Summary

Artificial RNA Polymerase II Elongation Complexes for Dissecting Co-transcriptional RNA Processing Events

Published: May 13, 2019
doi:

Summary

Here, we describe the assembly of RNA polymerase II (Pol II) elongation complexes requiring only short synthetic DNA and RNA oligonucleotides and purified Pol II. These complexes are useful for studying mechanisms underlying co-transcriptional processing of transcripts associated with the Pol II elongation complex.

Abstract

Eukaryotic mRNA synthesis is a complex biochemical process requiring transcription of a DNA template into a precursor RNA by the multi-subunit enzyme RNA polymerase II and co-transcriptional capping and splicing of the precursor RNA to form the mature mRNA. During mRNA synthesis, the RNA polymerase II elongation complex is a target for regulation by a large collection of transcription factors that control its catalytic activity, as well as the capping, splicing, and 3’-processing enzymes that create the mature mRNA. Because of the inherent complexity of mRNA synthesis, simpler experimental systems enabling isolation and investigation of its various co-transcriptional stages have great utility.

In this article, we describe one such simple experimental system suitable for investigating co-transcriptional RNA capping. This system relies on defined RNA polymerase II elongation complexes assembled from purified polymerase and artificial transcription bubbles. When immobilized via biotinylated DNA, these RNA polymerase II elongation complexes provide an easily manipulable tool for dissecting co-transcriptional RNA capping and mechanisms by which the elongation complex recruits and regulates capping enzyme during co-transcriptional RNA capping. We anticipate this system could be adapted for studying recruitment and/or assembly of proteins or protein complexes with roles in other stages of mRNA maturation coupled to the RNA polymerase II elongation complex.

Introduction

Eukaryotic messenger RNA (mRNA) synthesis is an elaborate biochemical process that involves synthesis of an unprocessed precursor RNA by RNA polymerase II and processing of the precursor RNA to yield the mature mRNA. The RNA processing steps of capping, splicing, and polyadenylation are carried out largely co-transcriptionally. The Pol II elongation complex serves as a scaffold that recruits and orchestrates the activities of many of the RNA processing enzymes. Consequently, our ultimate understanding of how mature eukaryotic mRNAs are generated will rely heavily on the development of experimental systems to allow dissection of the biochemical mechanisms underlying recruitment to the elongation complex and regulation of enzymes responsible for co-transcriptional capping, splicing, and polyadenylation.

Not surprisingly, development of such experimental systems has been difficult. A major impediment has been the remarkable complexity of Pol II transcription itself where simply reconstituting basal transcription by Pol II in vitro requires a minimum set of five general transcription initiation factors: TFIIB, TFIID, TFIIE, TFIIF, and TFIIH1. Moreover, reconstituting any sort of regulated Pol II transcription in vitro requires an even larger set of transcription factors and coregulators. Thus, a major goal has been to develop simpler experimental systems allowing reconstitution of active Pol II elongation complexes suitable for investigations of the functional coupling of Pol II transcription and RNA processing.

One such simpler method for reconstituting active Pol II elongation complexes has proven useful for structural and biochemical studies of elongating Pol II and, more recently, for investigating co-transcriptional RNA processing2,3,4,5. In this article, we show how Pol II elongation complexes prepared from purified Pol II and synthetic transcription bubbles can be used effectively to investigate the mechanisms underlying co-transcriptional capping of nascent Pol II transcripts.

Capping refers to the covalent addition of a 5’-guanosine “cap” to the 5’-triphosphate end of nascent Pol II transcripts. The cap is important for subsequent steps of mRNA maturation, transport, translation, and other processes6,7. The cap is added co-transcriptionally to Pol II transcripts by an enzyme referred to as capping enzyme. In mammalian cells, active sites responsible for the RNA 5’-triphosphatase and guanylyl transferase activities of the capping enzyme are contained within a single polypeptide8. The capping enzyme is recruited to the Pol II elongation complex through interactions with yet to be defined surfaces on the Pol II body and the Rpb1 carboxy-terminal domain (CTD) phosphorylated on Ser5 of its heptapeptide repeats5. In the elongation complex, the capping enzyme catalyzes addition of a 5’-guanosine cap once the nascent transcript reaches a length of at least 18 nucleotides and has emerged from the polymerase RNA exit channel. In the first step of the capping reaction, the triphosphatase hydrolyzes the RNA 5’-triphosphate to yield a 5’-diphosphate. In the second step, GTP is hydrolyzed to GMP by the guanylyl transferase, forming a GMP-capping enzyme intermediate. Finally, the guanylyl transferase transfers GMP to the 5’-diphosphate end of the nascent transcript to produce the cap.

A remarkable feature of the capping reaction is that co-transcriptional capping (i.e., capping of transcripts associated with functional Pol II elongation complexes) is much more efficient than capping of free RNA5,9. Thus, a major question in the field has been how this dramatic activation of capping is achieved via interactions of the capping enzyme with the Pol II elongation complex. In this protocol we describe the assembly of active RNA polymerase II elongation complexes using only purified RNA polymerase II and artificial transcription bubbles. These methods allow creation of RNA polymerase II elongation complexes with transcripts of defined length and sequence. In a recent study, we used these defined RNA polymerase II elongation complexes as a model for investigating aspects of the mechanisms of RNA capping5. In particular, we showed that (i) capping of RNA associated with these elongation complexes was more than 100-fold more efficient than capping of free RNA and (ii) was stimulated by TFIIH-dependent phosphorylation of the Pol II CTD. The approach described here could in principle be adapted to generate substrates for studying other co-transcriptional RNA processing reactions linked to the Pol II elongation complex.

In Section 1 of this protocol, artificial elongation complexes are created by annealing a synthetic template strand DNA oligonucleotide to an RNA oligonucleotide that is complementary at its 3’-end to approximately 9 nucleotides of the template strand DNA. Pol II is then loaded onto the DNA:RNA duplex. The elongation complex is then completed by addition of a partially complementary, non-template strand DNA oligonucleotide that is labeled with biotin at its 3’-end (Figure 1 and Figure 2A). The RNA oligonucleotide is extended by Pol II in these elongation complexes to make radiolabeled transcripts of defined length and sequence upon addition of appropriate combinations of radiolabeled nucleotides. In addition, using a combination of washes to remove unincorporated nucleotides and further addition of different combinations of nucleotides, one can “walk” Pol II to different positions along the DNA template and synthesize RNA of defined lengths. RNA is then purified and subjected to electrophoresis in denaturing urea-PAGE gels. In Section 2 of the protocol, artificial elongation complexes are used to analyze co-transcriptional RNA capping. The example presented measures the effect of TFIIH-dependent phosphorylation of the Pol II CTD on co-transcriptional RNA capping. In this experiment, we measure the extent of co-transcriptional capping as a function of capping enzyme concentration (5, 15 and 45 ng per reaction) and time (1, 2 and 4 min).

Protocol

1. Assembly of Artificial Elongation Complexes and Pol II Walking

  1. Immobilize 1 nmol of non-template DNA oligo containing a 3’ biotin molecule on magnetic beads.
    NOTE:
    The following steps can be done in advance to prepare for future experiments. All oligo sequences used in this protocol are provided in Table 1. RNA oligos are synthesized with 5’-triphosphate modifications.
    1. Add 200 µL of magnetic beads (10 mg/mL) to a low-protein binding 1.5 mL tube, and then place on a magnetic rack for 2 min.
    2. While the tube is on the magnetic rack, remove the liquid from the tube without disturbing the beads. To wash the beads, remove the tube from the rack, add 1 mL of 5 mM Tris-HCl pH 7.5, 0.5 mM EDTA, 1 M NaCl, return the tube to the rack, and remove the wash solution after 2 min.
    3. Repeat washes 2 more times using 200 µL of the same buffer.
    4. Resuspend magnetic beads in 400 µL of 10 mM Tris-HCl pH 7.5, 1 mM EDTA, 2 M NaCl, buffer. Then mix with 380 µL of H2O and 20 µL of 10 µM non-template biotinylated DNA oligo. Place the tube on a nutator and incubate for 30 min at room temperature.
    5. Wash immobilized non-template DNA oligo 3 times with 200 µL of 5 mM Tris-HCl pH 7.5, 0.5 mM EDTA, 1 M NaCl, and then 3 times with 200 µL of 20 mM HEPES-NaOH pH 7.9, 20% glycerol, 100 mM KCl, 1 mM EDTA, 0.5 mg/mL bovine serum albumin.
    6. Leave tube overnight at 4 °C to finish blocking beads with BSA.
    7. The next day, place the tube in the magnetic rack, remove and discard the liquid, and resuspend beads in 200 µL of 20 mM HEPES-NaOH pH 7.9, 20% glycerol, 100 mM KCl, 1 mM EDTA, 0.5 mg/mL bovine serum albumin and transfer to a new tube. For this DNA template, final concentration is approximately 5 µM.
      NOTE: Incubation time and oligo concentration need to be empirically determined for each biotinylated DNA oligo. This template should provide enough for 200 reactions, and last at least 6 months when stored at 4 °C.
  2. Anneal RNA and DNA template strand oligonucleotide oligos in a 2:1 molar ratio (20 and 10 pmol, respectively) to obtain the DNA:RNA duplex.
    1. Set up a 10 µL annealing mix as described in Table 2.
      NOTE: 10 µL of annealing mix are sufficient for 10 reactions. The annealing mix can be scaled up as needed if more assays are to be performed.
    2. Perform the annealing reactions in a thermal cycler using the following program: 5 min at 45 °C, followed by 12 cycles of 2 min each, starting at 43 °C and decreasing the temperature 2 °C per cycle. Idle at 4 °C.
      NOTE: This is a flexible timepoint. Annealing is finished within ~30 min but can be left at 4 °C for a longer period. In the lab, annealing mixtures have been left sitting for up to 4 h without observing any decrease in reaction efficiency.
    3. While annealing RNA to the template strand DNA, prepare buffers for later steps of the protocol. The ingredients needed to prepare each buffer for a single reaction with each buffer are listed in Tables 2 to 8. Scale up recipes by a factor of [Y(X+1) + 1] for Wash and (X+1) for all other buffers. X = number of reactions to be prepared; Y = number of washing steps needed (minimum 3).
      NOTE: Prepare all buffers fresh the day of the experiment. Do not place tubes on ice after PVA has been added to buffers. Add Pol II or nucleotides to buffers right before using.
  3. Load purified RNA polymerase II onto the DNA:RNA hybrid.
    1. Mix 1 pmol (1 µL) of DNA:RNA duplex with 13 µL of Pol II buffer (from Table 3).
    2. Add ~0.02 units of purified RNA Pol II (1 µL) to the mixture from step 1.3.1 and mix by gently pipetting up and down and stirring with pipet tip, without introducing bubbles. Incubate for 10 min at 30 °C.
      NOTE: Volumes given from here on are for a single reaction; scale up as needed for the number of reactions in the experiment. RNA Pol II purified from rat liver as described10 is used in this example; however, RNA Pol II purified from other sources, including cultured mammalian cells or yeast can also be used3,4,5,11,12,13.
  4. Complete the elongation complex by addition of biotinylated non-template DNA.
    1. Add 5 pmol (1 µL) of immobilized non-template DNA oligo to 14 µL of non-template DNA buffer (from Table 4), add to tube from step 1.3.2, and incubate for 10 min at 37 °C.
    2. Place the sample in magnetic rack for 2 min. Wash 1x with 30 µL of wash buffer (from Table 7) to remove unincorporated Pol II and oligos.
  5. Generate elongation complexes containing radiolabeled RNA 23mers.
    1. Perform all further incubations at 30 °C. Add 1 µL of 15 µM ATP and 10 µCi (1 µL) of [α-32P] UTP (3,000 Ci/mmol) to 23 µL of Pulse buffer and use this to resuspend washed magnetic beads.
      CAUTION: Radioactive material is hazardous. Make sure to wear appropriate protective equipment and to follow all lab guidelines for safe use and disposal of radioactive material.
      NOTE: Replace radiolabeled UTP with 15 µM UTP when radiolabeled RNA is not needed, such as for western blot experiments.
    2. Incubate the reaction for 10 min to allow the synthesis of radiolabeled 23mers.
    3. Add 1.5 µL of solution containing 100 µM ATP and 100 µM UTP mix to 3.5 µL of chase buffer, add to tube containing preassembled elongation complexes, and incubate for 5 min to chase all nascent transcripts into 23mers.
    4. Place the sample in magnetic rack for 2 min, remove the supernatant, wash once with 30 µL of wash buffer to remove unincorporated nucleotides, and resuspend in 30 µL of wash buffer.
    5. Either add 94 µL of stop mix with proteinase K and glycogen (Table 9) to terminate reactions or proceed to section 1.6 to generate elongation complexes with longer transcripts or section 2 to perform capping assays.
  6. (Optional) Walk Pol II to make 23, 25, and 29 nucleotide transcripts
    1. Follow the procedure described in steps 1.2.1 through 1.5.4 to prepare elongation complexes containing radiolabeled 23mers. Scale up 4-fold to generate 120 µL of washed elongation complexes, which is enough complexes for 4 reactions.
    2. Label 3 new tubes “23mer”, “25mer” and “29mer”. Transfer 30 µL of washed elongation complexes to “23mer” tube and add 94 µL of stop mix with proteinase K and glycogen.
    3. Place the tube containing the remaining 90 µL of washed elongation complexes in the magnetic rack for 2 min, remove the supernatant, and resuspend beads in 90 µL of BTB supplemented with 1.2 µL each of 1.5 mM ATP and 1.5 mM CTP. Incubate for 10 min at 30 °C.
    4. After washing once with 90 µL of wash buffer and resuspending in 90 μL of wash buffer as described in step 1.5.4, transfer 30 µL of elongation complexes to “25mer” tube and add 94 µL of stop mix with proteinase K and glycogen.
    5. Place the tube containing the remaining 60 µL of elongation complexes in the magnetic rack for 2 min, remove the supernatant, and resuspend beads in 60 µL of BTB supplemented with 0.8 µL each of 1.5 mM ATP and 1.5 mM CTP.
    6. Incubate for 10 min at 30 °C, wash once with 60 µL of wash buffer as in section 1.5.5, and resuspend in 60 µL of wash buffer.
    7. Transfer 30 µL from 2x sample to “29mer” tube and either add 94 µL of stop mix with proteinase K and glycogen or proceed to section 2 to perform capping assays.
    8. Proceed to RNA purification and analysis (Section 3).

2. Using Artificial Elongation Complexes to Assay Cotranscriptional Capping

  1. Generate washed elongation complexes containing 23mers by scaling up the procedure described in steps 1.2.1 through 1.5.5 13-fold. This is enough for 12 reactions + 1 extra.
  2. Pol II CTD phosphorylation
    1. Place the tube containing washed elongation complexes in the magnetic rack for 2 min, remove the supernatant, and resuspend beads in 377 µL of BTB supplemented with 13 µL of 1.5 mM ATP.
    2. Prepare two new tubes, labeled +H and -H, respectively. To the tube labeled +H add 3 µL of ~300 ng/µL TFIIH, and to the tube labeled -H add 9 µL of 20 mM HEPES-NaOH pH 7.9, 20% glycerol, 100 mM KCl, 1 mM EDTA, 0.5 mg/mL bovine serum albumin.
      NOTE: We typically use TFIIH purified from rat liver, but we have obtained similar results using ~0.6 µg/reaction of commercially-available recombinant Cdk7/Cyclin H/MAT1 (CAK, which is the kinase module from TFIIH). See Table of Materials for information.
    3. Add 87 µL of the washed elongation complexes from step 2.2.1 to the tube labeled +H and 270 µL of washed elongation complexes to the tube labeled -H. Incubate 10 min at 30 °C.
    4. Place sample in magnetic rack for 2 min. To remove excess nucleotides and unbound protein, wash elongation complexes in +H and -H reactions with 90 µL or 270 µL of wash buffer, respectively.
  3. RNA capping
    1. Resuspend elongation complexes in the tube labeled +H in 87 µL of capping mix (BTB supplemented with 50 µM GTP (Table 10). Resuspend elongation complexes in the tube labeled -H in 261 µL of capping mix.
    2. Prepare 4 new tubes labeled 5 ng CE+H, 5 ng CE, 15 ng CE, 45 ng CE. Dilute capping enzyme (CE) into 20 mM HEPES-NaOH pH 7.9, 20% glycerol, 100 mM KCl, 1 mM EDTA, 0.5 mg/mL bovine serum albumin to prepare solutions containing 5 ng CE/µL, 15 ng CE/µL, or 45 ng CE/µL and dispense 3 µL of the appropriate solution into each of the 4 tubes.
    3. Prepare 12 new tubes with 94 µL of stop buffer (2.1.1) added to each.
    4. Start each capping reaction by adding 87 µL of elongation complex treated with TFIIH or not to labeled tubes containing capping enzyme. Incubate at 30 °C in a heat block.
    5. After 1, 2, or 4 min, stop reactions by transferring 30 µL of each reaction mixture to tubes containing 94 µL of stop buffer. Purify and analyze reaction products as described in section 3.

3. RNA Purification and Analysis

  1. Purify RNA
    1. Incubate reaction products in stop buffer for 20 min at room temperature.
      NOTE: Pausing point. Samples in this buffer has been maintained for up to 4 h without loss or degradation of RNA.
    2. Extract once with 124 µL of phenol:chloroform:isoamyl alcohol (25:24:1) and once with chloroform:isoamyl alcohol (24:1).
      CAUTION: Phenol is extremely toxic and is rapidly absorbed by the skin. Wear appropriate protective equipment.
      NOTE: To maximize recovery of RNA during extraction, use commercially available tubes containing a high-density gel, which forms a stable barrier between aqueous and organic phases. See Discussion and Table of Materials.
    3. Transfer the aqueous phase (top layer) to new tubes containing 12.4 µL of 3 M sodium acetate pH 5.2.
  2. Ethanol precipitation
    1. Add 350 µL of 100% ethanol and mix thoroughly by inversion.
    2. Incubate for at least 10 min on dry ice.
      NOTE: Pausing point. For convenience, one can stop here and complete the procedure on the next day; however, it is possible to proceed directly to step 3.3 and run the gel on the same day. RNA can be kept at -80 °C for a couple of days before further processing, but do not leave for longer times.
  3. Preparing RNA samples for gel electrophoresis
    1. Allow samples to thaw, mix by inverting 2-3 times, and centrifuge for 15 min at 21,000 x g, 4 °C, in a tabletop centrifuge. Meanwhile, set up denaturing gel mix (section 3.4.1).
    2. Carefully remove ethanol from samples without disturbing pellet.
    3. Add 500 µL of 70% ethanol, invert tube a couple of times to wash pellet, and then centrifuge again at 21,000 x g for 5 min at either room temperature or 4 °C.
    4. Remove as much ethanol as possible and do a quick spin (5-10 s) of the tubes in a table top centrifuge. Then, with a gel-loading tip, remove the last remaining volume of ethanol.
    5. Air-dry pellet for 3 min at room temperature.
    6. Dissolve RNA by adding 4 µL of H2O to the top of each pellet. Incubate 5 min at room temperature.
    7. Add 4 µL of 2x RNA dye (See Table of Materials) to the mix, and then vortex each tube for a couple of seconds to fully resuspend RNA.
      NOTE: RNA dye that contains formamide instead of urea is recommended, since the latter precipitates at low temperatures.
    8. Quick-spin the tubes, and then incubate them at 70 °C for 10 min in a heat block.
    9. Store tubes on dry ice until ready to load on gel.
      NOTE:
      Keeping RNA on dry ice allows the flexibility to work on other experiments while the gel is polymerizing. Samples do not need to be reheated after thawing. However, RNA can be directly loaded after heating if the gel is ready to run.
  4. Preparing Urea-PAGE gel
    1. For 40 mL gel mix, combine in a 50 mL conical tube: 16.7 g of urea, 15 mL of 40% bis:acrylamide solution (19:1 ratio), 4 mL of 10x TBE (1 M Tris-HCl, 1 M sodium borate, 20 mM EDTA), and 8 mL of H2O. This volume is sufficient for one standard size gel (18 cm height x 16 cm width) with 1.0 mm spacers.
      CAUTION: Acrylamide is extremely toxic. While there is no inhalation risk when it is in solution, always wear lab coat, gloves, and safety glasses while handling.
      NOTE: This mixture is for casting a denaturing 15% polyacrylamide gel, which readily resolves RNA between 15-50 nt. Change the concentration of bis/acrylamide as needed to resolve different RNA transcripts of different lengths.
    2. Place closed tube containing gel mix on a nutator until urea is fully dissolved.
    3. Set up gel-casting station with glass plates, 1 mm spacers and a 15-well comb.
    4. Working rapidly, add 40 µL of TEMED and 400 µL of 10% ammonium persulfate solution to gel solution and mix well. Using a 25 mL pipet, pour gel solution between plates, insert comb, and allow the gel to polymerize for at least 2 h.
      NOTE: If the gel is poured more than 2 h before use, once it has polymerized cover it with moist paper towel (leaving the comb in place) and wrap with plastic wrap to prevent it from drying out.
  5. Denaturing gel RNA electrophoresis
    1. After polymerization, transfer gel to running tank and pre-run it at 20 mA in 1x TBE for 15-30 min.
    2. Meanwhile, thaw samples (if frozen), vortex, and spin them for 4 min at 2,000 x g, 4 °C.
    3. When ready, turn off the power supply, and carefully rinse each well with 1x TBE using a syringe.
    4. Use gel-loading tips to load samples onto the gel.
    5. Run gel at a constant 20-30 mA for about 2 h or until lower dye (xylene cyanol FF) reaches the bottom of the gel.
  6. Remove the gel, place it on a piece of absorbent paper, and wrap with plastic wrap.
  7. Expose the radiolabeled gel to a phosphorscreen.
  8. Scan phosphorscreen using a phosphorimager and analyze image.

Representative Results

Figures 2 and 3 show representative result reactions used to generate artificial elongation complexes containing transcripts of different lengths by extending or Pol II from different sources. Figure 4 depicts how these elongation complexes can be used to assay co-transcriptional CTD phosphorylation-dependent RNA capping.

Figure 2A is a diagram of DNA and RNA molecules in artificial elongation complexes. Figure 2B shows transcripts of different length generated in reactions performed exactly as described in Protocol 1, in which the starting artificial elongation complexes were prepared using a synthetic RNA oligo of 20 nt (dark blue in Figure 2A; RNA_20mer, Table 1). Since we know the starting RNA length and DNA template sequence, we can determine the subset of nucleotides—ATP, CTP, GTP, or UTP—necessary to walk Pol II to a defined position along the template. The number of newly synthesized nucleotides is added to the starting size of the RNA oligonucleotide primer to determine the final expected length (RNA oligo size + number of nucleotides added). In the presence of ATP and UTP, Pol II can add 3 nt to the 20 nt RNA oligo to generate elongation complexes containing a 23mer RNA. If one washes away unincorporated ATP and UTP and then adds ATP and CTP, the 20 nt oligo is extended by 2 nt to make a 25mer, and if one then again washes away unincorporated nucleotides and adds ATP and GTP, the transcript is extended an additional 4 nt to make a 29mer. Since the newly generated transcripts correspond to the expected RNA size and since nearly all of the radiolabeled 23mers can be quantitatively chased into longer products, one knows that using this method (i) the RNA oligo is correctly positioned at the Pol II exit channel during assembly and (ii) radiolabeled RNAs are associated with active Pol II elongation complexes.

Figure 2C shows a variation of the protocol, in which the starting elongation complexes were prepared using the same DNA template and non-template strand oligos and an RNA oligo (RNA_29mer, Table 1) that contains an additional 9 nucleotides at its 5’-end but is otherwise identical in sequence to the 20 nt RNA oligo. Because the starting RNA length is 29 nt in this case, elongation complexes containing 32mer, 34mer, and 38mer transcripts can be generated using the same Pol II walking steps described above.

Depending on scope of analysis, this method allows flexibility in the source of Pol II. In Figure 3 we compare reactions using Pol II from different sources. In the reactions shown in the first 4 lanes, artificial elongation complexes were assembled with endogenous, wild type Pol II purified from either rat liver or fission yeast and walked as described above to generate 23mers or 25mers. The rat and fission yeast Pol IIs used in these reactions were purified to near homogeneity using multiple chromatographic steps.

The method can also be used to generate artificial elongation complexes containing wild type or mutant Pol II prepared using a simple, one-step purification method. The last two lanes in the figure show assays performed using a mutant form of human Pol II that lacks the CTD in its Rpb1 subunit, which is not required for Pol II catalytic activity but helps to couple transcription to RNA capping. The CTD-less Pol II used in these assays was purified by anti-FLAG immuno-purification from a human cell line expressing a FLAG epitope tagged version of Rpb1. It is important to note that the concentration of active Pol II will vary from preparation to preparation. Thus, it is essential to perform initial experiments in which the amount of Pol II used in reactions is varied to determine the amount needed to obtain the desired activity.

Figure 4 shows a representative example of an assay comparing capping of radiolabeled transcripts associated with artificial elongation complexes containing Pol II with either a phosphorylated or unphosphorylated CTD. For these assays, elongation complexes containing 23 nucleotide transcripts with a 5’-triphosphate end were prepared as described in protocol 2.

Incubation of elongation complexes with capping enzyme leads to a mobility shift of around 1 nt, indicating the addition of a 5’ cap14,15. To quantitate capping reactions, one determines capping efficiency, expressed as percent of RNA that is capped. Capping efficiency is the ratio of capped RNA to total RNA, divided by the maximum obtainable capping. In our assays we find the maximum obtainable capping of RNA oligos obtained from commercial sources is ~85%, likely due to incomplete triphosphorylation of synthetic RNA.

In the reactions shown in the first 3 lanes, elongation complexes were incubated with the general transcription factor TFIIH and the co-factor ATP to phosphorylate the Pol II CTD prior to capping. In these reactions, near maximal capping was observed ~1 min after addition of 5 ng of capping enzyme. When assays were performed using elongation complexes that are not incubated with TFIIH and hence contain unphosphorylated Pol II, it took nearly 10 times as much capping enzyme to observe similar levels of capping. The last two lanes of Figure 4 show the products of reactions in which elongation complexes were incubated with or without capping enzyme, in the presence of TFIIH. Importantly, the TFIIH-dependence of co-transcriptional capping artificial elongation complexes demonstrated in this figure is very similar to that observed in elongation complexes that had initiated transcription at a promoter in more complex enzyme systems5.

Figure 1
Figure 1: Assembly of artificial elongation complexes. (A) RNA oligo (dark blue) of 20 nt is annealed to a DNA template strand (green) through a complementary sequence of 9 nt. (B) RNA polymerase II (Pol II) is mixed with the annealed DNA:RNA hybrid to position the RNA 3’-end at the Pol II catalytic site. (C) A molar excess of 3’ biotinylated non-template strand DNA oligo (light blue) is added to the reaction mix to enclose and further stabilize the elongation complex. (D) Immobilized elongation complexes are washed to remove excess oligos and incubated with appropriate combinations of nucleotides to allows Pol II to extend the RNA oligo to the desired length. The newly synthesized portion of the RNA is shown in yellow. Please click here to view a larger version of this figure.

Figure 2
Figure 2: Pol II walking using RNA oligos of different lengths. (A) Diagram of artificial elongation complexes, showing nucleotides added during walks. Non-template strand and template strand DNA are shown in light blue and green, respectively. The 20 nt RNA oligo is shown in dark blue. Also shown are nucleotides added during successive walks to generate 23mer RNA (orange), 25mer RNA (brown), and 29mer RNA (magenta). (B) Denaturing gel electrophoresis showing RNAs of defined length obtained after walking Pol II using a 20 nt RNA primer, as described in Protocol 1. Nucleotides added during each sequential walking step of the protocol are color coded orange (23mer), brown (25mer), and magenta (29mer). (C) Pol II walking starting with a 29 nt RNA primer, but otherwise exactly as that shown in B. (B and C) show parts of the same gel but were separated for illustration purposes. Please click here to view a larger version of this figure.

Figure 3
Figure 3: Transcripts synthesized by artificial elongation complexes containing wild type or mutant Pol II. Artificial elongation complexes were assembled using the 20 nt RNA primer and highly purified endogenous Pol II from rat liver or fission yeast or FLAG immunopurified Pol II lacking the Rpb1 from HeLa cells (F:Rpb1-ΔCTD). RNA in each complex was further extended to 23 nt or 25 nt. See text for details. Please click here to view a larger version of this figure.

Figure 4
Figure 4: Phosphorylation-dependent activation of co-transcriptional RNA capping. Artificial elongation complexes containing rat liver Pol II and radiolabeled 23mer RNA were incubated with ATP and the general transcription factor TFIIH or buffer for 10 min to phosphorylate the Pol II CTD. After washing, elongation complexes were incubated with 5 ng, 15 ng, or 45 ng of mammalian capping enzyme for 1, 2 or 4 min. Capped and uncapped 23mers were resolved in a denaturing gel (top, first 12 lanes) and the % capped RNA was quantified and plotted (bottom). This portion of the figure was originally published in ref 5, which was published as an open access article under a CC-BY license. The last two lanes, which come from a separate experiment, illustrate products of reactions in which elongation complexes were incubated with or without capping enzyme, in the presence of TFIIH. Please click here to view a larger version of this figure.

Sequence Comments
RNA_20mer ACUCUCAUGUCUGAUGCUUA 5’ Triphosphate modification; PAGE & RP-HPLC purified
RNA_29mer ACUCUAUGACUCUUCAUGUCUGAUGCUUA 5’ Triphosphate modification; PAGE & RP-HPLC purified
Template Strand DNA CTACGGTTAAGCTCACGGTACATTTCTGAA
TTAAGCATCATGG
Dual PAGE & HPLC purified
Non-template Strand DNA ATCAGAAATGTACCGTGAGCTTAACCGTAG 5’ TEG-biotinylated; HPLC purified

Table 1: DNA and RNA oligonucleotides

Final concentration Volume
Tris HCl pH 7.5 12 mM*
50 mM MgCl2 5 mM 1 µL
300 mM KCl 50 mM 1.67 µL
10 µM Template Strand DNA oligo in 100 mM Tris-HCl pH 7.5 1 µM 1 µL
10 µM RNA oligo
in 10 mM Tris-HCl pH 7.5
2 µM 2 µL
Water 4.33 µL
10 µL
*All Tris-HCl comes from DNA and RNA oligo solutions

Table 2: Cocktail for annealing DNA and RNA oligos

Pol II buffer Final concentration Volume/reaction
Water 4.52 µL
50 mM MgCl2 ^4.67 mM 1.40 µL
250 mM Tris HCl, pH 7.5 ^23 mM 1.40 µL
300 mM KCl *27 mM 1.33 µL
50% Glycerol 3% 0.9 µL
20 mg/ml BSA 0.5 mg/ml 0.38 µL
100 mM DTT 0.5 mM 0.08 µL
10% PVA 2% 3 µL
13 µl
Right before using buffer add:
Annealed template strand DNA:RNA (from Table 1) 1 µL
RNA Polymerase II 1 µL
*Final KCl concentration in the mix is ~50 mM, with additional KCl coming from Pol II
^Final MgCl2 and Tris HCl concentrations are 5 mM and 25 mM respectively,
The additional MgCl2 and Tris HCl come from annealed DNA:RNA product.

Table 3: Pol II mix

Non-template DNA buffer Final concentration Volume/reaction
Water 4.48 µL
300 mM KCl *43.33 mM 2.17 µL
50 mM MgCl2 5 mM 1.50 µL
250 mM Tris HCl, pH 7.5 25 mM 1.50 µL
50% Glycerol 3% 0.9 µL
20 mg/mL BSA 0.5 mg/ml 0.38 µL
100 mM DTT 0.5 mM 0.08 µL
10% PVA 2% 3 µL
14 µL
Right before using buffer add:
5 µM Biotinylated non-template DNA oligo 1 µL
*Final KCl concentration in the mix is 50 mM, with additional KCl coming from non-template DNA oligo buffer.

Table 4: Non-template DNA mix

Pulse labeling buffer Final concentration Volume/reaction
Water 9.98 µL
300 mM KCl 60 mM 5 µL
50% Glycerol 3% 1.5 µL
20 mg/mL BSA 0.5 mg/ml 0.63 µL
500 mM MgCl2 8 mM 0.4 µL
1 M Tris HCl, pH 7.9 *12 mM 0.3 µL
100 mM DTT 0.5 mM 0.13 µL
1 M HEPES-NaOH, pH 7.9 3 mM 0.08 µL
10% PVA 2% 5 µL
23 µL
Right before using buffer add:
15 µM ATP 0.6 µM 1 µL
3.3 µM [α-32P]UTP 0.13 µM 1 µL
*Final Tris HCl concentration is 20mM, with additional Tris HCl coming from nucleotide buffer.

Table 5: Pulse labeling NTP mix

Chase buffer Final concentration Volume/reaction
Tris HCl, pH 7.5 *30 mM
300 mM KCl 60 mM 1 µL
Water 0.6 µL
50% Glycerol 3% 0.3 µL
10 mM DTT 0.5 mM 0.25 µL
100 mM HEPES-NaOH, pH 7.9 3 mM 0.15 µL
20 mg/mL BSA 0.5 mg/ml 0.13 µL
500 mM MgCl2 8 mM 0.08 µL
10% PVA 2% 1 µL
3.5 µL
Right before using buffer add:
100 µM UTP, 100 µM ATP diluted in 100 mM Tris-HCl, pH 7.5 5 µM 1.5 µL
*All Tris HCl comes from nucleotide buffer

Table 6: Chase NTP mix

Final concentration Volume/reaction
Water 24.21 µL
1 M KCl 60 mM 1.8 µL
50% Glycerol 3% 1.8 µL
20 mg/ml BSA 0.5 mg/mL 0.75 µL
1 M Tris HCl, pH 7.9 20 mM 0.6 µL
10% PVA 0.2% 0.6 µL
100 mM DTT 0.5 mM 0.15 µL
1 M HEPES-NaOH, pH 7.9 3 mM 0.09 µL
30 µl

Table 7: Wash buffer

Final concentration Volume/reaction
Water 14.13 µL
300 mM KCl 60 mM 6 µL
50% Glycerol 3% 1.8 µL
20 mg/ml BSA 0.5 mg/ml 0.75 µL
1 M Tris HCl, pH 7.9 20 mM 0.6 µL
500 mM MgCl2 8 mM 0.48 µL
100 mM DTT 0.5 mM 0.15 µL
1 M HEPES-NaOH, pH 7.9 3 mM 0.09 µL
10% PVA 2% 6 µL
30 µL

Table 8: Base Transcription Buffer (BTB)

Stop buffer Final Concentration Volume/reaction
Water 55.74 µL
1 M Tris HCl, pH 7.5 10 mM 0.6 µL
5 M NaCl 300 mM NaCl 3.6 µL
500 mM EDTA 0.5 mM EDTA 0.06 µL
10% SDS 0.2% SDS 1.2 µL
60 µL
Right before using buffer add:
15 mg/mL Glycogen 2 µL
20 mg/mL Proteinase K 2 µL
Water 30 µL

Table 9: Stop mix

Final concentration Volume/reaction
Water 11.9 µL
300 mM KCl *53.33 mM 5.33 µL
50% Glycerol 3% 1.8 µL
1.5 µM GTP diluted in 100 mM Tris HCl, pH 7.5 50 µM 1 µL
100 units/mL Inorganic Pyrophosphatase, Yeast 0.1 units/reaction 1 µL
20 mg/ml BSA 0.5 mg/ml 0.75 µL
1 M Tris HCl, pH 7.9 ^16.67 mM 0.5 µL
500 mM MgCl2 8 mM 0.48 µL
100 mM DTT 0.5 mM 0.15 µL
1 M HEPES-NaOH, pH 7.9 3 mM 0.09 µL
10% PVA 2% 6 µL
29 µL
Right before using buffer add:
Capping Enzyme 1 µL
*Final KCl concentration in the mix is ~60 mM, with additional KCl coming from capping enzyme and pyrophosphatase
^Final Tris HCl concentration is 20 mM, with additional Tris HCl coming from nucleotide buffer

Table 10: Capping mix

Discussion

Studies that seek to dissect events coupled to the Pol II elongation complex such as RNA processing and regulation of the transcript elongation itself can be greatly facilitated by use of a highly purified enzyme system. Setting up such enzyme systems can be challenging. Promoter-dependent transcription by Pol II requires at least five general transcription factors. Preparing and stockpiling these factors can take months; hence, the rate-limiting step in this process is often simply preparing the cadre of transcription factors needed to reconstitute basal transcription in the test tube.

In this article, we describe an adaptation of previously developed methods for generating artificial transcription elongation complexes2,3 using only purified Pol II and synthetic DNA and RNA oligonucleotides. The resulting elongation complexes are transcriptionally active and are suitable for use in investigating the coupling of Pol II transcription and RNA capping5. It is important to note that transcription and RNA capping occur in vivo in the context of chromatin and many other proteins not present in this defined enzyme system; hence, this system is expected to recapitulate many, but not all, features of reactions that occur in vivo. The protocol we describe builds on previous methods by immobilizing artificial elongation complexes through biotinylated DNA bound to magnetic beads, allowing the researcher easily to change reaction conditions and/or remove unincorporated nucleotides during different stages of assays. Importantly, because the tag used to immobilize elongation complexes is on one end of the non-template strand of DNA rather than on Pol II itself or on the template strand, only those Pol IIs associated with complete elongation complexes will be retained on beads.

Because nascent transcripts must have a 5’-triphosphate end in order to be modified by capping enzyme, the synthetic RNA oligonucleotides used for capping experiments are purchased with 5’-triphosphate termini. However, unmodified RNA oligos can be used for other applications, including studies of other co-transcriptional RNA processing events or the activities of transcription factors that regulate Pol II elongation. Regardless of the downstream application, we recommend assembling elongation complexes with highly purified DNA and RNA oligos. In particular, biotinylated DNA oligos should be purified by HPLC, and other DNA and RNA oligos should be purified by polyacrylamide gel electrophoresis and/or HPLC. Purity of enzymatic activities, however, will have to be determined on a case-by-case basis and will depend on the scope of each experiment.

Adding the non-template biotinylated DNA oligo in the last step of assembly should be, in principle, sufficient to obtain a ternary complex. However, we always include at least one “walking” step to confirm Pol II incorporates the correct number of nucleotides: If the goal of the experiment is to generate substrates for assaying co-transcriptional capping or other RNA processing steps or to follow Pol II elongation, we always include a 32P-labeled ribonucleotide in the initial “walk” so that the transcript can be visualized and use unlabeled “cold” nucleotides for subsequent walking steps so the specific activity of transcripts of different lengths remains constant. Although the method described in this protocol uses 32P-labeled nucleotides to visualize nascent transcripts, fluorescence-based assays can be used to measure RNA labeling when it is not possible to work with radioactive materials. However, it is important to note that the sensitivity of such assays is typically much less than those using radioactive labels, and they usually require larger amounts of enzyme.

A key step for reproducible experiments is good RNA recovery during phenol:chloroform:isoamyl extraction and ethanol precipitation. We have found that using microcentrifuge tubes containing high-density gels (see Table of Materials) for phenol:chloroform:isoamyl extraction increases the reproducibility and yield of nucleic acid from this step. In addition, the use of colored glycogen (see Table of Materials) as carrier during ethanol precipitation makes it easier to see small nucleic acid pellets, making it less likely that one inadvertently loses the pellet by aspirating it during removal of the ethanol supernatant.

Artificial elongation complexes generated using protocols similar to those we describe should also be useful for measuring protein-protein or protein-nucleic acid interactions between the Pol II elongation complex and factors that regulate transcript elongation or RNA processing events linked to elongation. In this case, proteins that remain bound to artificial elongation complexes after washing are detected by western blotting or mass spectrometry; radiolabeling RNA is not necessary and we do all transcription steps with only “cold” nucleotides.

Finally, this method could be of use for structural analyses of transcription complexes. Indeed, related methods have been used in cryo-EM studies with yeast and mammalian enzymes to reconstitute capping enzyme-Pol II interactions13, and interactions of Pol II with other proteins or protein complexes during elongation12, pausing16,17, and most recently, bound to a nucleosome18. A possible complication for structural analyses of transcription complexes generated using this method is the need to remove the biotin/magnetic beads from the complex; however, this can be solved by including in DNA oligos specific sites recognized by restriction enzymes or by using biotin linkers that are cleaved off after UV ray treatment19.

Disclosures

The authors have nothing to disclose.

Acknowledgements

We thank S. Shuman for providing the mammalian capping enzyme cDNA. This work was supported in part by a grant to the Stowers Institute for Medical Research from the Helen Nelson Medical Research Fund at the Greater Kansas City Community Foundation.  Original data underlying this manuscript can be accessed from the Stowers Original Data Repository at http://www.stowers.org/research/publications/libpb-1434.

Materials

[α-32P] UTP (3000 Ci/mmol), 1 mCi Perkin Elmer NEG007H001MC For radiolabeling RNA
2x RNA loading dye New England Biolabs B0363S Highly recommended. For preparing RNA during gel loading
40% Bis:Acrylamide solution Biorad 1610144
Bovine Serum Albumin (20 mg/ml) New England Biolabs B9000S
Cdk7/Cyclin H/MAT1 (CAK complex) Protein, active, 10 µg Millipore Sigma 14-476 Used to phosphorylate Pol II CTD
DNA oligonucleotides IDT See Table 8 for purity specifications
Dynabeads MyOne Streptavidin C1 Life Technologies Invitrogen 65001 We have also used Dynabeads M-280 streptavidin without problem but prefer MyOne Streptavidin beads because they sediment more slowly
GlycoBlue Coprecipitant (15 mg/ml) Life Technologies Invitrogen AM9516 Highly recommended. Dyes nucleic-acid pellet blue making reactions much easier to handle
Hoefer SE600 standard dual cooled vertical electrophoresis system with 1 mm spacers and 15 well comb Hoefer SE600-15-1.5
MaXtract high density tubes (1.5 ml) Qiagen 129046 Highly recommended. Contains a high density gel that forms a stable barrier between aqueous and organic phases; improves RNA yields during extractions
Proteinase K solution (20 mg/ml) Life Technologies Invitrogen 25530049
RNA oligonucleotides Trilink See Table 8 for more details
Yeast Inorganic Pyrophosphatase (100 units/ml) New England Biolabs NEBM2403S Required only during capping reactions

References

  1. Liu, X., Bushnell, D. A., Kornberg, R. D. RNA polymerase II transcription: structure and mechanism. Biochimica et Biophysica Acta. 1829 (1), 2-8 (2013).
  2. Daube, S. S., von Hippel, P. H. Functional transcription elongation complexes from synthetic RNA-DNA bubble duplexes. Science. 258, 1320-1324 (1992).
  3. Kireeva, M. L., Komissarova, N., Waugh, D. S., Kashlev, M. The 8-nucleotide-long RNA:DNA hybrid is a primary stability determinant of the RNA polymerase II elongation complex. Journal of Biological Chemistry. 275 (9), 6530-6536 (2000).
  4. Kellinger, M. W., et al. 5-formylcytosine and 5-carboxylcytosine reduce the rate and substrate specificity of RNA polymerase II transcription. Nature Structural and Molecular Biology. 19 (8), 831-833 (2012).
  5. Noe Gonzalez, M., Sato, S., Tomomori-Sato, C., Conaway, J. W., Conaway, R. C. CTD-dependent and -independent mechanisms govern co-transcriptional capping of Pol II transcripts. Nature Communications. 9 (1), 3392 (2018).
  6. Topisirovic, I., Svitkin, Y. V., Sonenberg, N., Shatkin, A. J. Cap and cap-binding proteins in the control of gene expression. Wiley Interdisciplinary Reviews. RNA. 2 (2), 277-298 (2011).
  7. Ramanathan, A., Robb, G. B., Chan, S. H. mRNA capping: biological functions and applications. Nucleic Acids Research. 44 (16), 7511-7526 (2016).
  8. Ghosh, A., Lima, C. D. Enzymology of RNA cap synthesis. Wiley Interdisciplinary Reviews. RNA. 1 (1), 152-172 (2010).
  9. Moteki, S., Price, D. Functional coupling of capping and transcription of mRNA. Molecular Cell. 10, 599-609 (2002).
  10. Conaway, J. W., Conaway, R. C. An RNA polymerase II transcription factor shares functional properties with Escherichia coli sigma 70. Science. 248, 1550-1553 (1990).
  11. Wang, D., et al. Structural basis of transcription: backtracked RNA polymerase II at 3.4 angstrom resolution. Science. 324 (5931), 1203-1206 (2009).
  12. Wang, L., et al. Molecular basis for 5-carboxycytosine recognition by RNA polymerase II elongation complex. Nature. 523 (7562), 621-625 (2015).
  13. Martinez-Rucobo, F. W., et al. Molecular Basis of Transcription-Coupled Pre-mRNA Capping. Molecular Cell. 58 (6), 1079-1089 (2015).
  14. Mandal, S. S., et al. Functional interactions of RNA-capping enzyme with factors that positively and negatively regulate promoter escape by RNA polymerase II. Proceedings of the National Academy of Sciences USA. 101, 7572-7577 (2004).
  15. Chiu, Y. L., et al. Tat stimulates cotranscriptional capping of HIV mRNA. Molecular Cell. 10 (3), 585-597 (2002).
  16. Vos, S. M., Farnung, L., Urlaub, H., Cramer, P. Structure of paused transcription complex Pol II-DSIF-NELF. Nature. 560 (7720), 601-606 (2018).
  17. Vos, S. M., et al. Structure of activated transcription complex Pol II-DSIF-PAF-SPT6. Nature. 560 (7720), 607-612 (2018).
  18. Kujirai, T., et al. Structural basis of the nucleosome transition during RNA polymerase II passage. Science. 362 (6414), 595-598 (2018).
  19. Szychowski, J., et al. Cleavable biotin probes for labeling of biomolecules via azide-alkyne cycloaddition. Journal of the American Chemical Society. 132 (51), 18351-18360 (2010).
check_url/59497?article_type=t

Play Video

Cite This Article
Noe Gonzalez, M., Conaway, J. W., Conaway, R. C. Artificial RNA Polymerase II Elongation Complexes for Dissecting Co-transcriptional RNA Processing Events. J. Vis. Exp. (147), e59497, doi:10.3791/59497 (2019).

View Video