Waiting
Traitement de la connexion…

Trial ends in Request Full Access Tell Your Colleague About Jove

Biochemistry

Crystal Structure of the N-terminal Domain of Ryanodine Receptor from Plutella xylostella

Published: November 30, 2018 doi: 10.3791/58568
* These authors contributed equally

Summary

In this article, we describe the protocols of protein expression, purification, crystallization and structure determination of the N-terminal domain of ryanodine receptor from diamondback moth (Plutella xylostella).

Abstract

Development of potent and efficient insecticides targeting insect ryanodine receptors (RyRs) has been of great interest in the area of agricultural pest control. To date, several diamide insecticides targeting pest RyRs have been commercialized, which generate annual revenue of 2 billion U.S. dollars. But comprehension of the mode of action of RyR-targeting insecticides is limited by the lack of structural information regarding insect RyR. This in turn restricts understanding of the development of insecticide resistance in pests. The diamondback moth (DBM) is a devastating pest destroying cruciferous crops worldwide, which has also been reported to show resistance to diamide insecticides. Therefore, it is of great practical importance to develop novel insecticides targeting the DBM RyR, especially targeting a region different from the traditional diamide binding site. Here, we present a protocol to structurally characterize the N-terminal domain of RyR from DBM. The x-ray crystal structure was solved by molecular replacement at a resolution of 2.84 Å, which shows a beta-trefoil folding motif and a flanking alpha helix. This protocol can be adapted for the expression, purification and structural characterization of other domains or proteins in general.

Introduction

Ryanodine receptors (RyRs) are specific ion channels, which mediate the permeation of Ca2+ ions across the sarcoplasmic reticulum (SR) membranes in muscle cells. Therefore, they play an important role in the excitation contraction coupling process. In its functional form, RyR assembles as a homo-tetramer with a molecular mass of >2 MDa, with each subunit comprising of ~5000 amino acid residues. In mammals, there are three isoforms: RyR1- skeletal muscle type, RyR2- cardiac muscle type and RyR3- ubiquitously expressed in different tissues1.

In insects there is only one type of RyR, which is expressed in muscular and nervous tissue2. Insect RyR is more similar to mammalian RyR2 with a sequence identity of about 47%3. Diamide insecticides targeting RyR of Lepidoptera and Coleoptera have been developed and marketed by major companies like Bayer (flubendiamide), DuPont (chlorantraniliprole) and Syngenta (cyantraniliprole). Since its relatively recent launch, diamide insecticides have become one of the fastest growing class of insecticides. Currently, the sales of these three insecticides annually have crossed 2 billion U.S. dollars with a growth rate of more than 50% since 2009 (Agranova).

Recent studies have reported the development of resistance in insects after a few generations of usage of these insecticides4,5,6,7,8. The resistance mutations in the transmembrane domain of RyRs from the diamondback moth (DBM), Plutella xylostella (G4946E, I4790M) and the corresponding positions in tomato leafminer, Tuta absoluta (G4903E, I4746M) show that the region might be involved in diamide insecticide binding as this region is known to be critical for gating of the channel4,8,9. Despite extensive research in this area, the exact molecular mechanisms of diamide insecticides remain elusive. Moreover, it is unclear whether the resistance mutations affect the interactions with diamides directly or allosterically.

Earlier studies have reported the structure of several RyR domains from mammalian species and the structure of full-length mammalian RyR1 and RyR2 by x-ray crystallography and cryo-electron microscopy, respectively10,11,12,13,14,15,16,17,18,19,20,21. But so far, no structure of insect RyR has been reported, which prohibits us from understanding the molecular intricacies of the receptor function as well as the molecular mechanisms of insecticide action and development of insecticide resistance.

In this manuscript, we present a generalized protocol for the structural characterization of N-terminal β-trefoil domain of ryanodine receptor from the diamondback moth, a destructive pest infecting cruciferous crops worldwide22. The construct was designed according to the published rabbit RyR1 NTD crystal structures23,24and the cryo-EM structural models16,17,18,19,20,21. This is the first high-resolution structure reported for insect RyR, which reveals the mechanism for channel gating and provides an important template for the development of species-specific insecticides using structure-based drug design. For structure elucidation, we employed x-ray crystallography, which is considered as the 'gold standard' for protein structure determination at near atomic resolution. Although the crystallization process is unpredictable and labor intensive, this step-by-step protocol will help researchers to express, purify and characterize other domains of insect RyR or any other proteins in general.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Gene Cloning, Protein Expression, and Purification

  1. PCR amplify DNA corresponding to protein of interest (residues 1-205 of DBM RyR, Genbank acc. no. AFW97408) and clone into pET-28a-HMT vector by Ligation-Independent Cloning (LIC)25. This vector contains a histidine tag, MBP tag and a TEV protease cleavage site at the N-terminus15.
    1. Design LIC primers for amplification of target gene with LIC-compatible 5’ extensions:
      Forward LIC primer:
      5’ TACTTCCAATCCAATGCAATGGCGGAAGCGGAAGGGG 3’
      Reverse LIC primer:
      5’ TTATCCACTTCCAATGTTATTATATGCCGGTCCCGTACGGC 3’
    2. Combine the reaction components (50 μL): 1 μL of DNA templates (100 ng/μL), 1 μL of forward primer (10 μM), 1 μL of reverse primer (10 μM), 0.5 μL of DNA polymerase (NEB), 5 μL of 10x reaction buffer, 1 μL of dNTP (25 mM), 40.5 μL of RNase free ddH2O.
      1. Place the reaction mixture in a PCR machine and run the following program.
      2. Incubate at 95 °C for 3 min, and then run 30 cycles of (95 °C for 30 s, 58 °C for 15 s, 72 °C for 1 min). Incubate at 72 °C for 5 min and then hold at 4 °C.
      3. Run the entire reaction mix (50 μL) on a 2% agarose gel and extract with a Gel Extraction Kit. Follow manufacturer’s protocol.
    3. Ligation-Independent Cloning (LIC)
      1. Perform SspI digestion (60 μL): 20 μL of vector DNA (50 ng/μL), 6 μL of 10x reaction buffer, 4 μL of SspI, and 30 μL of ddH2O. Incubate at 37 °C for 3 h. Run the entire reaction mix on 1% agarose gel and extract with a Gel Extraction Kit. Follow manufacturer’s protocol.
      2. Perform T4 DNA Polymerase treatment of the vector and insert DNA. Combine the following: 5 μL of vector or insert DNA (50 ng/μL), 2 μL of 10x T4 DNA Polymerase Buffer, 1 μL of dGTP (25 mM) for vector or 1 μL of dCTP (25 mM) for insert DNA, 1 μL of DTT (100 mM), 0.4 μL of T4 DNA Polymerase (LIC-qualified), and 9.6 μL of ddH2O. Incubate reactions at room temperature for 40 min. Heat-inactivate enzyme at 75 °C for 20 min.
        Note: The LIC vector and insert DNA must be treated in separate reactions.
      3. Perform the LIC annealing reaction. Combine the following: 2 μL of T4-treated insert DNA, 2 μL of T4-treated LIC vector DNA. Incubate reaction at room temperature for 10 min.
  2. Transform BL21 (DE3) E. coli cells with this recombinant plasmid.
    1. Thaw competent cells (50 μL in micro-centrifuge tube) on ice.
    2. Add approximately 1 μL (50 ng) of plasmid into the tube. Mix the cells and DNA by gently flicking the tube 2–3 times. Place the tube on ice for 20 min.
    3. Heat shock at 42 °C for 40 s. Place the tube on ice again for 2 min. Add 1 mL of room temperature LB media to the tube.
    4. Place the mixture tube in the 250 rpm shaker at 37 °C for 45 min. Spread 150–200 µL of the mixture onto the selection plates. Invert the plate and incubate overnight at 37 °C.
  3. Pick a single colony and culture the cells in 100 mL 2YT medium containing 50 µg/mL kanamycin at 37 °C overnight. Next morning, inoculate 1 L 2YT medium containing 50 µg/mL kanamycin with 10 mL of overnight culture and incubate in 37 °C shaker incubator at 250 rpm, until the OD600 reaches ~0.6. Thereafter induce the culture with IPTG to a final concentration of 0.4 mM and grow for another 5 h at 30 °C.
  4. Harvest the cells by centrifugation at 8,000 x g for 10 min at 4 °C, collect the cells and resuspend every 10 g cells in 40 mL lysis buffer (10 mM HEPES pH 7.4, 250 mM KCl, 10 mM β-mercaptoethanol, 25 μg/mL lysozyme, 25 μg/mL DNase, 1 mM PMSF).
    1. Disrupt it by sonication at 65% amplitude for 8 min with 1 s on and 1 s off. Remove the cell debris by centrifugation at 40,000 x g for 30 min at 4 °C. Filter the supernatant by passing through 0.22 μm filter and load it into the sample loop.
  5. Purify the fusion protein, cleave the tag and re-purify the target protein.
    1. Purify the fusion protein using Ni-NTA column (binding buffer: 10 mM HEPES pH 7.4, 250 mM KCl; elution buffer: 10 mM HEPES pH 7.4, 250 mM KCl, 500 mM imidazole) and purify by a purification system, with a linear gradient of 20–250 mM imidazole.
    2. Cleave the eluted target protein with TEV protease (1:50 ratio) overnight at 4 °C.
    3. Purify the cleavage reaction mixture by using amylose resin column (binding buffer: 10 mM HEPES pH 7.4, 250 mM KCl; elution buffer: 10 mM HEPES pH 7.4, 250 mM KCl, 10 mM maltose) and Ni-NTA column to remove the tag and TEV protease. The target protein will be in the flow-through fraction of these two columns.
    4. Dialyze the sample against dialysis buffer (10 mM Tris-HCl pH 8.8, 50 mM KCl, 10 mM β-mercaptoethanol to reduce the salt concentration. Purify the sample on a anion exchange column (binding buffer: 10 mM Tris-HCl pH 8.8, 10 mM β-mercaptoethanol; elution buffer: 10 mM Tris-HCl pH 8.8, 1 M KCl, 10 mM β-mercaptoethanol) by a linear gradient of 20–500 mM KCl in the elution buffer.
    5. As a final step in the purification process, concentrate the protein using centrifugal concentrator (10 kDa MWCO) and inject into a Superdex 200 26/600 gel-filtration column to check the homogeneity.
  6. Examine the purity of the protein by running it on a 15% SDS PAGE.
    NOTE: All columns are running on a protein purification system with a binding flow rate of 2 mL/min, and an elution flow rate of 4 mL/min except for gel-filtration at 1 mL/min.

2. Protein Preparation and Crystallization

  1. Concentrate the purified protein sample to 10 mg/mL using centrifugal concentrator (10 kDa MWCO) and buffer exchange to crystallization buffer before storing at -80 °C.
  2. Perform crystallization screening (1:1 ratio, 200 nL of protein and 200 nL of reservoir buffer) by the sitting drop vapor diffusion method at 295 K with several crystallization kits using an automated liquid handling robotic system in a 96-well format.
    NOTE: We used kits from Molecular Dimensions and Hampton research and the Gryphon automated liquid handling system.
  3. Seal the 96-well crystallization plate to prevent evaporation and enable the equilibration of the protein drop with the reservoir buffer. Then keep the plates in the crystal incubator at 18 °C.
  4. Check the 96-well plates periodically using a light microscope to monitor crystal formation and growth.
  5. To differentiate protein crystals from salt crystals, use a protein dye. Add 1 µL of dye to the target drop. Wait for about 1 h and observe under microscope. The protein crystals will turn blue.
  6. Use the positive crystallization conditions (1.5 M ammonium sulfate, 0.1 M Tris pH 8.0) to further optimize the crystals using hanging drop vapor-diffusion method in 24-well plates.
    1. Optimize pH from 7.0 to 8.5 with 0.5 pH unit interval every step. Optimize concentration of ammonium sulfate from 1.2 M to 1.7 M with 0.1 M interval every step. (In our case the best condition producing large plate-shaped crystals was 0.1 M HEPES pH 7.0 and 1.6 M ammonium sulfate)

3. Crystal Mounting, X-Ray Data Collection, and Structure Determination

  1. Mount crystals in a cryoloop and flash-cool in liquid nitrogen using reservoir solution containing 20% glycerol as cryo-protectant. Place the crystals in unipuck for storage and transportation.
  2. Pre-screen protein crystals using a Rigaku in-house X-ray diffractor. Choose the best ones with the highest resolutions for data collection at synchrotron facilities (our dataset was collected from BL17U1 at Shanghai Synchrotron Radiation Facility).
    1. Use the beamline control software BluIce26 to mount and center the crystals by automatic or manual centering function. Perform test exposures to determine the data collection strategy, including starting angle, exposure time, detector distance, frame width and numbers.
    2. Collect dataset accordingly (we collected 180 frames with 1 s exposure time, 1° frame width and the detector distance of 350 mm).
  3. Index, integrate and scale the dataset using HKL2000 suite27. First carry out the peak search function to find the diffraction spots, and then index the spots and select the right space group. After peak integration, scale the dataset with the proper error model and save the output .sca file.
  4. Solve the phase problem by molecular replacement using Phaser28 in PHENIX29.
    1. Calculate the possible copy number of protein molecules in the asymmetric unit by Xtriage30.
    2. Look for the proper structure templates with high sequence identity and structural similarity as the target protein using known structures from literature or the models generated by structure prediction server such as Phyre231 (we used rabbit RyR1 NTD as a search model, PDB ID 2XOA).
    3. Run Phaser using the diffraction data file, the template structure file and the protein sequence file to find the solution.
  5. Perform AutoBuild32 in PHENIX29 to generate the initial model using the output file from Phaser and the sequence file from the target protein.
  6. Manually build the structure into the modified experimental electron density using Coot33 and refine using phenix.refine34 in iterative cycles.
  7. Validate the final model using the validation tools in PHENIX18.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Purification

The N-terminal domain of DBM RyR was expressed as a fusion protein with a hexahistidine tag, a MBP tag and a TEV protease cleavage site. We followed a five-step purification strategy to obtain a highly pure protein, suitable for crystallization purpose. At first, the fusion protein was purified from the soluble fraction of cell lysate by Ni-NTA column (HisTrap HP). Next, the fusion protein was subjected to TEV protease cleavage and the hexahistidine-MBP moiety was removed by amylose resin column followed by Ni-NTA column. Further, the protein was purified by anion exchange column (Q Sepharose HP) and finally by gel-filtration column (Superdex 200 26/600). The final yield of purified protein from 1 L bacterial culture using 2YT media was ~4 mg. The purified protein showed a single band on SDS-PAGE at ~21 kDa (Figure 1). The elution volume from gel-filtration column confirmed the purified RyR NTD to be a monomer (Figure 1).

Crystallization

Initial crystallization screening in 96-well plates yielded crystals in several conditions. These conditions were selected for crystal optimization in 24 well plates. The most optimal condition where high quality plate-shape crystals were formed was 0.1 M HEPES pH 7.0 and 1.6 M ammonium sulfate (Figure 2).

Structure determination

Crystals obtained was diffracted to 2.84 Å on beamline BL17U1 at Shanghai Synchrotron Radiation Facility. The crystal was indexed in space group P61 with unit-cell parameters a = 170.13, b = 170.13, c = 51.763 Å, α = β = 90.00°, γ = 120°. For structure determination, molecular replacement was employed using rabbit RyR1 NTD as a search model in PHENIX. Further refinement of the structure was done in PHENIX to a final Rwork and Rfree of 21.63 and 24.52%, respectively. The data collection and refinement statistics are listed in Table 1. The solved structure of DBM RyR NTD covering the residues 1-205 (PDB ID 5Y9V) is shown in Figure 3.

Figure 1
Figure 1: SDS-PAGE and gel filtration chromatogram representing purification of DBM RyR NTD35SDS PAGE (15%) in the inset shows purified DBM RyR NTD as a single band after the five step purification strategy. The left lane shows standard protein marker (PM). The gel filtration chromatogram obtained using a Superdex 200 26/600 column shows the elution peak at 240 mL, which corresponds to the monomeric form of the protein. Please click here to view a larger version of this figure.

Figure 2
Figure 2. Crystallization of DBM RyR NTD35Crystals of DBM RyR NTD produced by vapor-diffusion method as seen under a light microscope. The crystallization condition was 0.1 M HEPES pH 7.0 and 1.6 M ammonium sulfate. Scale bar = 200 µm. Please click here to view a larger version of this figure.

Figure 3
Figure 3: Structure of DBM RyR NTD (PDB ID 5Y9V)35Solved structure of the protein shown from two views. Secondary structure elements are labeled. β strands are shown in purple. α helix and a 310 helix are shown in blue. Loops are shown in white. Nt and Ct represent the N-terminal and C-terminal of the protein, respectively. Please click here to view a larger version of this figure.

Table 1: Data collection and refinement statistics for the DBM RyR NTD crystal35. Please click here to download this table.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

In this paper, we describe the procedure to recombinantly express, purify, crystallize and determine the structure of DBM RyR NTD. For crystallization, a crucial requirement is to obtain proteins with high solubility, purity and homogeneity. In our protocol, we chose to use pET-28a-HMT vector as it contains a hexahistidine tag and MBP tag, both of which could be utilized for purification to obtain a higher fold purity. Additionally, the MBP tag aids in the solubility of the target protein. We purified the protein by five consecutive steps which yielded protein that was highly pure and suitable for crystallization. Crystallization screening was performed using automated liquid handling system. Compared to traditional screening by manual drop setting, automated system uses very small volumes of sample, saves time and energy. It also enhances reproducibility due to accuracy of liquid handling. Crystals were diffracted in-house for screening and at synchrotron for data collection as it provides x-ray with higher intensity and less divergence, thereby yielding high quality data. Molecular replacement was our first choice as similar structural templates were available in the database. The alternative way is to use experimental phasing, including MAD, SAD, MIR, etc.

While solving the structure of DBM RyR NTD, the Matthews coefficients obtained from Xtriage30 suggested that the asymmetric unit (ASU) most likely contained four monomers with 46% solvent content, which has a probability of 49%. However, we could not find the right solution with four molecules in ASU. Subsequent runs to look for two, three, five, six molecules also failed. Eventually we found the right solution with only one molecule in ASU, which only has 4% probability and over 86% solvent content. The high water content was confirmed after we solved the structure. Thus, the extreme high solvent content does exist depending on the intrinsic way in which protein packs.

Although X-ray crystallography is a gold-standard in protein structure determination, proteins with large disorder or flexible regions and some large protein complexes with weak affinity are challenging to crystallize. Protein engineering methods, including loop-truncation, surface entropy reduction and cross-linking, might improve the chance of obtaining better protein crystals. Besides the revealing of high-resolution protein structures, X-ray crystallography can also be used to study the protein-pesticide interactions, which would help us on structure-based pesticide design. Qi et al. found that different families of diamides might bind to distinct sites that are different across species36. Using our strategy, one can determine the RyR structures from multiple species and identify the unique elements responsible for the observed species-specificity. Overall, this protocol can be adapted for expression, purification, crystallization and structure determination of any proteins or protein domains by themselves or in complex with small molecule drugs.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

The authors have nothing to disclose.

Acknowledgments

Funding for this research was provided by: National Key Research and Development Program of China (2017YFD0201400, 2017YFD0201403), National Nature Science Foundation of China (31320103922, 31230061), and Project of National Basic Research (973) Program of China (2015CB856500, 2015CB856504). We are grateful to the staff on the beamline BL17U1 at Shanghai Synchrotron Radiation Facility (SSRF).

Materials

Name Company Catalog Number Comments
pET-28a-HMT vector This modified pET vector contains a hexahistidine tag, an MBP fusion protein and a TEV protease cleavage site at the N-terminus (Lobo and Van Petegem, 2009)
E. coli BL21 (DE3) strain Novagen 69450-3CN
HisTrapHP column (5 mL) GE Healthcare 45-000-325
Amylose resin column New England Biolabs E8021S
Q Sepharose high-performance column  GE Healthcare 17-1154-01
Amicon concentrators (10 kDa MWCO) Millipore UFC901008
Superdex 200 26/600 gel-filtration column  GE Healthcare 28-9893-36
Automated liquid handling robotic system  Art Robbins Instruments Gryphon
96 Well CrystalQuick Greiner bio-one 82050-494
Uni-Puck Molecular Dimensions MD7-601
Mounted CryoLoop - 20 micron Hampton Research HR4-955
CryoWand Molecular Dimensions MD7-411
Puck dewar loading tool Molecular Dimensions MD7-607
Nano drop Thermo Scientific NanoDrop One
Crystal incubator Molecular Dimensions MD5-605
X-Ray diffractor Rigaku FRX
PCR machine Eppendorf Nexus GX2
Plasmid mini-prep kit Qiagen 27104
Gel extraction kit Qiagen 28704
SspI restriction endonuclease NEB R0132S
T4 DNA polymerase Novagen 2868713
Kanamycin Scientific Chemical 25389940
IPTG Genview 367931
HEPES Genview 7365459
β-mercaptoethanol Genview 60242
Centrifuge Thermo Scientific Sorvall LYNX 6000 
Sonnicator Scientz II-D
Protein purification system GE Healthcare Akta Pure
Light microscope Nikon SMZ745
IzIt crystal dye Hampton Research HR4-710
Electrophoresis unit Bio-Rad 1658005EDU
Shaker Incubator Zhicheng ZWYR-D2401
Index crystal screen Hampton Research HR2-144
Structure crystal screen Molecular Dimensions MD1-01
ProPlex crystal screen Molecular Dimensions MD1-38
PACT premier crystal screen Molecular Dimensions MD1-29
JCSG-plus crystal screen Molecular Dimensions MD1-37

DOWNLOAD MATERIALS LIST

References

  1. Giannini, G., Sorrentino, V. Molecular structure and tissue distribution of ryanodine receptors calcium channels. Medicinal Research Reviews. 15 (4), 313-323 (1995).
  2. Takeshima, H., et al. Isolation and characterization of a gene for a ryanodine receptor/calcium release channel in Drosophila melanogaster. FEBS Letters. 337 (1), 81-87 (1994).
  3. Sattelle, D. B., Cordova, D., Cheek, T. R. Insect ryanodine receptors: molecular targets for novel pest control chemicals. Invertebrate Neuroscience. 8 (3), 107-119 (2008).
  4. Steinbach, D., et al. Geographic spread, genetics and functional characteristics of ryanodine receptor based target-site resistance to diamide insecticides in diamondback moth, Plutella xylostella. Insect Biochemistry and Molecular Biology. 63, 14-22 (2015).
  5. Wang, X., Khakame, S. K., Ye, C., Yang, Y., Wu, Y. Characterisation of field-evolved resistance to chlorantraniliprole in the diamondback moth, Plutella xylostella, from China. Pest Management Science. 69 (5), 661-665 (2013).
  6. Liu, X., Wang, H. Y., Ning, Y. B., Qiao, K., Wang, K. Y. Resistance Selection and Characterization of Chlorantraniliprole Resistance in Plutella xylostella (Lepidoptera: Plutellidae). Journal of Economic Entomology. 108 (4), 1978-1985 (2015).
  7. Guo, L., et al. Functional analysis of a point mutation in the ryanodine receptor of Plutella xylostella (L.) associated with resistance to chlorantraniliprole. Pest Management Science. 70 (7), 1083-1089 (2014).
  8. Troczka, B., et al. Resistance to diamide insecticides in diamondback moth, Plutella xylostella (Lepidoptera: Plutellidae) is associated with a mutation in the membrane-spanning domain of the ryanodine receptor. Insect Biochemistry and Molecular Biology. 42 (11), 873-880 (2012).
  9. Roditakis, E., et al. Ryanodine receptor point mutations confer diamide insecticide resistance in tomato leafminer, Tuta absoluta (Lepidoptera: Gelechiidae). Insect Biochemistry and Molecular Biology. 80, 11-20 (2017).
  10. Borko, L., et al. Structural insights into the human RyR2 N-terminal region involved in cardiac arrhythmias. Acta Crystallographica Section D. 70 (Pt 11), 2897-2912 (2014).
  11. Sharma, P., et al. Structural determination of the phosphorylation domain of the ryanodine receptor. FEBS Journal. 279 (20), 3952-3964 (2012).
  12. Kimlicka, L., Lau, K., Tung, C. C., Van Petegem, F. Disease mutations in the ryanodine receptor N-terminal region couple to a mobile intersubunit interface. Nature Communications. 4, 1506 (2013).
  13. Lau, K., Van Petegem, F. Crystal structures of wild type and disease mutant forms of the ryanodine receptor SPRY2 domain. Nature Communications. 5, 5397 (2014).
  14. Amador, F. J., et al. Crystal structure of type I ryanodine receptor amino-terminal beta-trefoil domain reveals a disease-associated mutation "hot spot" loop. Proceedings of the National Academy of Sciences of the United States of America. 106 (27), 11040-11044 (2009).
  15. Lobo, P. A., Van Petegem, F. Crystal structures of the N-terminal domains of cardiac and skeletal muscle ryanodine receptors: insights into disease mutations. Structure. 17 (11), 1505-1514 (2009).
  16. des Georges, A., et al. Structural Basis for Gating and Activation of RyR1. Cell. 167 (1), 145-157 (2016).
  17. Efremov, R. G., Leitner, A., Aebersold, R., Raunser, S. Architecture and conformational switch mechanism of the ryanodine receptor. Nature. 517 (7532), 39-43 (2015).
  18. Peng, W., et al. Structural basis for the gating mechanism of the type 2 ryanodine receptor RyR2. Science. 354 (6310), (2016).
  19. Wei, R. S., et al. Structural insights into Ca2+-activated long-range allosteric channel gating of RyR1. Cell Research. 26 (9), 977-994 (2016).
  20. Yan, Z., et al. Structure of the rabbit ryanodine receptor RyR1 at near-atomic resolution. Nature. 517 (7532), 50-55 (2015).
  21. Zalk, R., et al. Structure of a mammalian ryanodine receptor. Nature. 517 (7532), 44-49 (2015).
  22. Furlong, M. J., Wright, D. J., Dosdall, L. M. Diamondback moth ecology and management: problems, progress, and prospects. Annual Review of Entomology. 58, 517-541 (2013).
  23. Amador, F. J., et al. Crystal structure of type I ryanodine receptor amino-terminal beta-trefoil domain reveals a disease-associated mutation "hot spot" loop. Proceedings of the National Academy of Sciences of the United States of America. 106 (27), 11040-11044 (2009).
  24. Lobo, P. A., Van Petegem, F. Crystal Structures of the N-Terminal Domains of Cardiac and Skeletal Muscle Ryanodine Receptors: Insights into Disease Mutations. Structure. 17 (11), 1505-1514 (2009).
  25. Aslanidis, C., de Jong, P. J. Ligation-independent cloning of PCR products (LIC-PCR). Nucleic Acids Research. 18 (20), 6069-6074 (1990).
  26. Stepanov, S., et al. JBluIce-EPICS control system for macromolecular crystallography. Acta Crystallographica Section D. 67 (3), 176-188 (2011).
  27. Minor, W., Cymborowski, M., Otwinowski, Z., Chruszcz, M. HKL-3000: the integration of data reduction and structure solution--from diffraction images to an initial model in minutes. Acta Crystallographica Section D. 62 (Pt 8), 859-866 (2006).
  28. McCoy, A. J., et al. Phaser crystallographic software. Journal of Applied Crystallography. 40 (Pt 4), 658-674 (2007).
  29. Adams, P. D., et al. PHENIX: a comprehensive Python-based system for macromolecular structure solution. Acta Crystallographica Section D. 66 (Pt 2), 213-221 (2010).
  30. Zwart, P. H., Gross-Kunstleve, R. W., Adams, P. D. Xtriage and Fest: Automatic assessment of X-ray data and substructure structure factor estimation. CCP4 Newsletter. (43), 27-35 (2005).
  31. Kelley, L. A., Mezulis, S., Yates, C. M., Wass, M. N., Sternberg, M. J. The Phyre2 web portal for protein modeling, prediction and analysis. Nature Protocols. 10 (6), 845-858 (2015).
  32. Terwilliger, T. C., et al. Iterative model building, structure refinement and density modification with the PHENIX AutoBuild wizard. Acta Crystallographica Section D. 64 (Pt 1), 61-69 (2008).
  33. Emsley, P., Cowtan, K. Coot: model-building tools for molecular graphics. Acta Crystallographica Section D. 60, 2126-2132 (2004).
  34. Afonine, P. V., et al. Towards automated crystallographic structure refinement with phenix.refine. Acta Crystallographica Section D. 68 (Pt 4), 352-367 (2012).
  35. Lin, L., et al. Crystal structure of ryanodine receptor N-terminal domain from Plutella xylostella reveals two potential species-specific insecticide-targeting sites. Insect Biochemistry and Molecular Biology. 92, 73-83 (2018).
  36. Qi, S., Casida, J. E. Species differences in chlorantraniliprole and flubendiamide insecticide binding sites in the ryanodine receptor. Pesticide Biochemistry and Physiology. 107 (3), 321-326 (2013).

Tags

Ryanodine Receptor Crystal Structure Plutella Xylostella Molecular Mechanism Insecticide Action Insecticide Resistance X-ray Crystallography Protein Structure Determination High-resolution Structure Channel Gating Species-specific Insecticides Structure-based Drug Design Biochemistry Biophysics Computer Science Maths Polymerase Chain Reaction Agarose Gel Gel Extraction Kit LIC Vector DNA SspI Restriction Enzyme
Crystal Structure of the N-terminal Domain of Ryanodine Receptor from <em>Plutella xylostella</em>
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Nayak, B. C., Wang, J., Lin, L., He, More

Nayak, B. C., Wang, J., Lin, L., He, W., You, M., Yuchi, Z. Crystal Structure of the N-terminal Domain of Ryanodine Receptor from Plutella xylostella. J. Vis. Exp. (141), e58568, doi:10.3791/58568 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter