초기 개발은 모계 유전 제품에 의존하며 이러한 제품 중 많은 부분의 역할은 현재 알려져 있지 않습니다. 여기에서는 CRISPR-Cas9를 사용하여 단일 세대에서 모성 효과 표현형을 식별하는 프로토콜을 설명했습니다.
초기 발달은 접합체 게놈 활성화까지 발달에 필요한 모든 세포 기능을 수행하는 난자 형성 동안 성숙한 난모세포에 통합된 모체 인자 풀에 의존합니다. 일반적으로 이러한 모성 인자의 유전 적 표적화는 모성 효과 표현형을 식별하기 위해 추가 세대를 필요로하며, 발달 중에 모성 발현 유전자의 역할을 결정하는 능력을 방해합니다. CRISPR-Cas9의 이중 대립 유전자 편집 능력의 발견은 주입 된 배아 또는 “크리스펫”의 체세포 조직에서 배아 표현형을 스크리닝 할 수있게하여 발달 프로그램에서 접합 발현 유전자가하는 역할에 대한 이해를 높였습니다. 이 문서에서는 크리스펀트 방법의 확장인 프로토콜에 대해 설명합니다. 이 방법에서, 생식 세포의 이중 대립 유전자 편집은 단일 세대 또는 “모체 크리스펫”에서 모성 효과 표현형의 분리를 허용합니다. 단일 표적에 대한 가이드 RNA를 멀티플렉싱하면 모체 크리스펀트의 효율적인 생산을 촉진하는 반면, 모체 크리스펀트 반수체의 서열 분석은 모체 효과 표현형을 생성하는 유전적 병변을 확증하는 간단한 방법을 제공합니다. 모체 크리스펀트의 사용은 필수 모계 발현 유전자의 신속한 식별을 지원하여 조기 발달에 대한 이해를 용이하게합니다.
모계로 축적된 산물(예: RNA, 단백질 및 기타 생체 분자) 풀은 배아의 접합체 게놈이 활성화될 때까지 모든 초기 세포 과정에 필요합니다1. 난 모세포에서 이러한 생성물의 조기 고갈은 일반적으로 배아 치명적입니다. 발달에서 이러한 유전자의 중요성에도 불구하고, 많은 모계 발현 유전자의 역할은 현재 알려지지 않았습니다. CRISPR-Cas9와 같은 제브라피쉬의 유전자 편집 기술의 발전은 모계에서 발현된 유전자 2,3,4의 표적화를 가능하게 합니다. 그러나 모성 효과 표현형의 식별은 접합 표현형과 비교할 때 추가 세대가 필요하므로 더 많은 자원이 필요합니다. 최근 CRISPR-Cas9의 이중 대립 유전자 편집 능력은 “크리스프 판트”5,6,7,8,9,10으로 알려진 주입 된 (F0) 배아의 체세포 조직에서 배아 표현형을 스크리닝하는 데 사용되었습니다. 크리스펀트 기술은 체세포에서 후보 유전자의 자원 효율적인 스크리닝을 허용하여 발달의 특정 측면에 대한 이해를 용이하게 합니다. 이 논문에 설명된 프로토콜은 단일 세대에서 모성 효과 표현형 또는 “모성 크리스펫”의 식별을 허용합니다11. 이 계획은 가이드 RNA를 단일 유전자로 멀티플렉싱하고 생식계열에서 이대립유전자 편집 이벤트를 촉진함으로써 달성할 수 있습니다. 이들 모체 크리스펀트 배아는 총 형태학적 표현형에 의해 확인될 수 있고, 세포 경계 및 DNA 패터닝(11)에 대한 표지와 같은 1차 특성화를 거친다. 관찰 가능한 표현형과 유도된 INDEL의 기본 분자 특성화의 결합 분석을 통해 초기 발달에서 표적 유전자의 역할을 예측할 수 있습니다.
제브라 피쉬에서는 수정 후 처음 24 시간 (hpf) 동안 작은 세포 그룹이 생식선12,13,14,15의 전구체 인 원시 생식 세포로 발전합니다. F0 암컷이 놓은 클러치에서 회수된 모체 크리스펀트 배아의 비율은 표적 유전자에 이대립유전자 편집 이벤트가 포함된 생식 세포의 수에 따라 달라집니다. 일반적으로 배아에서 편집 사건이 일찍 발생할수록 생식계열에서 CRISPR-Cas9 돌연변이가 관찰될 확률이 높아집니다. 대부분의 경우, 모체 크리스펀트 배아의 표현형은 발달중인 난 모세포에 존재하는 두 개의 모체 대립 유전자의 기능 상실에서 비롯됩니다. 난 모세포가 감수 분열을 마치면 모체 대립 유전자 중 하나가 극체를 통해 배아에서 돌출되고 다른 대립 유전자는 모체 전핵에 통합됩니다. 다수의 모체 크리스펀트 반수체의 시퀀싱은 표현형11에 기여하는 생식계열에 존재하는 돌연변이(삽입 및/또는 결실(INDEL))의 혼합물을 나타낼 것이다.
다음 프로토콜은 모성 효과 유전자에서 CRISPR-Cas9 돌연변이를 생성하고 모체 크리스펀트 접근법을 사용하여 해당 표현형을 식별하는 데 필요한 단계를 설명합니다(그림 1). 섹션 1은 가이드 RNA를 효과적으로 설계하고 생성하는 방법을 설명하고 섹션 2와 3에는 미세 주입으로 산모의 크리스펀트를 만드는 중요한 단계가 포함되어 있습니다. CRISPR-Cas9 혼합물을 주입한 후, 주입된 배아는 PCR을 통해 체세포 편집을 위해 스크리닝됩니다(섹션 4). 주입된 F0 배아가 발달하여 성적으로 성숙되면 F0 암컷을 야생형 수컷으로 교배하고 자손을 대상으로 모성 효과 표현형을 선별합니다(섹션 5). 섹션 6에는 CRISPR-Cas9 유도 INDEL을 식별하기 위해 Sanger 시퀀싱과 결합할 수 있는 모체 크리스펀트 반수체를 만드는 방법에 대한 지침이 포함되어 있습니다. 또한 토론에는 이 방법의 민감도와 성능을 높이기 위해 프로토콜에 적용할 수 있는 수정 사항이 포함되어 있습니다.
이 원고에 제시된 프로토콜은 정방향 및 역방향 유전 기술 모두에 필요한 여러 세대 대신 단일 세대에서 모성 효과 표현형의 식별 및 1 차 분자 특성화를 허용합니다. 현재, 많은 모계 발현 유전자의 역할은 알려져 있지 않다. 이러한 지식 부족은 부분적으로 모성 효과 유전자를 식별 할 때 표현형을 시각화하는 데 필요한 추가 세대 때문입니다. 과거에, 제브라피쉬에서 모성 효과 유전자의 신속한 …
The authors have nothing to disclose.
수생 시설을 돌봐 주신 전현직 Pelegri 실험실 축산 직원들에게 감사드립니다. 우리는 또한 Ryan Trevena와 Diane Hanson의 원고에 대한 의견과 통찰력에 감사드립니다. 자금은 FP에 대한 NIH 보조금으로 제공되었습니다 (GM065303).
1 M Tris-HCl (pH 8.4) | Invirogen | 15568025 | For PCR mix |
1.5 mL Eppendorf Tubes | Any Maker | ||
10 mM dNTPs | Thermo Fischer Scientific | 18427013 | Synthesis of gRNA |
100 BP ladder | Any Maker | For gel electrophoresis | |
100% RNAse free ethanol | Any Maker | ||
100% RNAse free ethanol | Any Maker | ||
100ml Beaker | Any Maker | For IVF | |
5 M Ammonium Accetate | Thermo Fischer Scientific | Found in the MEGAshortscript T7 Transcription Kit | Synthesis of gRNA |
70% Ethanol | Synthesis of gRNA (70 mL of ethanol + 30 mL of nuclease free water) | ||
Borosil 1.0 mm OD x 0.5 mm ID | FHC INC | 27-30-1 | for Microinjection |
Bulk Pharma Sodium Bicarbonate 35 pounds | Bulk Reef Supply | 255 | Fish supplies |
CaCl2 | MiliporeSigma | C7902 | |
Cas9 Protein with NLS | PNABio | CP01 | |
ChopChop | https://chopchop.cbu.uib.no/ | ||
Constant oligonucleotide | Integrated DNA Technologies (IDT) | AAAAGCACCGACTCGGTGCCAC TTTTTCAAGTTGATAACGGACTA GCCTTATTTTAACTTGCTATTTC TAGCTCTAAAAC |
|
Depression Glass Plate | Thermo Fischer Scientific | 13-748B | For IVF |
Dissecting Forceps | Dumont | SS | For IVF |
Dissecting Scissors | Fine Science Tools | 14091-09 | For IVF |
Dissecting Steroscope( with transmitted light source) | Any Maker | For IVF | |
DNA Clean & Concentrator -5 | Zymo Research | D4014 | Synthesis of gRNA |
DNA Gel Loading Dye (6x) | Any Maker | For gel electrophoresis | |
EconoTaq DNA Polymerase | Lucigen | 30032-1 | For PCR mix |
Electropheresis Power Supply | Any Maker | For gel electrophoresis | |
Ensemble | https://useast.ensembl.org/index.html | ||
Eppendorf Femtotips Microloader Tips for Femtojet Microinjector | Thermo Fischer Scientific | E5242956003 | for Microinjection |
Ethanol (200 proof, nuclease-free) | Any Maker | ||
FemtoJet 4i | Eppendorf | 5252000021 | for Microinjection |
Fish Net | Any Maker | Fish supplies | |
Frozen Brine Shrimp | Brine Shrimp Direct | Fish supplies | |
General All Purpose Agarose | Any Maker | For gel electrophoresis | |
Gene-Specific oligonucleotide | Integrated DNA Technologies (IDT) | TAATACGACTCACTATA- N20 -GTTTTAGAGCTAGAAATAGCAAG | |
Gloves | Any Maker | ||
Ice Bucket | Any Maker | ||
Instant Ocean salt | Any Maker | Fish supplies | |
Invitrogen UltraPure Ethidium Bromide, 10 mg/mL | Thermo Fischer Scientific | 15-585-011 | |
KCl | MiliporeSigma | P5405 | |
KH2PO4 | MiliporeSigma | 7778-77-0 | |
Kimwipes | Thermo Fischer Scientific | 06-666 | |
Male & Female zebrafish | |||
MEGAshortscript T7 Transcription Kit | Thermo Fischer Scientific | AM1354 | Synthesis of gRNA |
Methylene Blue | Thermo Fischer Scientific | AC414240250 | For E3 |
MgCl2 | MiliporeSigma | 7791-18-6 | For PCR mix |
MgSO2·7H2O | MiliporeSigma | M2773 | |
Microinjection plastic mold | World Precision Instruments | Z-Molds | for Microinjection |
Micromanipulator | Any Maker | for Microinjection | |
Micropipeters | Any Maker | ||
Micropipette Puller | Sutter | P-87 | for Microinjection |
Micropipetter tips with filters (all sizes) | Any Maker | ||
Micropippetter tips without filters ( all sizes) | Any Maker | ||
Microwave | Any Maker | ||
Mineral Oil | MiliporeSigma | m5904-5ml | for Microinjection |
MS-222 ( Tricaine-D) | Any Maker | FDA approved | |
Na2HPO4 | MiliporeSigma | S3264 | |
NaCl | MiliporeSigma | S5886 | |
NaHC03 | MiliporeSigma | S5761 | |
Nanodrop | Any Maker | ||
NaOH | MiliporeSigma | 567530 | |
Nonstick, RNase-free Microfuge Tubes, 1.5 mL | Ambion | AM12450 | Synthesis of gRNA |
nuclease-free water | Any Maker | ||
Paper Towel | Any Maker | ||
Pastro Pipettes | Any Maker | ||
PCR Strip Tubes | Any Maker | ||
Petri Plates 100 mm diameter | Any Maker | ||
Phenol Red solution | MiliporeSigma | P0290 | for Microinjection |
Plastic Pestals | VWR | 47747-358 | For IVF |
Plastic Spoon | Any Maker | For IVF | |
Premium Grade Brine Shrimp Eggs | Brine Shrimp Direct | Fine Mesh | |
RNA Gel Loading Dye | found in MEGAshortscript T7 Transcription Kit | For gel electrophoresis | |
RNAse AWAY | Thermo Fischer Scientific | 21-402-178 | |
Scale | Any Maker | ||
Sharpie | Any Maker | ||
Spatula | Any Maker | ||
Sterile H2O | Any Maker | For PCR mix | |
T4 DNA Polymerase | NEB | M0203 | Synthesis of gRNA |
Tape | Any Maker | ||
TBE (Tris-Borate-EDTA) 10x | Any Maker | For gel electrophoresis | |
Tea Stainer | Amazon | IMU-71133W | Fish supplies |
Thermo Scientific Owl 12-Tooth Comb, 1.0/1.5 mm Thick, Double Sided for B2 | Thermo Fischer Scientific | B2-12 | For gel electrophoresis |
Thermo Scientific Owl EasyCast B2 Mini Gel Electrophoresis Systems | Thermo Fischer Scientific | 09-528-110B | For gel electrophoresis |
Thermocycler | Any Maker | ||
Thermocycler | Any Maker | ||
Transilluminator | Any Maker | ||
UV lamp | UVP | Model XX-15 (Cat NO. UVP18006201) | For IVF |
UV safety glasses | Any Maker | For IVF | |
Wash Bottle | Thermo Fischer Scientific | S39015 | Fish supplies |
Zebrafish mating boxes | Aqua Schwarz | SpawningBox1 | Fish supplies |
1.5ml Eppendorf Tubes | Fisher Scientific | 05-402-11 | |
10 Molar dNTPs | Thermo Fischer Scientific | 18427013 | |
100 BP ladder | Thermo Fischer Scientific | 15628019 | |
100% RNAse free ethanol | any maker | ||
5m Ammonium Accetate | Thermo Fischer Scientific | ||
70% Ethanol | 70ml ethanol and 30 ml of nuclease free water | ||
Accessories for Horizontal Gel Box | Fisher Scientific | 0.625 mm | |
Agarose | any maker | ||
CaCl2 | Sigma | 10043-52-4 | |
CaCl2, dihydrate | Sigma | 10035-04-8 | E3 Medium |
Capillary Tubing | Cole-Parmer | UX-03010-68 | for injection needles |
Cas9 Protein | Thermo Fischer Scientific | A36496 | |
ChopChop | https://chopchop.cbu.uib.no/ | ||
Computer | any maker | ||
Dissecting Forcepts | any maker | ||
Dissecting Microscope | any maker | ||
Dissecting Scissors | any maker | ||
DNA Clean & Concentrator -5 | Zymo Research | D4014 | |
DNA Gel Loading Dye (6X) | Thermo Fischer Scientific | R0611 | |
EconoTaq DNA Polymerase | Lucigen | 30032-1 | |
Ensemble | https://useast.ensembl.org/index.html | ||
Eppendorf Microloader PipetteTips | Fischer Scientific | 10289651 | 20 microliters |
Ethanol (200 proof, nuclease-free) | any maker | ||
Ethidium Bromide | Thermo Fischer Scientific | 15585011 | |
Fish Net | any maker | fine mesh | |
Frozen Brine Shrimp | LiveAquaria | CD-12018 | fish food |
Gel Comb (0.625mm) | any maker | ||
Gel Electropheresis System | any maker | ||
Gene-Specific oligonucleotide | Integrated DNA Technologies (IDT) | ||
Glass Capilary Needle | Grainger | 21TZ99 | https://www.grainger.com/product/21TZ99?ef_id=Cj0KCQjw8Ia GBhCHARIsAGIRRYpqsyA3-LUXbpZVq7thnRbroBqQTbrZ_a88 VVcI964LtOC6SFLz4ZYaAhZzEAL w_wcB:G:s&s_kwcid=AL!2966!3! 264955916096!!!g!438976 780705!&gucid=N:N:PS:Paid :GGL:CSM-2295:4P7A1P:20501 231&gclid=Cj0KCQjw8IaGBh CHARIsAGIRRYpqsyA3-LUXbp ZVq7thnRbroBqQTbrZ_a88VVcI 964LtOC6SFLz4ZYaAhZzEALw _wcB&gclsrc=aw.ds |
Glass Dishes | any maker | ||
Gloves | any maker | ||
Hank's Final Working Solution | Combine 9.9 ml of Hank's Premix with 0.1 ml HS Stock #6 | ||
Hank's Premix | combine the following in order: (1) 10.0 ml HS #1, (2) 1.0 ml HS#2, (3) 1.0 ml HS#4, (4) 86 ml ddH2O, (5) 1.0 ml HS#5. Store all HS Solotions at 4C | ||
Hanks Solution | |||
Hank's Solution | https://www.jove.com/pdf-materials/51708/jove-materials-51708-production-of-haploid-zebrafish-embryos-by-in-vitro-fertilization | ||
Hank's Stock Solution #1 | 8.0 g NaCl, 0.4 g KCl in 100 ml ddH2O | ||
Hank's Stock Solution #2 | 0.358 g Na2HPO4 anhydrous; 0.60 g K2H2PO4 in 100 ml ddH2O | ||
Hank's Stock Solution #4 | 0.72 g CaCl2 in 50 ml ddH2O | ||
Hank's Stock Solution #5 | 1.23 g MgSO47H2O in 50 ml ddH20 | ||
Hank's Stock Solution #6 | 0.35g NaHCO3 in 10.0 ml ddH20; make fresh day of use | ||
HCl | Sigma | 7647-01-0 | |
Ice Bucket | any maker | ||
Instant Ocean salt | any maker | for fish water | |
In-Vitro Transcription Kit Mega Short Script | Thermo Fischer Scientific | AM1354 | |
Invitrogen™ UltraPure™ DNase/RNase-Free Distilled Water | Fisher Scientific | 10-977-023 | |
KCl | Sigma | 7447-40-7 | E3 Medium |
KH2PO4 | Sigma | 7778-77-0 | |
Kimwipes | Fisher Scientific | 06-666 | |
Male and Female zebrafish | |||
Mega Short Script T7 Transciption Kit | Thermo Fischer Scientific | AM1354 | |
methylene blue | Fisher Scientific | AC414240250 | E3 Medium |
MgSO2-7H2O | Sigma | M2773 | |
Microimicromanipulator | |||
Microinjection plastic mold | World Precision Instruments | Z-Molds | |
Microinjector | |||
Microneedle Slide | |||
Micropipeter (1-10) with tips | any maker | need filtered p10 tips | |
Micropipetter (20-200) with tips | any maker | ||
Micropippetter (100-1000) with tips | any maker | ||
Microplastic slide | |||
Microwave | any maker | ||
MiliQ Water | any maker | ||
mineral oil | sigma-aldrich | m5904-5ml | |
Na2HPO4 | Sigma | ||
NaCl | Sigma | S9888 | |
NaHC02 | Sigma | 223441 | |
Nanodrop | |||
NaOH | Sigma | 567530 | |
Narrow Spatula | any maker | ||
Needle Puller | Sutter | P-97 | |
Paper Towel | any maker | ||
Pastro Pipettes | Fisher Scientific | 13-678-20A | |
PCR primer flanking guide site | Integrated DNA Technologies (IDT) | ||
PCR primers flanking guide RNA cut site | Integrated DNA Technologies (IDT) | Standard desalted | |
PCR Strip Tubes | Thermo Fischer Scientific | AB0771W | |
Petri Dishes | Fisher Scientific | FB0875714 | 10 cm diameter 100mm x 15mm |
Phenol Red | Fisher Science | S25464 | https://www.fishersci.com/shop/products/phenol-red-indicator-solution-0-02-w-v-2/S25464 |
Pipette Tips | any maker | 10ul, 200ul and 1000ul tips | |
Plastic Pestals | Fisher Scientific | 12-141-364 | |
Plastic Spoon | any maker | ||
Primer Guide Site | Integrated DNA Technologies (IDT) | ||
Razor Blade | Uline | H-595B | |
RNA gel Loading Dye | in megashort script kit(in vitro transciption kit) | ||
RNAse away | Fisher | 21-402-178 | |
RNAse free polypropylene microcentrifuge tubes | Thermo Fischer Scientific | AM12400 | https://www.thermofisher.com/order/catalog/product/AM12400#/AM12400 |
RNAse free water | Fisher Scientific | 10-977-023 | |
Scale | any maker | ||
Sharpie | any maker | ||
Sodium bicarbonate (cell culture tested) | Sigma | S5761 | fish water |
Sodium Bromide Solotion | Sigma | E1510 | |
Software for sanger sequencing Analysis | |||
Spectrophotometer | |||
Sterlie H2O | any brand | ||
T4 DNA Polymerase | NEB | M0203S | https://www.neb.com/products/m0203-t4-dna-polymerase#Product%20Information |
Tape | any brand | ||
TBE (Tris-Borate-EDTA) 10X | Thermo Fischer Scientific | B52 | https://www.thermofisher.com/order/catalog/product/B52#/B52 |
Tea Stainer | amazon | IMU-71133W | avaible in most kitchen stores |
Thermocycler | |||
Transfer Pipette | Uline | S-24320 | |
Transilluminator | |||
Tricaine | fisher scientific | NC0872873 | |
Tris HCl 7.5 | Thermo Fischer Scientific | 15567027 | |
Universal Primer | Integrated DNA Technologies (IDT) | AAAAGCACCGACTCGGTGCCAC TTTTTCAAGTTGATAACGGACTAG CCTTATTTTAACTTGCTATTTCTA GCTCTAAAAC |
|
UV lamp | UVP | ||
UV safety glasses | any maker | ||
Wash Bottle | fisher scientific | S39015 | |
Zebrafish mating boxes | any maker | ||
PCR Buffer Recipe | Add 171.12mL sterile H20; 0.393 mL 1M MgCl2; 2.616mL 1M MgCl2; 2.618 mL 1M Tris-HCl (pH 8.4) 13.092mL 1M KCl; 0.262 mL 1% Gelatin. Autoclave for 20 minutes then chill the solotion on ice. Next add 3.468 mL 100mg/mL BSA; 0.262 mL dATP (100mM), 0.262mL dCTP (100mM); 0.262 mL dGTP (100mM); 0.262 mL dTTP (100mL). Alliquote into sterile eppendorf tubes |