Sigma	10035-04-8	E3 Medium
Capillary Tubing	Cole-Parmer	UX-03010-68	for injection needles
Cas9 Protein	Thermo Fischer Scientific	A36496
ChopChop	https://chopchop.cbu.uib.no/
Computer	any maker
Dissecting Forcepts	any maker
Dissecting Microscope	any maker
Dissecting Scissors	any maker
DNA Clean & Concentrator -5	Zymo Research	D4014
DNA Gel Loading Dye (6X)	Thermo Fischer Scientific	R0611
EconoTaq DNA Polymerase	Lucigen	30032-1
Ensemble	https://useast.ensembl.org/index.html
Eppendorf Microloader PipetteTips	Fischer Scientific	10289651	20 microliters
Ethanol (200 proof, nuclease-free)	any maker
Ethidium Bromide	Thermo Fischer Scientific	15585011
Fish Net	any maker		fine mesh
Frozen Brine Shrimp	LiveAquaria	CD-12018	fish food
Gel Comb (0.625mm)	any maker
Gel Electropheresis System	any maker
Gene-Specific oligonucleotide	Integrated DNA Technologies (IDT)
Glass Capilary Needle	Grainger	21TZ99	https://www.grainger.com/product/21TZ99?ef_id=Cj0KCQjw8Ia GBhCHARIsAGIRRYpqsyA3-LUXbpZVq7thnRbroBqQTbrZ_a88 VVcI964LtOC6SFLz4ZYaAhZzEAL w_wcB:G:s&s_kwcid=AL!2966!3! 264955916096!!!g!438976 780705!&gucid=N:N:PS:Paid :GGL:CSM-2295:4P7A1P:20501 231&gclid=Cj0KCQjw8IaGBh CHARIsAGIRRYpqsyA3-LUXbp ZVq7thnRbroBqQTbrZ_a88VVcI 964LtOC6SFLz4ZYaAhZzEALw _wcB&gclsrc=aw.ds
Glass Dishes	any maker
Gloves	any maker
Hank's Final Working Solution			Combine 9.9 ml of Hank's Premix with 0.1 ml HS Stock #6
Hank's Premix			combine the following in order: (1) 10.0 ml HS #1, (2) 1.0 ml HS#2, (3) 1.0 ml HS#4, (4) 86 ml ddH2O, (5) 1.0 ml HS#5. Store all HS Solotions at 4C
Hanks Solution
Hank's Solution			https://www.jove.com/pdf-materials/51708/jove-materials-51708-production-of-haploid-zebrafish-embryos-by-in-vitro-fertilization
Hank's Stock Solution #1			8.0 g NaCl, 0.4 g KCl in 100 ml ddH2O
Hank's Stock Solution #2			0.358 g Na2HPO4 anhydrous; 0.60 g K2H2PO4 in 100 ml ddH2O
Hank's Stock Solution #4			0.72 g CaCl2 in 50 ml ddH2O
Hank's Stock Solution #5			1.23 g MgSO47H2O in 50 ml ddH20
Hank's Stock Solution #6			0.35g NaHCO3 in 10.0 ml ddH20; make fresh day of use
HCl	Sigma	7647-01-0
Ice Bucket	any maker
Instant Ocean salt	any maker		for fish water
In-Vitro Transcription Kit Mega Short Script	Thermo Fischer Scientific	AM1354
Invitrogen™ UltraPure™ DNase/RNase-Free Distilled Water	Fisher Scientific	10-977-023
KCl	Sigma	7447-40-7	E3 Medium
KH2PO4	Sigma	7778-77-0
Kimwipes	Fisher Scientific	06-666
Male and Female zebrafish
Mega Short Script T7 Transciption Kit	Thermo Fischer Scientific	AM1354
methylene blue	Fisher Scientific	AC414240250	E3 Medium
MgSO2-7H2O	Sigma	M2773
Microimicromanipulator
Microinjection plastic mold	World Precision Instruments	Z-Molds
Microinjector
Microneedle Slide
Micropipeter (1-10) with tips	any maker		need filtered p10 tips
Micropipetter (20-200) with tips	any maker
Micropippetter (100-1000) with tips	any maker
Microplastic slide
Microwave	any maker
MiliQ Water	any maker
mineral oil	sigma-aldrich	m5904-5ml
Na2HPO4	Sigma
NaCl	Sigma	S9888
NaHC02	Sigma	223441
Nanodrop
NaOH	Sigma	567530
Narrow Spatula	any maker
Needle Puller	Sutter	P-97
Paper Towel	any maker
Pastro Pipettes	Fisher Scientific	13-678-20A
PCR primer flanking guide site	Integrated DNA Technologies (IDT)
PCR primers flanking guide RNA cut site	Integrated DNA Technologies (IDT)		Standard desalted
PCR Strip Tubes	Thermo Fischer Scientific	AB0771W
Petri Dishes	Fisher Scientific	FB0875714	10 cm diameter 100mm x 15mm
Phenol Red	Fisher Science	S25464	https://www.fishersci.com/shop/products/phenol-red-indicator-solution-0-02-w-v-2/S25464
Pipette Tips	any maker		10ul, 200ul and 1000ul tips
Plastic Pestals	Fisher Scientific	12-141-364
Plastic Spoon	any maker
Primer Guide Site	Integrated DNA Technologies (IDT)
Razor Blade	Uline	H-595B
RNA gel Loading Dye	in megashort script kit(in vitro transciption kit)
RNAse away	Fisher	21-402-178
RNAse free polypropylene microcentrifuge tubes	Thermo Fischer Scientific	AM12400	https://www.thermofisher.com/order/catalog/product/AM12400#/AM12400
RNAse free water	Fisher Scientific	10-977-023
Scale	any maker
Sharpie	any maker
Sodium bicarbonate (cell culture tested)	Sigma	S5761	fish water
Sodium Bromide Solotion	Sigma	E1510
Software for sanger sequencing Analysis
Spectrophotometer
Sterlie H2O	any brand
T4 DNA Polymerase	NEB	M0203S	https://www.neb.com/products/m0203-t4-dna-polymerase#Product%20Information
Tape	any brand
TBE (Tris-Borate-EDTA) 10X	Thermo Fischer Scientific	B52	https://www.thermofisher.com/order/catalog/product/B52#/B52
Tea Stainer	amazon	IMU-71133W	avaible in most kitchen stores
Thermocycler
Transfer Pipette	Uline	S-24320
Transilluminator
Tricaine	fisher scientific	NC0872873
Tris HCl 7.5	Thermo Fischer Scientific	15567027
Universal Primer	Integrated DNA Technologies (IDT)		AAAAGCACCGACTCGGTGCCAC TTTTTCAAGTTGATAACGGACTAG CCTTATTTTAACTTGCTATTTCTA GCTCTAAAAC
UV lamp	UVP
UV safety glasses	any maker
Wash Bottle	fisher scientific	S39015
Zebrafish mating boxes	any maker
PCR Buffer Recipe	Add 171.12mL sterile H20; 0.393 mL 1M MgCl2; 2.616mL 1M MgCl2; 2.618 mL 1M Tris-HCl (pH 8.4) 13.092mL 1M KCl; 0.262 mL 1% Gelatin. Autoclave for 20 minutes then chill the solotion on ice. Next add 3.468 mL 100mg/mL BSA; 0.262 mL dATP (100mM), 0.262mL dCTP (100mM); 0.262 mL dGTP (100mM); 0.262 mL dTTP (100mL). Alliquote into sterile eppendorf tubes

Referências

Pelegri, F. Maternal factors in zebrafish development. Developmental Dynamics. 228 (3), 535-554 (2003).
Campbell, P. D., Heim, A. E., Smith, M. Z., Marlow, F. L. Kinesin-1 interacts with Bucky ball to form germ cells and is required to pattern the zebrafish body axis. Development. 142 (17), 2996-3008 (2015).
Eno, C., Solanki, B., Pelegri, F. aura (mid1ip1l) regulates the cytoskeleton at the zebrafish egg-to-embryo transition. Development. 143 (9), 1585-1599 (2016).
He, W. -. X., et al. Oocyte-specific maternal Slbp2 is required for replication-dependent histone storage and early nuclear cleavage in zebrafish oogenesis and embryogenesis. RNA. 24 (12), 1738-1748 (2018).
Burger, A., et al. Maximizing mutagenesis with solubilized CRISPR-Cas9 ribonucleoprotein complexes. Development. 143 (11), 2025-2037 (2016).
Jao, L. -. E., Wente, S. R., Chen, W. Efficient multiplex biallelic zebrafish genome editing using a CRISPR nuclease system. Proceedings of the National Academy of Sciences of the United States of America. 110 (34), 13904-13909 (2013).
Shah, A. N., Davey, C. F., Whitebirch, A. C., Miller, A. C., Moens, C. B. Rapid reverse genetic screening using CRISPR in zebrafish. Nature Methods. 12 (6), 535-540 (2015).
Shankaran, S. S., Dahlem, T. J., Bisgrove, B. W., Yost, H. J., Tristani-Firouzi, M. CRISPR/Cas9-directed gene editing for the generation of loss-of-function mutants in high-throughput zebrafish F0 screens. Current Protocols in Molecular Biology. 119 (1), 1-22 (2017).
Trubiroha, A., et al. A Rapid CRISPR/Cas-based mutagenesis assay in zebrafish for identification of genes involved in thyroid morphogenesis and function. Scientific Reports. 8 (1), 5647 (2018).
Wu, R. S., Lam, I. I., Clay, H., Duong, D. N., Deo, R. C., Coughlin, S. R. A Rapid method for directed gene knockout for screening in G0 zebrafish. Developmental Cell. 46 (1), 112-125 (2018).
Moravec, C. E., Voit, G. C., Otterlee, J., Pelegri, F. Identification of maternal-effect genes in zebrafish using maternal crispants. Development. 148 (19), 199536 (2021).
Braat, A. K., Zandbergen, T., van de Water, S., Goos, H. J., Zivkovic, D. Characterization of zebrafish primordial germ cells: morphology and early distribution of vasa RNA. Developmental Dynamics: An Official Publication of the American Association of Anatomists. 216 (2), 153-167 (1999).
Eno, C., Hansen, C. L., Pelegri, F. Aggregation, segregation, and dispersal of homotypic germ plasm RNPs in the early zebrafish embryo. Developmental Dynamics. 248 (4), 306-318 (2019).
Knaut, H., Steinbeisser, H., Schwarz, H., Nüsslein-Volhard, C. An evolutionary conserved region in the vasa 3’UTR targets RNA translation to the germ cells in the zebrafish. Current biology: CB. 12 (6), 454-466 (2002).
Yoon, C., Kawakami, K., Hopkins, N. Zebrafish vasa homologue RNA is localized to the cleavage planes of 2- and 4-cell-stage embryos and is expressed in the primordial germ cells. Development. 124 (16), 3157-3165 (1997).
Gagnon, J. A., et al. Efficient mutagenesis by Cas9 protein-mediated oligonucleotide insertion and large-scale assessment of single-guide RNAs. PLoS ONE. 9 (5), 98186 (2014).
Labun, K., Montague, T. G., Gagnon, J. A., Thyme, S. B., Valen, E. CHOPCHOP v2: a web tool for the next generation of CRISPR genome engineering. Nucleic Acids Research. 44, 272-276 (2016).
Labun, K., Montague, T. G., Krause, M., Torres Cleuren, Y. N., Tjeldnes, H., Valen, E. CHOPCHOP v3: expanding the CRISPR web toolbox beyond genome editing. Nucleic Acids Research. 47, 171-174 (2019).
Montague, T. G., Cruz, J. M., Gagnon, J. A., Church, G. M., Valen, E. CHOPCHOP: a CRISPR/Cas9 and TALEN web tool for genome editing. Nucleic Acids Research. 42, 401-407 (2014).
Moravec, C. E., Pelegri, F. J. An accessible protocol for the generation of CRISPR-Cas9 knockouts using INDELs in zebrafish. Methods in Molecular Biology. 1920, 377-392 (2019).
White, R. J., et al. A high-resolution mRNA expression time course of embryonic development in zebrafish. eLife. 6, 30860 (2017).
Aanes, H., et al. Zebrafish mRNA sequencing deciphers novelties in transcriptome dynamics during maternal to zygotic transition. Genome Research. 21 (8), 1328-1338 (2011).
Aken, B. L., et al. The Ensembl gene annotation system. Database: The Journal of Biological Databases and Curation. 2016, (2016).
Sorlien, E. L., Witucki, M. A., Ogas, J. Efficient production and identification of CRISPR/Cas9-generated gene knockouts in the model system Danio rerio. Journal of Visualized Experiments: JoVE. (138), e56969 (2018).
Kotani, H., Taimatsu, K., Ohga, R., Ota, S., Kawahara, A. efficient multiple genome modifications induced by the crRNAs, tracrRNA and Cas9 protein complex in zebrafish. PloS One. 10 (5), 0128319 (2015).
Rosen, J. N., Sweeney, M. F., Mably, J. D. Microinjection of zebrafish embryos to analyze gene function. Journal of Visualized Experiments: JoVE. (25), e1115 (2009).
Xu, Q. Microinjection into zebrafish embryos. Methods in Molecular Biology. 127, 125-132 (1999).
Biology Mouse, ., Zebrafish, , Chick, Biology: Mouse, Zebrafish, and Chick. Zebrafish Microinjection Techniques. JoVE Science Education Database. , (2021).
Kimmel, C. B., Ballard, W. W., Kimmel, S. R., Ullmann, B., Schilling, T. F. Stages of embryonic development of the zebrafish. Developmental Dynamics: An Official Publication of the American Association of Anatomists. 203 (3), 253-310 (1995).
D’Agostino, Y., et al. A rapid and cheap methodology for CRISPR/Cas9 zebrafish mutant screening. Molecular Biotechnology. 58 (1), 73-78 (2016).
Baars, D. L., Takle, K. A., Heier, J., Pelegri, F. Ploidy manipulation of zebrafish embryos with Heat Shock 2 treatment. Journal of Visualized Experiments: JoVE. (118), e54492 (2016).
Nair, S., Lindeman, R. E., Pelegri, F. In vitro oocyte culture-based manipulation of zebrafish maternal genes. Developmental Dynamics: An Official Publication of the American Association of Anatomists. 242 (1), 44-52 (2013).
Kushawah, G., et al. CRISPR-Cas13d induces efficient mRNA knockdown in animal embryos. Developmental Cell. 54 (6), 805-817 (2020).
Kroeger, P. T., Poureetezadi, S. J., McKee, R., Jou, J., Miceli, R., Wingert, R. A. Production of haploid zebrafish embryos by in vitro fertilization. Journal of Visualized Experiments: JoVE. (89), e51708 (2014).
Xiao, T., Roeser, T., Staub, W., Baier, H. A GFP-based genetic screen reveals mutations that disrupt the architecture of the zebrafish retinotectal projection. Development. 132 (13), 2955-2967 (2005).
Riemer, S., Bontems, F., Krishnakumar, P., Gömann, J., Dosch, R. A functional Bucky ball-GFP transgene visualizes germ plasm in living zebrafish. Gene Expression Patterns: GEP. 18 (1-2), 44-52 (2015).
Moreno-Mateos, M. A., et al. CRISPRscan: designing highly efficient sgRNAs for CRISPR-Cas9 targeting in vivo. Nature Methods. 12 (10), 982-988 (2015).

Play Video

PDF

DOI

DOWNLOAD MATERIALS LIST

Citar este artigo

Moravec, C. E., Voit, G. C., Pelegri, F. Determining the Role of Maternally-Expressed Genes in Early Development with Maternal Crispants. J. Vis. Exp. (178), e63177, doi:10.3791/63177 (2021).