Determinación del papel de los genes expresados por la madre en el desarrollo temprano con crispants maternos
Summary
El desarrollo temprano depende de los productos heredados por la madre, y el papel de muchos de estos productos es actualmente desconocido. En este documento, describimos un protocolo que utiliza CRISPR-Cas9 para identificar fenotipos de efecto materno en una sola generación.
Abstract
El desarrollo temprano depende de un conjunto de factores maternos incorporados al ovocito maduro durante la ovogénesis que realizan todas las funciones celulares necesarias para el desarrollo hasta la activación del genoma cigótico. Por lo general, la orientación genética de estos factores maternos requiere una generación adicional para identificar fenotipos de efecto materno, lo que dificulta la capacidad de determinar el papel de los genes expresados por la madre durante el desarrollo. El descubrimiento de las capacidades de edición bialélica de CRISPR-Cas9 ha permitido la detección de fenotipos embrionarios en tejidos somáticos de embriones inyectados o “crispantes”, aumentando la comprensión del papel que desempeñan los genes expresados cigóticamente en los programas de desarrollo. En este artículo se describe un protocolo que es una extensión del método crispant. En este método, la edición bialélica de las células germinales permite el aislamiento de un fenotipo de efecto materno en una sola generación, o “crispantes maternos”. La multiplexación guía a los ARN a un solo objetivo promueve la producción eficiente de crispantes maternos, mientras que el análisis de secuencia de haploides de crispantes maternos proporciona un método simple para corroborar las lesiones genéticas que producen un fenotipo de efecto materno. El uso de crispantes maternos apoya la rápida identificación de genes esenciales expresados por la madre, facilitando así la comprensión del desarrollo temprano.
Introduction
Un conjunto de productos depositados por la madre (por ejemplo, ARN, proteínas y otras biomoléculas) es necesario para todos los procesos celulares tempranos hasta que se active el genoma cigótico del embrión1. El agotamiento prematuro de estos productos del ovocito es típicamente letal embrionario. A pesar de la importancia de estos genes en el desarrollo, el papel de muchos genes expresados por la madre es actualmente desconocido. El avance en la tecnología de edición de genes en el pez cebra, como CRISPR-Cas9, permite la focalización de genes expresados maternamente 2,3,4. Sin embargo, la identificación de un fenotipo de efecto materno requiere una generación adicional en comparación con un fenotipo cigótico, por lo que requiere más recursos. Recientemente, la capacidad de edición bialélica de CRISPR-Cas9 se ha utilizado para detectar fenotipos embrionarios en tejidos somáticos de embriones inyectados (F0), conocidos como “crispantes”5,6,7,8,9,10. La técnica crispant permite la detección eficiente de genes candidatos en células somáticas, facilitando la comprensión de aspectos específicos en el desarrollo. El protocolo descrito en este trabajo permite la identificación de fenotipos de efecto materno, o “crispantes maternos”, en una sola generación11. Este esquema se puede lograr mediante la multiplexación de ARN guía a un solo gen y la promoción de eventos de edición bialélica en la línea germinal. Estos embriones maternos crispantes pueden identificarse por fenotipos morfológicos macroscópicos y someterse a una caracterización primaria, como el etiquetado de los límites celulares y el patrón de ADN11. El análisis combinado del fenotipo observable y la caracterización molecular básica de los INDEL inducidos permite predecir el papel del gen objetivo en el desarrollo temprano.
En el pez cebra, durante las primeras 24 h después de la fertilización (hpf), un pequeño grupo de células se convierte en las células germinales primordiales, un precursor de la línea germinal12,13,14,15. En las garras colocadas por hembras F0, la proporción de embriones maternos crispantes recuperados depende de cuántas células germinales contienen un evento de edición bialélico en el gen objetivo. En general, cuanto antes ocurra el evento de edición en el embrión, mayor será la probabilidad de que se observen mutaciones CRISPR-Cas9 en la línea germinal. En la mayoría de los casos, los fenotipos de embriones crujientes maternos provienen de la pérdida de función en los dos alelos maternos presentes en el ovocito en desarrollo. A medida que el ovocito termina la meiosis, uno de los alelos maternos se extruye del embrión a través del cuerpo polar, mientras que el otro alelo se incorpora al pronúcleo materno. La secuenciación de múltiples haploides crujientes maternos representará una mezcla de las mutaciones (inserciones y/o deleciones (INDELs)) presentes en la línea germinal que contribuyen al fenotipo11.
El siguiente protocolo describe los pasos necesarios para crear mutaciones CRISPR-Cas9 en genes de efecto materno e identificar el fenotipo correspondiente utilizando un enfoque de crispante materno (Figura 1). La sección uno explicará cómo diseñar y crear ARN guía de manera efectiva, mientras que las secciones dos y tres contienen pasos críticos para crear crispantes maternos mediante microinyección. Después de inyectar la mezcla CRISPR-Cas9, los embriones inyectados se examinan para detectar ediciones somáticas mediante PCR (sección cuatro). Una vez que los embriones F0 inyectados se desarrollan y alcanzan la madurez sexual, las hembras F0 se cruzan con machos de tipo salvaje, y sus crías son examinadas para detectar fenotipos de efecto materno (sección cinco). La sección seis incluye instrucciones sobre cómo hacer haploides crujientes maternos que se pueden combinar con la secuenciación de Sanger para identificar los INDEL inducidos por CRISPR-Cas9. Además, la Discusión contiene modificaciones que se pueden hacer al protocolo para aumentar la sensibilidad y el poder de este método.
Protocol
Representative Results
Discussion
El protocolo presentado en este manuscrito permite la identificación y caracterización molecular primaria de un fenotipo de efecto materno en una sola generación en lugar de las múltiples generaciones requeridas para las técnicas genéticas directas e inversas. Actualmente, se desconoce el papel de muchos genes expresados por la madre. Esta falta de conocimiento se debe en parte a la generación adicional requerida para visualizar un fenotipo al identificar genes de efecto materno. En el pasado, la rápida identific…
Declarações
The authors have nothing to disclose.
Acknowledgements
Agradecemos a los miembros anteriores y actuales del personal de cría de animales de laboratorio de Pelegri por su cuidado de las instalaciones acuáticas. También estamos agradecidos por los comentarios y la visión sobre el manuscrito de Ryan Trevena y Diane Hanson. La financiación fue proporcionada por la subvención de los NIH a F.P. (GM065303)
Materials
| 1 M Tris-HCl (pH 8.4) | Invirogen | 15568025 | For PCR mix |
| 1.5 mL Eppendorf Tubes | Any Maker | ||
| 10 mM dNTPs | Thermo Fischer Scientific | 18427013 | Synthesis of gRNA |
| 100 BP ladder | Any Maker | For gel electrophoresis | |
| 100% RNAse free ethanol | Any Maker | ||
| 100% RNAse free ethanol | Any Maker | ||
| 100ml Beaker | Any Maker | For IVF | |
| 5 M Ammonium Accetate | Thermo Fischer Scientific | Found in the MEGAshortscript T7 Transcription Kit | Synthesis of gRNA |
| 70% Ethanol | Synthesis of gRNA (70 mL of ethanol + 30 mL of nuclease free water) | ||
| Borosil 1.0 mm OD x 0.5 mm ID | FHC INC | 27-30-1 | for Microinjection |
| Bulk Pharma Sodium Bicarbonate 35 pounds | Bulk Reef Supply | 255 | Fish supplies |
| CaCl2 | MiliporeSigma | C7902 | |
| Cas9 Protein with NLS | PNABio | CP01 | |
| ChopChop | https://chopchop.cbu.uib.no/ | ||
| Constant oligonucleotide | Integrated DNA Technologies (IDT) | AAAAGCACCGACTCGGTGCCAC TTTTTCAAGTTGATAACGGACTA GCCTTATTTTAACTTGCTATTTC TAGCTCTAAAAC |
|
| Depression Glass Plate | Thermo Fischer Scientific | 13-748B | For IVF |
| Dissecting Forceps | Dumont | SS | For IVF |
| Dissecting Scissors | Fine Science Tools | 14091-09 | For IVF |
| Dissecting Steroscope( with transmitted light source) | Any Maker | For IVF | |
| DNA Clean & Concentrator -5 | Zymo Research | D4014 | Synthesis of gRNA |
| DNA Gel Loading Dye (6x) | Any Maker | For gel electrophoresis | |
| EconoTaq DNA Polymerase | Lucigen | 30032-1 | For PCR mix |
| Electropheresis Power Supply | Any Maker | For gel electrophoresis | |
| Ensemble | https://useast.ensembl.org/index.html | ||
| Eppendorf Femtotips Microloader Tips for Femtojet Microinjector | Thermo Fischer Scientific | E5242956003 | for Microinjection |
| Ethanol (200 proof, nuclease-free) | Any Maker | ||
| FemtoJet 4i | Eppendorf | 5252000021 | for Microinjection |
| Fish Net | Any Maker | Fish supplies | |
| Frozen Brine Shrimp | Brine Shrimp Direct | Fish supplies | |
| General All Purpose Agarose | Any Maker | For gel electrophoresis | |
| Gene-Specific oligonucleotide | Integrated DNA Technologies (IDT) | TAATACGACTCACTATA- N20 -GTTTTAGAGCTAGAAATAGCAAG | |
| Gloves | Any Maker | ||
| Ice Bucket | Any Maker | ||
| Instant Ocean salt | Any Maker | Fish supplies | |
| Invitrogen UltraPure Ethidium Bromide, 10 mg/mL | Thermo Fischer Scientific | 15-585-011 | |
| KCl | MiliporeSigma | P5405 | |
| KH2PO4 | MiliporeSigma | 7778-77-0 | |
| Kimwipes | Thermo Fischer Scientific | 06-666 | |
| Male & Female zebrafish | |||
| MEGAshortscript T7 Transcription Kit | Thermo Fischer Scientific | AM1354 | Synthesis of gRNA |
| Methylene Blue | Thermo Fischer Scientific | AC414240250 | For E3 |
| MgCl2 | MiliporeSigma | 7791-18-6 | For PCR mix |
| MgSO2·7H2O | MiliporeSigma | M2773 | |
| Microinjection plastic mold | World Precision Instruments | Z-Molds | for Microinjection |
| Micromanipulator | Any Maker | for Microinjection | |
| Micropipeters | Any Maker | ||
| Micropipette Puller | Sutter | P-87 | for Microinjection |
| Micropipetter tips with filters (all sizes) | Any Maker | ||
| Micropippetter tips without filters ( all sizes) | Any Maker | ||
| Microwave | Any Maker | ||
| Mineral Oil | MiliporeSigma | m5904-5ml | for Microinjection |
| MS-222 ( Tricaine-D) | Any Maker | FDA approved | |
| Na2HPO4 | MiliporeSigma | S3264 | |
| NaCl | MiliporeSigma | S5886 | |
| NaHC03 | MiliporeSigma | S5761 | |
| Nanodrop | Any Maker | ||
| NaOH | MiliporeSigma | 567530 | |
| Nonstick, RNase-free Microfuge Tubes, 1.5 mL | Ambion | AM12450 | Synthesis of gRNA |
| nuclease-free water | Any Maker | ||
| Paper Towel | Any Maker | ||
| Pastro Pipettes | Any Maker | ||
| PCR Strip Tubes | Any Maker | ||
| Petri Plates 100 mm diameter | Any Maker | ||
| Phenol Red solution | MiliporeSigma | P0290 | for Microinjection |
| Plastic Pestals | VWR | 47747-358 | For IVF |
| Plastic Spoon | Any Maker | For IVF | |
| Premium Grade Brine Shrimp Eggs | Brine Shrimp Direct | Fine Mesh | |
| RNA Gel Loading Dye | found in MEGAshortscript T7 Transcription Kit | For gel electrophoresis | |
| RNAse AWAY | Thermo Fischer Scientific | 21-402-178 | |
| Scale | Any Maker | ||
| Sharpie | Any Maker | ||
| Spatula | Any Maker | ||
| Sterile H2O | Any Maker | For PCR mix | |
| T4 DNA Polymerase | NEB | M0203 | Synthesis of gRNA |
| Tape | Any Maker | ||
| TBE (Tris-Borate-EDTA) 10x | Any Maker | For gel electrophoresis | |
| Tea Stainer | Amazon | IMU-71133W | Fish supplies |
| Thermo Scientific Owl 12-Tooth Comb, 1.0/1.5 mm Thick, Double Sided for B2 | Thermo Fischer Scientific | B2-12 | For gel electrophoresis |
| Thermo Scientific Owl EasyCast B2 Mini Gel Electrophoresis Systems | Thermo Fischer Scientific | 09-528-110B | For gel electrophoresis |
| Thermocycler | Any Maker | ||
| Thermocycler | Any Maker | ||
| Transilluminator | Any Maker | ||
| UV lamp | UVP | Model XX-15 (Cat NO. UVP18006201) | For IVF |
| UV safety glasses | Any Maker | For IVF | |
| Wash Bottle | Thermo Fischer Scientific | S39015 | Fish supplies |
| Zebrafish mating boxes | Aqua Schwarz | SpawningBox1 | Fish supplies |
| 1.5ml Eppendorf Tubes | Fisher Scientific | 05-402-11 | |
| 10 Molar dNTPs | Thermo Fischer Scientific | 18427013 | |
| 100 BP ladder | Thermo Fischer Scientific | 15628019 | |
| 100% RNAse free ethanol | any maker | ||
| 5m Ammonium Accetate | Thermo Fischer Scientific | ||
| 70% Ethanol | 70ml ethanol and 30 ml of nuclease free water | ||
| Accessories for Horizontal Gel Box | Fisher Scientific | 0.625 mm | |
| Agarose | any maker | ||
| CaCl2 | Sigma | 10043-52-4 | |
| CaCl2, dihydrate | Sigma | 10035-04-8 | E3 Medium |
| Capillary Tubing | Cole-Parmer | UX-03010-68 | for injection needles |
| Cas9 Protein | Thermo Fischer Scientific | A36496 | |
| ChopChop | https://chopchop.cbu.uib.no/ | ||
| Computer | any maker | ||
| Dissecting Forcepts | any maker | ||
| Dissecting Microscope | any maker | ||
| Dissecting Scissors | any maker | ||
| DNA Clean & Concentrator -5 | Zymo Research | D4014 | |
| DNA Gel Loading Dye (6X) | Thermo Fischer Scientific | R0611 | |
| EconoTaq DNA Polymerase | Lucigen | 30032-1 | |
| Ensemble | https://useast.ensembl.org/index.html | ||
| Eppendorf Microloader PipetteTips | Fischer Scientific | 10289651 | 20 microliters |
| Ethanol (200 proof, nuclease-free) | any maker | ||
| Ethidium Bromide | Thermo Fischer Scientific | 15585011 | |
| Fish Net | any maker | fine mesh | |
| Frozen Brine Shrimp | LiveAquaria | CD-12018 | fish food |
| Gel Comb (0.625mm) | any maker | ||
| Gel Electropheresis System | any maker | ||
| Gene-Specific oligonucleotide | Integrated DNA Technologies (IDT) | ||
| Glass Capilary Needle | Grainger | 21TZ99 | https://www.grainger.com/product/21TZ99?ef_id=Cj0KCQjw8Ia GBhCHARIsAGIRRYpqsyA3-LUXbpZVq7thnRbroBqQTbrZ_a88 VVcI964LtOC6SFLz4ZYaAhZzEAL w_wcB:G:s&s_kwcid=AL!2966!3! 264955916096!!!g!438976 780705!&gucid=N:N:PS:Paid :GGL:CSM-2295:4P7A1P:20501 231&gclid=Cj0KCQjw8IaGBh CHARIsAGIRRYpqsyA3-LUXbp ZVq7thnRbroBqQTbrZ_a88VVcI 964LtOC6SFLz4ZYaAhZzEALw _wcB&gclsrc=aw.ds |
| Glass Dishes | any maker | ||
| Gloves | any maker | ||
| Hank's Final Working Solution | Combine 9.9 ml of Hank's Premix with 0.1 ml HS Stock #6 | ||
| Hank's Premix | combine the following in order: (1) 10.0 ml HS #1, (2) 1.0 ml HS#2, (3) 1.0 ml HS#4, (4) 86 ml ddH2O, (5) 1.0 ml HS#5. Store all HS Solotions at 4C | ||
| Hanks Solution | |||
| Hank's Solution | https://www.jove.com/pdf-materials/51708/jove-materials-51708-production-of-haploid-zebrafish-embryos-by-in-vitro-fertilization | ||
| Hank's Stock Solution #1 | 8.0 g NaCl, 0.4 g KCl in 100 ml ddH2O | ||
| Hank's Stock Solution #2 | 0.358 g Na2HPO4 anhydrous; 0.60 g K2H2PO4 in 100 ml ddH2O | ||
| Hank's Stock Solution #4 | 0.72 g CaCl2 in 50 ml ddH2O | ||
| Hank's Stock Solution #5 | 1.23 g MgSO47H2O in 50 ml ddH20 | ||
| Hank's Stock Solution #6 | 0.35g NaHCO3 in 10.0 ml ddH20; make fresh day of use | ||
| HCl | Sigma | 7647-01-0 | |
| Ice Bucket | any maker | ||
| Instant Ocean salt | any maker | for fish water | |
| In-Vitro Transcription Kit Mega Short Script | Thermo Fischer Scientific | AM1354 | |
| Invitrogen™ UltraPure™ DNase/RNase-Free Distilled Water | Fisher Scientific | 10-977-023 | |
| KCl | Sigma | 7447-40-7 | E3 Medium |
| KH2PO4 | Sigma | 7778-77-0 | |
| Kimwipes | Fisher Scientific | 06-666 | |
| Male and Female zebrafish | |||
| Mega Short Script T7 Transciption Kit | Thermo Fischer Scientific | AM1354 | |
| methylene blue | Fisher Scientific | AC414240250 | E3 Medium |
| MgSO2-7H2O | Sigma | M2773 | |
| Microimicromanipulator | |||
| Microinjection plastic mold | World Precision Instruments | Z-Molds | |
| Microinjector | |||
| Microneedle Slide | |||
| Micropipeter (1-10) with tips | any maker | need filtered p10 tips | |
| Micropipetter (20-200) with tips | any maker | ||
| Micropippetter (100-1000) with tips | any maker | ||
| Microplastic slide | |||
| Microwave | any maker | ||
| MiliQ Water | any maker | ||
| mineral oil | sigma-aldrich | m5904-5ml | |
| Na2HPO4 | Sigma | ||
| NaCl | Sigma | S9888 | |
| NaHC02 | Sigma | 223441 | |
| Nanodrop | |||
| NaOH | Sigma | 567530 | |
| Narrow Spatula | any maker | ||
| Needle Puller | Sutter | P-97 | |
| Paper Towel | any maker | ||
| Pastro Pipettes | Fisher Scientific | 13-678-20A | |
| PCR primer flanking guide site | Integrated DNA Technologies (IDT) | ||
| PCR primers flanking guide RNA cut site | Integrated DNA Technologies (IDT) | Standard desalted | |
| PCR Strip Tubes | Thermo Fischer Scientific | AB0771W | |
| Petri Dishes | Fisher Scientific | FB0875714 | 10 cm diameter 100mm x 15mm |
| Phenol Red | Fisher Science | S25464 | https://www.fishersci.com/shop/products/phenol-red-indicator-solution-0-02-w-v-2/S25464 |
| Pipette Tips | any maker | 10ul, 200ul and 1000ul tips | |
| Plastic Pestals | Fisher Scientific | 12-141-364 | |
| Plastic Spoon | any maker | ||
| Primer Guide Site | Integrated DNA Technologies (IDT) | ||
| Razor Blade | Uline | H-595B | |
| RNA gel Loading Dye | in megashort script kit(in vitro transciption kit) | ||
| RNAse away | Fisher | 21-402-178 | |
| RNAse free polypropylene microcentrifuge tubes | Thermo Fischer Scientific | AM12400 | https://www.thermofisher.com/order/catalog/product/AM12400#/AM12400 |
| RNAse free water | Fisher Scientific | 10-977-023 | |
| Scale | any maker | ||
| Sharpie | any maker | ||
| Sodium bicarbonate (cell culture tested) | Sigma | S5761 | fish water |
| Sodium Bromide Solotion | Sigma | E1510 | |
| Software for sanger sequencing Analysis | |||
| Spectrophotometer | |||
| Sterlie H2O | any brand | ||
| T4 DNA Polymerase | NEB | M0203S | https://www.neb.com/products/m0203-t4-dna-polymerase#Product%20Information |
| Tape | any brand | ||
| TBE (Tris-Borate-EDTA) 10X | Thermo Fischer Scientific | B52 | https://www.thermofisher.com/order/catalog/product/B52#/B52 |
| Tea Stainer | amazon | IMU-71133W | avaible in most kitchen stores |
| Thermocycler | |||
| Transfer Pipette | Uline | S-24320 | |
| Transilluminator | |||
| Tricaine | fisher scientific | NC0872873 | |
| Tris HCl 7.5 | Thermo Fischer Scientific | 15567027 | |
| Universal Primer | Integrated DNA Technologies (IDT) | AAAAGCACCGACTCGGTGCCAC TTTTTCAAGTTGATAACGGACTAG CCTTATTTTAACTTGCTATTTCTA GCTCTAAAAC |
|
| UV lamp | UVP | ||
| UV safety glasses | any maker | ||
| Wash Bottle | fisher scientific | S39015 | |
| Zebrafish mating boxes | any maker | ||
| PCR Buffer Recipe | Add 171.12mL sterile H20; 0.393 mL 1M MgCl2; 2.616mL 1M MgCl2; 2.618 mL 1M Tris-HCl (pH 8.4) 13.092mL 1M KCl; 0.262 mL 1% Gelatin. Autoclave for 20 minutes then chill the solotion on ice. Next add 3.468 mL 100mg/mL BSA; 0.262 mL dATP (100mM), 0.262mL dCTP (100mM); 0.262 mL dGTP (100mM); 0.262 mL dTTP (100mL). Alliquote into sterile eppendorf tubes |
Referências
- Pelegri, F. Maternal factors in zebrafish development. Developmental Dynamics. 228 (3), 535-554 (2003).
- Campbell, P. D., Heim, A. E., Smith, M. Z., Marlow, F. L. Kinesin-1 interacts with Bucky ball to form germ cells and is required to pattern the zebrafish body axis. Development. 142 (17), 2996-3008 (2015).
- Eno, C., Solanki, B., Pelegri, F. aura (mid1ip1l) regulates the cytoskeleton at the zebrafish egg-to-embryo transition. Development. 143 (9), 1585-1599 (2016).
- He, W. -. X., et al. Oocyte-specific maternal Slbp2 is required for replication-dependent histone storage and early nuclear cleavage in zebrafish oogenesis and embryogenesis. RNA. 24 (12), 1738-1748 (2018).
- Burger, A., et al. Maximizing mutagenesis with solubilized CRISPR-Cas9 ribonucleoprotein complexes. Development. 143 (11), 2025-2037 (2016).
- Jao, L. -. E., Wente, S. R., Chen, W. Efficient multiplex biallelic zebrafish genome editing using a CRISPR nuclease system. Proceedings of the National Academy of Sciences of the United States of America. 110 (34), 13904-13909 (2013).
- Shah, A. N., Davey, C. F., Whitebirch, A. C., Miller, A. C., Moens, C. B. Rapid reverse genetic screening using CRISPR in zebrafish. Nature Methods. 12 (6), 535-540 (2015).
- Shankaran, S. S., Dahlem, T. J., Bisgrove, B. W., Yost, H. J., Tristani-Firouzi, M. CRISPR/Cas9-directed gene editing for the generation of loss-of-function mutants in high-throughput zebrafish F0 screens. Current Protocols in Molecular Biology. 119 (1), 1-22 (2017).
- Trubiroha, A., et al. A Rapid CRISPR/Cas-based mutagenesis assay in zebrafish for identification of genes involved in thyroid morphogenesis and function. Scientific Reports. 8 (1), 5647 (2018).
- Wu, R. S., Lam, I. I., Clay, H., Duong, D. N., Deo, R. C., Coughlin, S. R. A Rapid method for directed gene knockout for screening in G0 zebrafish. Developmental Cell. 46 (1), 112-125 (2018).
- Moravec, C. E., Voit, G. C., Otterlee, J., Pelegri, F. Identification of maternal-effect genes in zebrafish using maternal crispants. Development. 148 (19), 199536 (2021).
- Braat, A. K., Zandbergen, T., van de Water, S., Goos, H. J., Zivkovic, D. Characterization of zebrafish primordial germ cells: morphology and early distribution of vasa RNA. Developmental Dynamics: An Official Publication of the American Association of Anatomists. 216 (2), 153-167 (1999).
- Eno, C., Hansen, C. L., Pelegri, F. Aggregation, segregation, and dispersal of homotypic germ plasm RNPs in the early zebrafish embryo. Developmental Dynamics. 248 (4), 306-318 (2019).
- Knaut, H., Steinbeisser, H., Schwarz, H., Nüsslein-Volhard, C. An evolutionary conserved region in the vasa 3’UTR targets RNA translation to the germ cells in the zebrafish. Current biology: CB. 12 (6), 454-466 (2002).
- Yoon, C., Kawakami, K., Hopkins, N. Zebrafish vasa homologue RNA is localized to the cleavage planes of 2- and 4-cell-stage embryos and is expressed in the primordial germ cells. Development. 124 (16), 3157-3165 (1997).
- Gagnon, J. A., et al. Efficient mutagenesis by Cas9 protein-mediated oligonucleotide insertion and large-scale assessment of single-guide RNAs. PLoS ONE. 9 (5), 98186 (2014).
- Labun, K., Montague, T. G., Gagnon, J. A., Thyme, S. B., Valen, E. CHOPCHOP v2: a web tool for the next generation of CRISPR genome engineering. Nucleic Acids Research. 44, 272-276 (2016).
- Labun, K., Montague, T. G., Krause, M., Torres Cleuren, Y. N., Tjeldnes, H., Valen, E. CHOPCHOP v3: expanding the CRISPR web toolbox beyond genome editing. Nucleic Acids Research. 47, 171-174 (2019).
- Montague, T. G., Cruz, J. M., Gagnon, J. A., Church, G. M., Valen, E. CHOPCHOP: a CRISPR/Cas9 and TALEN web tool for genome editing. Nucleic Acids Research. 42, 401-407 (2014).
- Moravec, C. E., Pelegri, F. J. An accessible protocol for the generation of CRISPR-Cas9 knockouts using INDELs in zebrafish. Methods in Molecular Biology. 1920, 377-392 (2019).
- White, R. J., et al. A high-resolution mRNA expression time course of embryonic development in zebrafish. eLife. 6, 30860 (2017).
- Aanes, H., et al. Zebrafish mRNA sequencing deciphers novelties in transcriptome dynamics during maternal to zygotic transition. Genome Research. 21 (8), 1328-1338 (2011).
- Aken, B. L., et al. The Ensembl gene annotation system. Database: The Journal of Biological Databases and Curation. 2016, (2016).
- Sorlien, E. L., Witucki, M. A., Ogas, J. Efficient production and identification of CRISPR/Cas9-generated gene knockouts in the model system Danio rerio. Journal of Visualized Experiments: JoVE. (138), e56969 (2018).
- Kotani, H., Taimatsu, K., Ohga, R., Ota, S., Kawahara, A. efficient multiple genome modifications induced by the crRNAs, tracrRNA and Cas9 protein complex in zebrafish. PloS One. 10 (5), 0128319 (2015).
- Rosen, J. N., Sweeney, M. F., Mably, J. D. Microinjection of zebrafish embryos to analyze gene function. Journal of Visualized Experiments: JoVE. (25), e1115 (2009).
- Xu, Q. Microinjection into zebrafish embryos. Methods in Molecular Biology. 127, 125-132 (1999).
- Biology Mouse, ., Zebrafish, , Chick, Biology: Mouse, Zebrafish, and Chick. Zebrafish Microinjection Techniques. JoVE Science Education Database. , (2021).
- Kimmel, C. B., Ballard, W. W., Kimmel, S. R., Ullmann, B., Schilling, T. F. Stages of embryonic development of the zebrafish. Developmental Dynamics: An Official Publication of the American Association of Anatomists. 203 (3), 253-310 (1995).
- D’Agostino, Y., et al. A rapid and cheap methodology for CRISPR/Cas9 zebrafish mutant screening. Molecular Biotechnology. 58 (1), 73-78 (2016).
- Baars, D. L., Takle, K. A., Heier, J., Pelegri, F. Ploidy manipulation of zebrafish embryos with Heat Shock 2 treatment. Journal of Visualized Experiments: JoVE. (118), e54492 (2016).
- Nair, S., Lindeman, R. E., Pelegri, F. In vitro oocyte culture-based manipulation of zebrafish maternal genes. Developmental Dynamics: An Official Publication of the American Association of Anatomists. 242 (1), 44-52 (2013).
- Kushawah, G., et al. CRISPR-Cas13d induces efficient mRNA knockdown in animal embryos. Developmental Cell. 54 (6), 805-817 (2020).
- Kroeger, P. T., Poureetezadi, S. J., McKee, R., Jou, J., Miceli, R., Wingert, R. A. Production of haploid zebrafish embryos by in vitro fertilization. Journal of Visualized Experiments: JoVE. (89), e51708 (2014).
- Xiao, T., Roeser, T., Staub, W., Baier, H. A GFP-based genetic screen reveals mutations that disrupt the architecture of the zebrafish retinotectal projection. Development. 132 (13), 2955-2967 (2005).
- Riemer, S., Bontems, F., Krishnakumar, P., Gömann, J., Dosch, R. A functional Bucky ball-GFP transgene visualizes germ plasm in living zebrafish. Gene Expression Patterns: GEP. 18 (1-2), 44-52 (2015).
- Moreno-Mateos, M. A., et al. CRISPRscan: designing highly efficient sgRNAs for CRISPR-Cas9 targeting in vivo. Nature Methods. 12 (10), 982-988 (2015).
