Het bepalen van de rol van maternale tot expressie gebrachte genen in de vroege ontwikkeling met maternale crispants
Summary
Vroege ontwikkeling is afhankelijk van moederlijk overgeërfde producten en de rol van veel van deze producten is momenteel onbekend. Hierin beschreven we een protocol dat CRISPR-Cas9 gebruikt om fenotypen met maternale effecten in een enkele generatie te identificeren.
Abstract
Vroege ontwikkeling hangt af van een pool van maternale factoren die tijdens oogenese in de volwassen eicel zijn opgenomen en die alle cellulaire functies uitvoeren die nodig zijn voor de ontwikkeling tot zygotische genoomactivering. Typisch vereist genetische targeting van deze maternale factoren een extra generatie om fenotypen met maternale effecten te identificeren, waardoor het vermogen om de rol van maternale tot expressie gebrachte genen tijdens de ontwikkeling te bepalen, wordt belemmerd. De ontdekking van de biallelische bewerkingsmogelijkheden van CRISPR-Cas9 heeft screening van embryonale fenotypes in somatische weefsels van geïnjecteerde embryo’s of “crispants” mogelijk gemaakt, waardoor het begrip van de rol die zygotisch tot expressie gebrachte genen spelen in ontwikkelingsprogramma’s wordt vergroot. Dit artikel beschrijft een protocol dat in het verlengde ligt van de crispantmethode. In deze methode maakt de biallelische bewerking van geslachtscellen de isolatie van een fenotype met moedereffect in een enkele generatie mogelijk, of “maternale crispants”. Multiplexing leidt RNA’s naar een enkel doelwit bevordert de efficiënte productie van maternale crispants, terwijl sequentieanalyse van maternale crispant haploïden een eenvoudige methode biedt om genetische laesies te bevestigen die een fenotype met maternale effecten produceren. Het gebruik van maternale crispants ondersteunt de snelle identificatie van essentiële maternale tot expressie gebrachte genen, waardoor het begrip van vroege ontwikkeling wordt vergemakkelijkt.
Introduction
Een pool van maternale afgezette producten (bijv. RNA’s, eiwitten en andere biomoleculen) is noodzakelijk voor alle vroege cellulaire processen totdat het zygote genoom van het embryo wordt geactiveerd1. De voortijdige uitputting van deze producten uit de eicel is typisch embryonaal dodelijk. Ondanks het belang van deze genen in de ontwikkeling, is de rol van veel moederlijk tot expressie gebrachte genen momenteel onbekend. Vooruitgang in genbewerkingstechnologie in zebravissen, zoals CRISPR-Cas9, maakt het mogelijk om moederlijk tot expressie gebrachte genente richten 2,3,4. De identificatie van een fenotype met maternale effecten vereist echter een extra generatie in vergelijking met een zygotisch fenotype, waardoor meer middelen nodig zijn. Onlangs is de biallelische bewerkingsmogelijkheid van CRISPR-Cas9 gebruikt om te screenen op embryonale fenotypen in somatische weefsels van geïnjecteerde (F0) embryo’s, bekend als “crispants”5,6,7,8,9,10. De crispant-techniek maakt resource-efficiënte screening van kandidaatgenen in somatische cellen mogelijk, waardoor het begrip van specifieke aspecten in ontwikkeling wordt vergemakkelijkt. Het protocol dat in dit artikel wordt beschreven, maakt de identificatie mogelijk van fenotypen met maternale effecten, of “maternale crispants”, in een enkele generatie11. Dit schema is haalbaar door RNA’s te multiplexen naar een enkel gen en biallelische bewerkingsgebeurtenissen in de kiembaan te bevorderen. Deze maternale crispante embryo’s kunnen worden geïdentificeerd door grove morfologische fenotypen en ondergaan primaire karakterisering, zoals etikettering voor celgrenzen en DNA-patronen11. Gecombineerde analyse van het waarneembare fenotype en elementaire moleculaire karakterisering van de geïnduceerde INDELs maakt het mogelijk om de rol van het beoogde gen in de vroege ontwikkeling te voorspellen.
Bij zebravissen ontwikkelt zich tijdens de eerste 24 uur na de bevruchting (hpf) een kleine groep cellen tot de primordiale geslachtscellen, een voorloper van de kiembaan 12,13,14,15. In klauwen gelegd door F0-vrouwtjes hangt het aandeel van de maternale crispant-embryo’s die worden hersteld af van het aantal geslachtscellen dat een biallelische bewerkingsgebeurtenis in het beoogde gen bevat. Over het algemeen geldt dat hoe eerder de bewerkingsgebeurtenis in het embryo plaatsvindt, hoe groter de kans dat CRISPR-Cas9-mutaties in de kiembaan worden waargenomen. In de meeste gevallen zijn de fenotypen van maternale crispante embryo’s afkomstig van het verlies van functie in de twee maternale allelen die aanwezig zijn in de zich ontwikkelende eicel. Naarmate de eicel meiose voltooit, wordt een van de maternale allelen via het polaire lichaam uit het embryo geëxtrudeerd, terwijl het andere allel wordt opgenomen in de maternale pronucleus. De sequencing van meerdere maternale crispante haploïden vertegenwoordigt een mengsel van de mutaties (inserties en/of deleties (INDELs)) die aanwezig zijn in de kiembaan en die bijdragen aan fenotype11.
Het volgende protocol beschrijft de noodzakelijke stappen om CRISPR-Cas9-mutaties in maternale-effectgenen te creëren en het overeenkomstige fenotype te identificeren met behulp van een maternale crispantbenadering (figuur 1). In sectie één wordt uitgelegd hoe u effectief gids-RNA’s kunt ontwerpen en maken, terwijl secties twee en drie kritieke stappen bevatten voor het maken van maternale crispants door micro-injectie. Na het injecteren van het CRISPR-Cas9 mengsel worden geïnjecteerde embryo’s gescreend op somatische bewerkingen via PCR (sectie vier). Zodra de geïnjecteerde F0-embryo’s zich ontwikkelen en geslachtsrijp zijn, worden de F0-vrouwtjes gekruist met mannetjes van het wilde type en worden hun nakomelingen gescreend op fenotypen met maternale effecten (sectie vijf). Sectie zes bevat instructies voor het maken van maternale crispante haploïden die kunnen worden gecombineerd met Sanger-sequencing om de CRISPR-Cas9-geïnduceerde INDELs te identificeren. Daarnaast bevat de discussie wijzigingen die in het protocol kunnen worden aangebracht om de gevoeligheid en kracht van deze methode te vergroten.
Protocol
Representative Results
Discussion
Het protocol dat in dit manuscript wordt gepresenteerd, maakt de identificatie en primaire moleculaire karakterisering van een fenotype met moedereffect in een enkele generatie mogelijk in plaats van de meerdere generaties die nodig zijn voor zowel voorwaartse als omgekeerde genetische technieken. Momenteel is de rol van veel moederlijk tot expressie gebrachte genen onbekend. Dit gebrek aan kennis is deels te wijten aan de extra generatie die nodig is om een fenotype te visualiseren bij het identificeren van maternale-ef…
Declarações
The authors have nothing to disclose.
Acknowledgements
We bedanken voormalige en huidige medewerkers van pelegri lab animal husbandry voor hun zorg voor de waterfaciliteit. We zijn ook dankbaar voor de commentaren en inzichten op het manuscript van Ryan Trevena en Diane Hanson. Financiering werd verstrekt door NIH-subsidie aan F.P. (GM065303)
Materials
| 1 M Tris-HCl (pH 8.4) | Invirogen | 15568025 | For PCR mix |
| 1.5 mL Eppendorf Tubes | Any Maker | ||
| 10 mM dNTPs | Thermo Fischer Scientific | 18427013 | Synthesis of gRNA |
| 100 BP ladder | Any Maker | For gel electrophoresis | |
| 100% RNAse free ethanol | Any Maker | ||
| 100% RNAse free ethanol | Any Maker | ||
| 100ml Beaker | Any Maker | For IVF | |
| 5 M Ammonium Accetate | Thermo Fischer Scientific | Found in the MEGAshortscript T7 Transcription Kit | Synthesis of gRNA |
| 70% Ethanol | Synthesis of gRNA (70 mL of ethanol + 30 mL of nuclease free water) | ||
| Borosil 1.0 mm OD x 0.5 mm ID | FHC INC | 27-30-1 | for Microinjection |
| Bulk Pharma Sodium Bicarbonate 35 pounds | Bulk Reef Supply | 255 | Fish supplies |
| CaCl2 | MiliporeSigma | C7902 | |
| Cas9 Protein with NLS | PNABio | CP01 | |
| ChopChop | https://chopchop.cbu.uib.no/ | ||
| Constant oligonucleotide | Integrated DNA Technologies (IDT) | AAAAGCACCGACTCGGTGCCAC TTTTTCAAGTTGATAACGGACTA GCCTTATTTTAACTTGCTATTTC TAGCTCTAAAAC |
|
| Depression Glass Plate | Thermo Fischer Scientific | 13-748B | For IVF |
| Dissecting Forceps | Dumont | SS | For IVF |
| Dissecting Scissors | Fine Science Tools | 14091-09 | For IVF |
| Dissecting Steroscope( with transmitted light source) | Any Maker | For IVF | |
| DNA Clean & Concentrator -5 | Zymo Research | D4014 | Synthesis of gRNA |
| DNA Gel Loading Dye (6x) | Any Maker | For gel electrophoresis | |
| EconoTaq DNA Polymerase | Lucigen | 30032-1 | For PCR mix |
| Electropheresis Power Supply | Any Maker | For gel electrophoresis | |
| Ensemble | https://useast.ensembl.org/index.html | ||
| Eppendorf Femtotips Microloader Tips for Femtojet Microinjector | Thermo Fischer Scientific | E5242956003 | for Microinjection |
| Ethanol (200 proof, nuclease-free) | Any Maker | ||
| FemtoJet 4i | Eppendorf | 5252000021 | for Microinjection |
| Fish Net | Any Maker | Fish supplies | |
| Frozen Brine Shrimp | Brine Shrimp Direct | Fish supplies | |
| General All Purpose Agarose | Any Maker | For gel electrophoresis | |
| Gene-Specific oligonucleotide | Integrated DNA Technologies (IDT) | TAATACGACTCACTATA- N20 -GTTTTAGAGCTAGAAATAGCAAG | |
| Gloves | Any Maker | ||
| Ice Bucket | Any Maker | ||
| Instant Ocean salt | Any Maker | Fish supplies | |
| Invitrogen UltraPure Ethidium Bromide, 10 mg/mL | Thermo Fischer Scientific | 15-585-011 | |
| KCl | MiliporeSigma | P5405 | |
| KH2PO4 | MiliporeSigma | 7778-77-0 | |
| Kimwipes | Thermo Fischer Scientific | 06-666 | |
| Male & Female zebrafish | |||
| MEGAshortscript T7 Transcription Kit | Thermo Fischer Scientific | AM1354 | Synthesis of gRNA |
| Methylene Blue | Thermo Fischer Scientific | AC414240250 | For E3 |
| MgCl2 | MiliporeSigma | 7791-18-6 | For PCR mix |
| MgSO2·7H2O | MiliporeSigma | M2773 | |
| Microinjection plastic mold | World Precision Instruments | Z-Molds | for Microinjection |
| Micromanipulator | Any Maker | for Microinjection | |
| Micropipeters | Any Maker | ||
| Micropipette Puller | Sutter | P-87 | for Microinjection |
| Micropipetter tips with filters (all sizes) | Any Maker | ||
| Micropippetter tips without filters ( all sizes) | Any Maker | ||
| Microwave | Any Maker | ||
| Mineral Oil | MiliporeSigma | m5904-5ml | for Microinjection |
| MS-222 ( Tricaine-D) | Any Maker | FDA approved | |
| Na2HPO4 | MiliporeSigma | S3264 | |
| NaCl | MiliporeSigma | S5886 | |
| NaHC03 | MiliporeSigma | S5761 | |
| Nanodrop | Any Maker | ||
| NaOH | MiliporeSigma | 567530 | |
| Nonstick, RNase-free Microfuge Tubes, 1.5 mL | Ambion | AM12450 | Synthesis of gRNA |
| nuclease-free water | Any Maker | ||
| Paper Towel | Any Maker | ||
| Pastro Pipettes | Any Maker | ||
| PCR Strip Tubes | Any Maker | ||
| Petri Plates 100 mm diameter | Any Maker | ||
| Phenol Red solution | MiliporeSigma | P0290 | for Microinjection |
| Plastic Pestals | VWR | 47747-358 | For IVF |
| Plastic Spoon | Any Maker | For IVF | |
| Premium Grade Brine Shrimp Eggs | Brine Shrimp Direct | Fine Mesh | |
| RNA Gel Loading Dye | found in MEGAshortscript T7 Transcription Kit | For gel electrophoresis | |
| RNAse AWAY | Thermo Fischer Scientific | 21-402-178 | |
| Scale | Any Maker | ||
| Sharpie | Any Maker | ||
| Spatula | Any Maker | ||
| Sterile H2O | Any Maker | For PCR mix | |
| T4 DNA Polymerase | NEB | M0203 | Synthesis of gRNA |
| Tape | Any Maker | ||
| TBE (Tris-Borate-EDTA) 10x | Any Maker | For gel electrophoresis | |
| Tea Stainer | Amazon | IMU-71133W | Fish supplies |
| Thermo Scientific Owl 12-Tooth Comb, 1.0/1.5 mm Thick, Double Sided for B2 | Thermo Fischer Scientific | B2-12 | For gel electrophoresis |
| Thermo Scientific Owl EasyCast B2 Mini Gel Electrophoresis Systems | Thermo Fischer Scientific | 09-528-110B | For gel electrophoresis |
| Thermocycler | Any Maker | ||
| Thermocycler | Any Maker | ||
| Transilluminator | Any Maker | ||
| UV lamp | UVP | Model XX-15 (Cat NO. UVP18006201) | For IVF |
| UV safety glasses | Any Maker | For IVF | |
| Wash Bottle | Thermo Fischer Scientific | S39015 | Fish supplies |
| Zebrafish mating boxes | Aqua Schwarz | SpawningBox1 | Fish supplies |
| 1.5ml Eppendorf Tubes | Fisher Scientific | 05-402-11 | |
| 10 Molar dNTPs | Thermo Fischer Scientific | 18427013 | |
| 100 BP ladder | Thermo Fischer Scientific | 15628019 | |
| 100% RNAse free ethanol | any maker | ||
| 5m Ammonium Accetate | Thermo Fischer Scientific | ||
| 70% Ethanol | 70ml ethanol and 30 ml of nuclease free water | ||
| Accessories for Horizontal Gel Box | Fisher Scientific | 0.625 mm | |
| Agarose | any maker | ||
| CaCl2 | Sigma | 10043-52-4 | |
| CaCl2, dihydrate | Sigma | 10035-04-8 | E3 Medium |
| Capillary Tubing | Cole-Parmer | UX-03010-68 | for injection needles |
| Cas9 Protein | Thermo Fischer Scientific | A36496 | |
| ChopChop | https://chopchop.cbu.uib.no/ | ||
| Computer | any maker | ||
| Dissecting Forcepts | any maker | ||
| Dissecting Microscope | any maker | ||
| Dissecting Scissors | any maker | ||
| DNA Clean & Concentrator -5 | Zymo Research | D4014 | |
| DNA Gel Loading Dye (6X) | Thermo Fischer Scientific | R0611 | |
| EconoTaq DNA Polymerase | Lucigen | 30032-1 | |
| Ensemble | https://useast.ensembl.org/index.html | ||
| Eppendorf Microloader PipetteTips | Fischer Scientific | 10289651 | 20 microliters |
| Ethanol (200 proof, nuclease-free) | any maker | ||
| Ethidium Bromide | Thermo Fischer Scientific | 15585011 | |
| Fish Net | any maker | fine mesh | |
| Frozen Brine Shrimp | LiveAquaria | CD-12018 | fish food |
| Gel Comb (0.625mm) | any maker | ||
| Gel Electropheresis System | any maker | ||
| Gene-Specific oligonucleotide | Integrated DNA Technologies (IDT) | ||
| Glass Capilary Needle | Grainger | 21TZ99 | https://www.grainger.com/product/21TZ99?ef_id=Cj0KCQjw8Ia GBhCHARIsAGIRRYpqsyA3-LUXbpZVq7thnRbroBqQTbrZ_a88 VVcI964LtOC6SFLz4ZYaAhZzEAL w_wcB:G:s&s_kwcid=AL!2966!3! 264955916096!!!g!438976 780705!&gucid=N:N:PS:Paid :GGL:CSM-2295:4P7A1P:20501 231&gclid=Cj0KCQjw8IaGBh CHARIsAGIRRYpqsyA3-LUXbp ZVq7thnRbroBqQTbrZ_a88VVcI 964LtOC6SFLz4ZYaAhZzEALw _wcB&gclsrc=aw.ds |
| Glass Dishes | any maker | ||
| Gloves | any maker | ||
| Hank's Final Working Solution | Combine 9.9 ml of Hank's Premix with 0.1 ml HS Stock #6 | ||
| Hank's Premix | combine the following in order: (1) 10.0 ml HS #1, (2) 1.0 ml HS#2, (3) 1.0 ml HS#4, (4) 86 ml ddH2O, (5) 1.0 ml HS#5. Store all HS Solotions at 4C | ||
| Hanks Solution | |||
| Hank's Solution | https://www.jove.com/pdf-materials/51708/jove-materials-51708-production-of-haploid-zebrafish-embryos-by-in-vitro-fertilization | ||
| Hank's Stock Solution #1 | 8.0 g NaCl, 0.4 g KCl in 100 ml ddH2O | ||
| Hank's Stock Solution #2 | 0.358 g Na2HPO4 anhydrous; 0.60 g K2H2PO4 in 100 ml ddH2O | ||
| Hank's Stock Solution #4 | 0.72 g CaCl2 in 50 ml ddH2O | ||
| Hank's Stock Solution #5 | 1.23 g MgSO47H2O in 50 ml ddH20 | ||
| Hank's Stock Solution #6 | 0.35g NaHCO3 in 10.0 ml ddH20; make fresh day of use | ||
| HCl | Sigma | 7647-01-0 | |
| Ice Bucket | any maker | ||
| Instant Ocean salt | any maker | for fish water | |
| In-Vitro Transcription Kit Mega Short Script | Thermo Fischer Scientific | AM1354 | |
| Invitrogen™ UltraPure™ DNase/RNase-Free Distilled Water | Fisher Scientific | 10-977-023 | |
| KCl | Sigma | 7447-40-7 | E3 Medium |
| KH2PO4 | Sigma | 7778-77-0 | |
| Kimwipes | Fisher Scientific | 06-666 | |
| Male and Female zebrafish | |||
| Mega Short Script T7 Transciption Kit | Thermo Fischer Scientific | AM1354 | |
| methylene blue | Fisher Scientific | AC414240250 | E3 Medium |
| MgSO2-7H2O | Sigma | M2773 | |
| Microimicromanipulator | |||
| Microinjection plastic mold | World Precision Instruments | Z-Molds | |
| Microinjector | |||
| Microneedle Slide | |||
| Micropipeter (1-10) with tips | any maker | need filtered p10 tips | |
| Micropipetter (20-200) with tips | any maker | ||
| Micropippetter (100-1000) with tips | any maker | ||
| Microplastic slide | |||
| Microwave | any maker | ||
| MiliQ Water | any maker | ||
| mineral oil | sigma-aldrich | m5904-5ml | |
| Na2HPO4 | Sigma | ||
| NaCl | Sigma | S9888 | |
| NaHC02 | Sigma | 223441 | |
| Nanodrop | |||
| NaOH | Sigma | 567530 | |
| Narrow Spatula | any maker | ||
| Needle Puller | Sutter | P-97 | |
| Paper Towel | any maker | ||
| Pastro Pipettes | Fisher Scientific | 13-678-20A | |
| PCR primer flanking guide site | Integrated DNA Technologies (IDT) | ||
| PCR primers flanking guide RNA cut site | Integrated DNA Technologies (IDT) | Standard desalted | |
| PCR Strip Tubes | Thermo Fischer Scientific | AB0771W | |
| Petri Dishes | Fisher Scientific | FB0875714 | 10 cm diameter 100mm x 15mm |
| Phenol Red | Fisher Science | S25464 | https://www.fishersci.com/shop/products/phenol-red-indicator-solution-0-02-w-v-2/S25464 |
| Pipette Tips | any maker | 10ul, 200ul and 1000ul tips | |
| Plastic Pestals | Fisher Scientific | 12-141-364 | |
| Plastic Spoon | any maker | ||
| Primer Guide Site | Integrated DNA Technologies (IDT) | ||
| Razor Blade | Uline | H-595B | |
| RNA gel Loading Dye | in megashort script kit(in vitro transciption kit) | ||
| RNAse away | Fisher | 21-402-178 | |
| RNAse free polypropylene microcentrifuge tubes | Thermo Fischer Scientific | AM12400 | https://www.thermofisher.com/order/catalog/product/AM12400#/AM12400 |
| RNAse free water | Fisher Scientific | 10-977-023 | |
| Scale | any maker | ||
| Sharpie | any maker | ||
| Sodium bicarbonate (cell culture tested) | Sigma | S5761 | fish water |
| Sodium Bromide Solotion | Sigma | E1510 | |
| Software for sanger sequencing Analysis | |||
| Spectrophotometer | |||
| Sterlie H2O | any brand | ||
| T4 DNA Polymerase | NEB | M0203S | https://www.neb.com/products/m0203-t4-dna-polymerase#Product%20Information |
| Tape | any brand | ||
| TBE (Tris-Borate-EDTA) 10X | Thermo Fischer Scientific | B52 | https://www.thermofisher.com/order/catalog/product/B52#/B52 |
| Tea Stainer | amazon | IMU-71133W | avaible in most kitchen stores |
| Thermocycler | |||
| Transfer Pipette | Uline | S-24320 | |
| Transilluminator | |||
| Tricaine | fisher scientific | NC0872873 | |
| Tris HCl 7.5 | Thermo Fischer Scientific | 15567027 | |
| Universal Primer | Integrated DNA Technologies (IDT) | AAAAGCACCGACTCGGTGCCAC TTTTTCAAGTTGATAACGGACTAG CCTTATTTTAACTTGCTATTTCTA GCTCTAAAAC |
|
| UV lamp | UVP | ||
| UV safety glasses | any maker | ||
| Wash Bottle | fisher scientific | S39015 | |
| Zebrafish mating boxes | any maker | ||
| PCR Buffer Recipe | Add 171.12mL sterile H20; 0.393 mL 1M MgCl2; 2.616mL 1M MgCl2; 2.618 mL 1M Tris-HCl (pH 8.4) 13.092mL 1M KCl; 0.262 mL 1% Gelatin. Autoclave for 20 minutes then chill the solotion on ice. Next add 3.468 mL 100mg/mL BSA; 0.262 mL dATP (100mM), 0.262mL dCTP (100mM); 0.262 mL dGTP (100mM); 0.262 mL dTTP (100mL). Alliquote into sterile eppendorf tubes |
Referências
- Pelegri, F. Maternal factors in zebrafish development. Developmental Dynamics. 228 (3), 535-554 (2003).
- Campbell, P. D., Heim, A. E., Smith, M. Z., Marlow, F. L. Kinesin-1 interacts with Bucky ball to form germ cells and is required to pattern the zebrafish body axis. Development. 142 (17), 2996-3008 (2015).
- Eno, C., Solanki, B., Pelegri, F. aura (mid1ip1l) regulates the cytoskeleton at the zebrafish egg-to-embryo transition. Development. 143 (9), 1585-1599 (2016).
- He, W. -. X., et al. Oocyte-specific maternal Slbp2 is required for replication-dependent histone storage and early nuclear cleavage in zebrafish oogenesis and embryogenesis. RNA. 24 (12), 1738-1748 (2018).
- Burger, A., et al. Maximizing mutagenesis with solubilized CRISPR-Cas9 ribonucleoprotein complexes. Development. 143 (11), 2025-2037 (2016).
- Jao, L. -. E., Wente, S. R., Chen, W. Efficient multiplex biallelic zebrafish genome editing using a CRISPR nuclease system. Proceedings of the National Academy of Sciences of the United States of America. 110 (34), 13904-13909 (2013).
- Shah, A. N., Davey, C. F., Whitebirch, A. C., Miller, A. C., Moens, C. B. Rapid reverse genetic screening using CRISPR in zebrafish. Nature Methods. 12 (6), 535-540 (2015).
- Shankaran, S. S., Dahlem, T. J., Bisgrove, B. W., Yost, H. J., Tristani-Firouzi, M. CRISPR/Cas9-directed gene editing for the generation of loss-of-function mutants in high-throughput zebrafish F0 screens. Current Protocols in Molecular Biology. 119 (1), 1-22 (2017).
- Trubiroha, A., et al. A Rapid CRISPR/Cas-based mutagenesis assay in zebrafish for identification of genes involved in thyroid morphogenesis and function. Scientific Reports. 8 (1), 5647 (2018).
- Wu, R. S., Lam, I. I., Clay, H., Duong, D. N., Deo, R. C., Coughlin, S. R. A Rapid method for directed gene knockout for screening in G0 zebrafish. Developmental Cell. 46 (1), 112-125 (2018).
- Moravec, C. E., Voit, G. C., Otterlee, J., Pelegri, F. Identification of maternal-effect genes in zebrafish using maternal crispants. Development. 148 (19), 199536 (2021).
- Braat, A. K., Zandbergen, T., van de Water, S., Goos, H. J., Zivkovic, D. Characterization of zebrafish primordial germ cells: morphology and early distribution of vasa RNA. Developmental Dynamics: An Official Publication of the American Association of Anatomists. 216 (2), 153-167 (1999).
- Eno, C., Hansen, C. L., Pelegri, F. Aggregation, segregation, and dispersal of homotypic germ plasm RNPs in the early zebrafish embryo. Developmental Dynamics. 248 (4), 306-318 (2019).
- Knaut, H., Steinbeisser, H., Schwarz, H., Nüsslein-Volhard, C. An evolutionary conserved region in the vasa 3’UTR targets RNA translation to the germ cells in the zebrafish. Current biology: CB. 12 (6), 454-466 (2002).
- Yoon, C., Kawakami, K., Hopkins, N. Zebrafish vasa homologue RNA is localized to the cleavage planes of 2- and 4-cell-stage embryos and is expressed in the primordial germ cells. Development. 124 (16), 3157-3165 (1997).
- Gagnon, J. A., et al. Efficient mutagenesis by Cas9 protein-mediated oligonucleotide insertion and large-scale assessment of single-guide RNAs. PLoS ONE. 9 (5), 98186 (2014).
- Labun, K., Montague, T. G., Gagnon, J. A., Thyme, S. B., Valen, E. CHOPCHOP v2: a web tool for the next generation of CRISPR genome engineering. Nucleic Acids Research. 44, 272-276 (2016).
- Labun, K., Montague, T. G., Krause, M., Torres Cleuren, Y. N., Tjeldnes, H., Valen, E. CHOPCHOP v3: expanding the CRISPR web toolbox beyond genome editing. Nucleic Acids Research. 47, 171-174 (2019).
- Montague, T. G., Cruz, J. M., Gagnon, J. A., Church, G. M., Valen, E. CHOPCHOP: a CRISPR/Cas9 and TALEN web tool for genome editing. Nucleic Acids Research. 42, 401-407 (2014).
- Moravec, C. E., Pelegri, F. J. An accessible protocol for the generation of CRISPR-Cas9 knockouts using INDELs in zebrafish. Methods in Molecular Biology. 1920, 377-392 (2019).
- White, R. J., et al. A high-resolution mRNA expression time course of embryonic development in zebrafish. eLife. 6, 30860 (2017).
- Aanes, H., et al. Zebrafish mRNA sequencing deciphers novelties in transcriptome dynamics during maternal to zygotic transition. Genome Research. 21 (8), 1328-1338 (2011).
- Aken, B. L., et al. The Ensembl gene annotation system. Database: The Journal of Biological Databases and Curation. 2016, (2016).
- Sorlien, E. L., Witucki, M. A., Ogas, J. Efficient production and identification of CRISPR/Cas9-generated gene knockouts in the model system Danio rerio. Journal of Visualized Experiments: JoVE. (138), e56969 (2018).
- Kotani, H., Taimatsu, K., Ohga, R., Ota, S., Kawahara, A. efficient multiple genome modifications induced by the crRNAs, tracrRNA and Cas9 protein complex in zebrafish. PloS One. 10 (5), 0128319 (2015).
- Rosen, J. N., Sweeney, M. F., Mably, J. D. Microinjection of zebrafish embryos to analyze gene function. Journal of Visualized Experiments: JoVE. (25), e1115 (2009).
- Xu, Q. Microinjection into zebrafish embryos. Methods in Molecular Biology. 127, 125-132 (1999).
- Biology Mouse, ., Zebrafish, , Chick, Biology: Mouse, Zebrafish, and Chick. Zebrafish Microinjection Techniques. JoVE Science Education Database. , (2021).
- Kimmel, C. B., Ballard, W. W., Kimmel, S. R., Ullmann, B., Schilling, T. F. Stages of embryonic development of the zebrafish. Developmental Dynamics: An Official Publication of the American Association of Anatomists. 203 (3), 253-310 (1995).
- D’Agostino, Y., et al. A rapid and cheap methodology for CRISPR/Cas9 zebrafish mutant screening. Molecular Biotechnology. 58 (1), 73-78 (2016).
- Baars, D. L., Takle, K. A., Heier, J., Pelegri, F. Ploidy manipulation of zebrafish embryos with Heat Shock 2 treatment. Journal of Visualized Experiments: JoVE. (118), e54492 (2016).
- Nair, S., Lindeman, R. E., Pelegri, F. In vitro oocyte culture-based manipulation of zebrafish maternal genes. Developmental Dynamics: An Official Publication of the American Association of Anatomists. 242 (1), 44-52 (2013).
- Kushawah, G., et al. CRISPR-Cas13d induces efficient mRNA knockdown in animal embryos. Developmental Cell. 54 (6), 805-817 (2020).
- Kroeger, P. T., Poureetezadi, S. J., McKee, R., Jou, J., Miceli, R., Wingert, R. A. Production of haploid zebrafish embryos by in vitro fertilization. Journal of Visualized Experiments: JoVE. (89), e51708 (2014).
- Xiao, T., Roeser, T., Staub, W., Baier, H. A GFP-based genetic screen reveals mutations that disrupt the architecture of the zebrafish retinotectal projection. Development. 132 (13), 2955-2967 (2005).
- Riemer, S., Bontems, F., Krishnakumar, P., Gömann, J., Dosch, R. A functional Bucky ball-GFP transgene visualizes germ plasm in living zebrafish. Gene Expression Patterns: GEP. 18 (1-2), 44-52 (2015).
- Moreno-Mateos, M. A., et al. CRISPRscan: designing highly efficient sgRNAs for CRISPR-Cas9 targeting in vivo. Nature Methods. 12 (10), 982-988 (2015).
